A cd47 recombinant protein for inhibiting phagocytosis of macrophages and application thereof

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to a CD47 recombinant protein for inhibiting phagocytosis of macrophages and application thereof.The CD47 recombinant protein for inhibiting phagocytosis of macrophages comprises, in sequence, a CD47 extracellular domain, a signal peptide and a transmembrane domain; the amino acid sequence of the CD47 extracellular domain is shown as SEQ ID NO:1.The present application has the following technical effects: the present application provides a CD47 recombinant protein for inhibiting phagocytosis of macrophages, which can be combined with a SIRPalpha receptor and block a CD47-SIRPalpha signal by being expressed on the membrane surface of a CAR-T or CAR-NK cell.In order to solve the limitation of the prior art in CD47 antibody selection, the binding sequence of the CD47 recombinant protein provided by the present application is a CD47 protein extracellular domain fragment, which interacts with SIRPalpha on the macrophage.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant CD47 protein that inhibits macrophage phagocytosis and its applications. Background Technology

[0002] Immunosuppressive mechanisms in the tumor microenvironment (TME) are one of the major obstacles limiting the efficacy of existing immunotherapies. Myeloid cells, the most abundant immune cells in the TME, play a crucial role in tumorigenesis, development, and immune escape; therefore, therapeutic strategies targeting myeloid cells have become a hot topic in anti-tumor research. Studies have shown that elevated levels of tumor-associated macrophages (TAMs), an important component of myeloid cells, are closely associated with poor prognosis in various cancers. CD47, a "don't eat me" signaling molecule highly expressed on the surface of tumor cells, inhibits macrophage phagocytosis of tumor cells by binding to SIRPα on the surface of macrophages, thereby helping tumor cells evade immune surveillance. CD47 monoclonal antibodies, by blocking the CD47-SIRPα axis, can relieve this inhibition, enhance macrophage phagocytic activity, and remodel the tumor microenvironment. CD47 monoclonal antibodies have shown significant effects in various tumor models, inhibiting tumor growth and promoting tumor cell clearance. Early clinical trials have indicated that CD47 monoclonal antibodies have some efficacy against hematologic malignancies and some solid tumors, but the effects vary depending on tumor type and individual patient differences. However, the development of CD47 monoclonal antibodies suffered a significant setback when Gilead Sciences' Phase 3 clinical trial results for Magrolimab were presented at the 2024 European Society of Hematology (EHA) meeting. The results showed that the drug not only failed to achieve the expected efficacy but also potentially posed harm to patients. Consequently, increasing research is focusing on combination therapies using CD47 monoclonal antibodies.

[0003] Chimeric antigen receptor T / NK cell (CAR-T / CAR-NK) therapy has achieved significant results in the treatment of hematological malignancies, but its application in solid tumors still faces many challenges, including immunosuppression of the tumor microenvironment and insufficient persistence of CAR-T cells. Therefore, is combining CD47 monoclonal antibodies with CAR-T cell therapy a promising new approach for treating solid tumors? A recent study at Stanford University on the combination of anti-CD47 antibodies and CAR-T cell therapy found that anti-CD47 antibodies not only promote macrophage phagocytosis of cancer cells but also lead to rapid clearance of CAR-T cells, severely weakening the therapeutic effect of CAR T cell therapy. This study screened for a CD47 variant, CD47E, that binds to SIRPα but not to the CD47 antibody (B6H12) using yeast display. By expressing CD47E on CAR-T cells, researchers found that these engineered CAR-T cells could resist macrophage phagocytosis and persist in the tumor microenvironment after anti-CD47 antibody treatment (see the following reference: Engineered CD47 protects T cells for enhanced antitumour immunity. Nature. 2024 Jun;630(8016):457-465. doi: 10.1038 / s41586-024-07443-8. Epub2024 May 15.). Since the CD47E in this study was screened from a CD47 yeast library targeting B6H12, it only targets antibodies with the same binding modality as B6H12 and does not block antibodies with similar binding modalities to SIRPα, such as H59G4 or other antibodies with different binding modalities. Because different CD47 antibodies have different mechanisms of action and individual differences, different patients may be suitable for different CD47 antibodies. Engineered CD47E only has a blocking effect on a certain CD47 antibody, which limits its subsequent widespread application. Summary of the Invention

[0004] To address the technical challenge of combining CD47 antibodies with CAR-T or CAR-NK cells to enhance anti-tumor efficacy, overcome immunosuppression in the tumor microenvironment, and improve the persistence of CAR-T or CAR-NK cells, this invention provides a recombinant CD47 protein that inhibits macrophage phagocytosis and expresses it on the surface of CAR-T or CAR-NK cells. This allows the protein to protect CAR-T or CAR-NK cells from macrophage phagocytosis and enhance anti-tumor efficacy when used in combination with CD47 monoclonal antibody drugs. This invention relates to the structural design of the recombinant protein, methods for preparing CAR-T or CAR-NK cells expressing the recombinant protein, and the application of CAR-T or CAR-NK cells expressing the recombinant protein in combination with CD47 monoclonal antibody drugs for tumor treatment.

[0005] In a first aspect of the invention, a recombinant CD47 protein for inhibiting macrophage phagocytosis is provided, the recombinant protein comprising, sequentially, a CD47 extracellular domain, a signal peptide, and a transmembrane domain; the amino acid sequence of the CD47 extracellular domain is shown in SEQ ID NO:1. The specific sequence of SEQ ID NO:1 is GNYTCEVTELTSEGETIIELK.

[0006] In the recombinant CD47 protein of the present invention, the CD47 extracellular domain, signal peptide, and transmembrane domain each play the following roles: 1) CD47 extracellular domain: It is used to bind to the SIRPα receptor on the surface of macrophages, block the CD47-SIRPα signaling pathway, and inhibit macrophage phagocytosis. It is the core part that plays a role in this process.

[0007] 2) Signal peptide: used to guide the transport of recombinant proteins to the cell membrane.

[0008] 3) Transmembrane domain: used to fix recombinant proteins to the cell membrane.

[0009] In the recombinant CD47 protein of the present invention, the signal peptide and transmembrane domain can be any commonly used signal peptides and transmembrane domains in the art. Some signal peptides and transmembrane domains are listed in the present invention.

[0010] Furthermore, the nucleic acid encoding the CD47 extracellular domain is selected from any one of the following two: 1) Nucleic acids with sequences as shown in SEQ ID NO:2; 2) A protein that has at least 80% homology with the nucleic acid described in 1) and encodes the same or similar function as the nucleic acid described in 1).

[0011] Furthermore, the signal peptide is selected from one of CD8, CD28, IL-2, and GM-CSF.

[0012] Furthermore, the transmembrane domain is selected from one of CD28, CD3, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD134, CD137, ICOS, and CD154.

[0013] In a preferred embodiment of the present invention, the signal peptide is preferably a CD8 signal peptide, which encodes a nucleic acid sequence as shown in SEQ ID NO:3, or has a protein that has at least 80% homology with the nucleic acid shown in SEQ ID NO:3 and encodes the same or similar function as the nucleic acid.

[0014] In a preferred embodiment of the present invention, the transmembrane domain is preferably the CD8 transmembrane domain, which encodes a nucleic acid sequence as shown in SEQ ID NO:4, or has a protein that has at least 80% homology with the nucleic acid shown in SEQ ID NO:4 and encodes the same or similar function as the nucleic acid.

[0015] A second aspect of the invention provides a nucleic acid molecule encoding the CD47 recombinant protein as described in the first aspect.

[0016] The nucleic acid encoding the CD47 recombinant protein is selected from any one of the following two: 1) Nucleic acids with sequences as shown in SEQ ID NO:5; 2) A protein that has at least 80% homology with the nucleic acid described in 1) and encodes the same or similar function as the nucleic acid described in 1).

[0017] Furthermore, the nucleic acid molecule is a DNA molecule with the coding sequence shown in SEQ ID NO:5, or a DNA molecule with the nucleotide sequence shown in SEQ ID NO:5.

[0018] In a preferred embodiment of the present invention, the nucleic acid sequence encoding the recombinant protein is shown in SEQ ID NO:5. It is composed of the extracellular domain of the CD47 molecule (whose nucleic acid sequence is shown in SEQ ID NO:2), the CD8 signal peptide (whose nucleic acid sequence is shown in SEQ ID NO:3), and the CD8 transmembrane domain (whose nucleic acid sequence is shown in SEQ ID NO:4).

[0019] A third aspect of the present invention provides a biomaterial, said biomaterial being any one of the following: 1) An expression cassette containing nucleic acid molecules as described in the second aspect; 2) A recombinant vector containing nucleic acid molecules as described in the second aspect; 3) Recombinant microorganisms containing nucleic acid molecules as described in the second aspect; 4) Recombinant cells containing nucleic acid molecules as described in the second aspect.

[0020] In a fourth aspect of the invention, an engineered immune cell is provided, the immune cell expressing the CD47 recombinant protein as described in the first aspect.

[0021] Furthermore, the engineered immune cells are CAR-T or CAR-NK cells.

[0022] The method for preparing the engineered immune cells is as follows: First, CAR-T or CAR-NK cells to be modified are provided, and the cells are modified to express the CD47 recombinant protein, thereby obtaining the engineered immune cells.

[0023] In a fifth aspect of the invention, the use of the CD47 recombinant protein as described in the first aspect, the nucleic acid molecule as described in the second aspect, the biomaterial as described in the third aspect, or the engineered immune cell as described in the fourth aspect in the preparation of a drug for treating tumors is provided.

[0024] Furthermore, the tumors are selected from hematologic malignancies and solid tumors. Hematologic malignancies mainly include leukemia, lymphoma, and myeloma. Solid tumors mainly include lung cancer, stomach cancer, liver cancer, breast cancer, and prostate cancer.

[0025] In a sixth aspect of the invention, the use of engineered immune cells combined with CD47 monoclonal antibodies as described in the fourth aspect in the preparation of a drug for treating tumors is provided.

[0026] Furthermore, the tumors are selected from hematologic malignancies and solid tumors. Hematologic malignancies mainly include leukemia, lymphoma, and myeloma. Solid tumors mainly include lung cancer, stomach cancer, liver cancer, breast cancer, and prostate cancer.

[0027] The term "combination" in this application refers to the administration of the engineered immune cells and CD47 monoclonal antibody in combination therapy to cancer patients in need during treatment. The engineered immune cells and CD47 monoclonal antibody can be administered simultaneously, sequentially, or alternately, and can be administered via the same or different routes of administration. The dosages of the engineered immune cells and CD47 monoclonal antibody are respectively therapeutically effective amounts.

[0028] The recombinant CD47 protein of the present invention, which inhibits macrophage phagocytosis, is expressed on the surface of CAR-T or CAR-NK cells. When used in combination with CD47 monoclonal antibody drugs, it can protect CAR-T or CAR-NK cells, resist macrophage phagocytosis, enhance anti-tumor effects, and produce a synergistic effect.

[0029] CAR-T / CAR-NK cell therapy and macrophage-based CD47 monoclonal antibody therapy are both promising cancer treatments that activate different components of the immune system. Some studies have reported enhancing anti-tumor effects by combining anti-CD47 antibodies with adoptive T cells, but observed a weakening of the therapeutic effect due to rapid macrophage clearance of CAR-expressing T cells. Therefore, this invention provides a recombinant CD47 protein (tCD47) that inhibits macrophage phagocytosis, a CAR-T cell, a CAR-NK cell expressing this recombinant protein, and its application in CD47 monoclonal antibody combination therapy. This recombinant CD47 protein can bind to SIRPα on the surface of macrophages, inhibiting macrophage phagocytosis. This invention expresses this recombinant protein on the surface of CAR-T / CAR-NK cells, enabling them to protect CAR-T or CAR-NK cells from macrophage phagocytosis and enhance anti-tumor effects when used in combination with CD47 monoclonal antibody drugs. This not only solves a key problem in the combined therapy of anti-CD47 antibodies with CAR T or CAR-NK cells, but also provides a novel anti-tumor treatment strategy that can simultaneously activate CAR T or CAR-NK cells and macrophages.

[0030] In a seventh aspect of the invention, a pharmaceutical composition is provided comprising engineered immune cells and a CD47 monoclonal antibody drug as described in the fourth aspect. The pharmaceutical composition may also contain a pharmaceutically acceptable carrier.

[0031] The present invention has the following technical effects:

[0032] This invention provides a recombinant CD47 protein that inhibits macrophage phagocytosis. By expressing this recombinant protein on the surface of CAR-T or CAR-NK cell membranes, it can bind to the SIRPα receptor, blocking CD47-SIRPα signaling. Furthermore, to overcome the limitations of existing technologies in CD47 antibody selection, the binding sequence of the recombinant CD47 protein provided in this invention is a fragment of the extracellular domain of the CD47 protein, which interacts with SIRPα on macrophages. When this recombinant protein was expressed on CAR-T cells and co-incubated with macrophages, CD47 monoclonal antibodies with different mechanisms of action were added. It was found that the recombinant CD47 protein significantly reduced macrophage-mediated phagocytosis in all cases, regardless of the binding characteristics of the CD47 monoclonal antibodies. Therefore, the recombinant CD47 protein provided by this invention retains the macrophage phagocytic effect promoted by CD47 monoclonal antibodies while protecting CAR-T or CAR-NK cells from macrophage phagocytosis, allowing CAR-T and CAR-NK cells to persist in the tumor microenvironment after combined CD47 monoclonal antibody therapy.

[0033] The recombinant CD47 protein provided by this invention has a wide range of applications and is suitable for the combined use of various CD47 monoclonal antibodies. This invention not only solves a key problem in the combined therapy of anti-CD47 antibodies and CAR T / CAR-NK cells, but also provides a novel anti-tumor treatment strategy that can simultaneously utilize T / NK cells and macrophages. Through this novel engineered recombinant protein, a major obstacle in the treatment of solid tumors using CAR-T or CAR-NK cell therapy has been successfully overcome, significantly improving treatment efficacy. This discovery opens up new directions for future cancer immunotherapy and demonstrates strong application potential. Attached Figure Description

[0034] Figure 1 It is a DNA expression vector for CD47 recombinant protein.

[0035] Figure 2 The CD47 monoclonal antibody promotes the phagocytosis of tumor cells by macrophages. Figure A shows a flow cytometry plot of macrophage phagocytosis of tumor cells, with tumor cells labeled with CFSE and macrophages labeled with CD11b; Figure B is a statistical description of Figure A.

[0036] Figure 3 The CD47 recombinant protein inhibited the phagocytosis of tumor cells by macrophages. Figure A shows a flow cytometry plot of macrophage phagocytosis of tumor cells, with tumor cells labeled with CFSE and macrophages labeled with CD11b; Figure B is a statistical description of Figure A.

[0037] Figure 4 Using CD19 CAR-T as an example, this paper demonstrates the preparation of CAR-T cells expressing recombinant proteins. Figure A shows the flow cytometry results of the electroporation efficiency of CD47 recombinant protein; Figure B shows the expansion fold of CAR-T cells electroporated with recombinant protein and control group CAR-T cells; Figure C shows the killing effect of CAR-T cells electroporated with recombinant protein and control group CAR-T cells on target cells.

[0038] Figure 5 The CD47 recombinant protein inhibited the phagocytosis of CAR-T cells by macrophages. Figure A shows a flow cytometry plot of macrophage phagocytosis of CAR-T cells (using H59-G4 monoclonal antibody as an example), with CAR-T cells labeled with CFSE and macrophages labeled with CD11b; Figure B is a statistical graph of the phagocytosis of CAR-T cells by macrophages under the action of three different monoclonal antibody drugs.

[0039] Figure 6The combined use of CAR-T cells expressing recombinant CD47 protein and CD47 monoclonal antibody drugs enhanced the anti-tumor effect. Figure A shows the killing efficiency of CAR-T cells co-cultured with RAJI cells at different effector-to-target ratios; Figure B shows the killing efficiency of CAR-T cells co-cultured with HeLa cells overexpressing CD19 at different effector-to-target ratios. Detailed Implementation

[0040] The present invention will be further described below with reference to specific embodiments. These embodiments are only used to more clearly illustrate the technical solutions of the present invention and should not be construed as limiting the scope of protection of the present invention.

[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0042] Example 1 Construction of CD47 recombinant protein expression vector The extracellular domain of CD47 (encoding nucleic acid sequence shown in SEQ ID NO:2), along with the CD8 signal peptide (encoding nucleic acid sequence shown in SEQ ID NO:3) and the CD8 transmembrane domain (encoding nucleic acid sequence shown in SEQ ID NO:4), constitute a recombinant CD47 protein (encoding nucleic acid sequence shown in SEQ ID NO:5). The encoding nucleic acid sequence of the recombinant CD47 protein is ligated between the NheI and BstxI restriction sites of the pcDNA3.1(addgene) vector plasmid. P2A is tandemly linked to GFP protein to indicate the expression efficiency of the recombinant CD47 protein. This plasmid, named PCD-CD47, was synthesized by Anhui General Biotechnology. The expression vector structure is shown below. Figure 1 As shown.

[0043] The sequences of SEQ ID NO:2-5 are as follows: SEQ ID NO: 2: GGCAACTATAACCTGCGAAGTCACCGAACTGACCAGCGAAGGCGAAACATTATTGAACTGAAA.

[0044] SEQ ID NO: 3: ATGGCCCTGCCCGTGACCGCCCTGCTGCTGCCCCTGGCCCTGCTGCTGCACGCCGCCCGCCCC.

[0045] SEQ ID NO: 4: ACCACCACCCCCGCCCCCCGCCCCCCCACCCCCGCCCCCACCATCGCCAGCCAGCCCTGAGCCTGCGCCCCGAGGCCTGCCGCCCCGCCGCCGGCGGCCGCCGTGCACACCCGCGGCCTGGACTTCGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGCGGCGTGCTGCTGATGAGCCTGGTGATCACC.

[0046] SEQ ID NO:5:GGCAACTATAACCTGCGAAGTGACCGAACTGACCCGCGAAGGCGAAACCATTATTGAACTGAAATGGCCCTGCCCGTGACCGCCCTGCTGCTGCCCCTGGCCCTGCTGCTGCA CGCCGCCCGCCCCACCACCACCCCCGCCCCCCGCCCCCCCACCCCCGCCCCCACCATCGCCAGCCAGCCCCTGAGCCTGCGCCCCGAGGCCTGCCGCCCCGCCGCCGGCGGCCGCCGTGCACACCCGCGGCCTGGACTTCGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGCGGCGTGCTGCTGCTGAGCCTGGTGATCACC.

[0047] Example 2: In vitro transcription of CD47 recombinant protein mRNA The plasmid constructed in Example 1 was digested with restriction endonucleases, and the linear plasmid was purified and recovered by DNA gel electrophoresis as a template for in vitro transcription. In vitro transcription was performed using the T7 In vitro transcription kit (NEB, E2060S), and the reaction system was prepared according to the manufacturer's instructions as follows: 2X ARCA / NTP Mix 10μl Template DNA 2 μl (0.1 μg) T7 RNA Polymerase Mix 2μl Enzyme-free water to 20 μl After thoroughly mixing the above reaction system, incubate at 37°C for 30 minutes. After the reaction is complete, add 2 μl of DNase I, mix well, and incubate at 37°C for 15 minutes to remove the template DNA.

[0048] The above reaction solution was further subjected to a polyadenylation reaction to prepare the following reaction system: 20 μl of H2O 20 μl of the above reaction solution 10X Poly(A) Polymerase Reaction Buffer 5μl Poly(A) Polymerase 5μl After thorough mixing, incubate at 37°C for 30 minutes, recover the reaction solution, and purify the mRNA. Add 25 μl of lithium chloride solution to the above reaction and mix thoroughly, then incubate at -20°C for 30 minutes. Centrifuge at 12000 rpm for 15 minutes at 4°C to precipitate the RNA. Wash the particles with 500 μl of cold 70% ethanol and centrifuge at 4°C for 10 minutes. Discard the supernatant, resuspend the mRNA in 50 μl of 0.1 mM EDTA storage solution, mix thoroughly, and store at -20°C for later use.

[0049] Example 3: Macrophage culture and detection of tumor cell phagocytosis PBMCs were isolated from peripheral blood, and CD14 magnetic beads (Miltenyi) were used to separate CD14 from the PBMCs. + Cells were further induced into macrophages. The isolated cells were seeded in RPMI 1640 medium containing 10% fetal bovine serum, with 50 ng / ml of M-GSF (biolegend) added. The medium was replaced with half the volume every 2-3 days, and cultured for 7 days. Cell morphology was observed to be irregular and possessing pseudopodia. Macrophages were collected and incubated with tumor cell lines at a macrophage:target cell ratio of 2:1. Target cell lines A549, Raji, and SW480 were selected, representing lung cancer, B-cell lymphoma, and colon cancer cells, respectively, all of which highly expressed CD47 protein as detected by CD47 antibody. Target cells were pre-labeled with CFSE (MCE), and macrophages were labeled with CD11b (biolegend). Figure 2 A and Figure 2 As shown in Figure B, the phagocytic activity of macrophages on tumor cells was significantly enhanced after the addition of 10 μg / ml CD47 monoclonal antibody (MCE, H59-G4), indicating that the binding of CD47 monoclonal antibody to CD47 protein on tumor cells further inhibited the CD47-SIRPα signaling pathway and promoted the phagocytosis of tumor cells by macrophages.

[0050] Example 4: CD47 recombinant protein inhibited macrophage phagocytosis of tumor cells. To preliminarily verify that the recombinant CD47 protein can mimic the function of the CD47 molecule pair, activating the CD47-SIRPα signaling pathway upon binding to SIRPα on macrophages, and inhibiting macrophage phagocytosis in the presence of CD47 monoclonal antibody, the purified mRNA obtained in Example 2 was transfected into tumor cells via liposomes (Beyotime). Subsequently, tumor cells expressing the recombinant CD47 protein were co-incubated with induced macrophages using the same incubation method as in Example 3. The results are as follows: Figure 3 A and Figure 3 As shown in B, transduction of recombinant CD47 protein in tumor cells (tCD47 group) can significantly inhibit CD47 monoclonal antibody-mediated macrophage phagocytosis.

[0051] Example 5: Preparation of CAR-T cells expressing recombinant CD47 protein To further verify whether the CD47 recombinant protein of this invention can inhibit macrophage phagocytosis in CAR-T / CAR-NK cells, this embodiment further expresses the CD47 recombinant protein in CD19 CAR-T cells to describe the function of the CD47 recombinant protein. Three healthy donors were selected. First, human peripheral blood PBMCs were isolated, stimulated with CD3 / CD28 cytokines (Novoprotein) for 24 hours, and then infected with CD19 CAR-T lentivirus. The lentivirus was prepared using suspension 293T cells. The CD19 CAR carries a Myc tag, facilitating subsequent detection of CAR expression efficiency and sorting of CAR+ cells. On day 3 post-infection, infected T cells were stained with anti-Myc-conjugated PE fluorescent antibody (CST) and further sorted using PE magnetic beads (Miltenyi). The sorted CAR+ T cells were then cultured and expanded for another 3 days. CAR-T cells were harvested, and the mRNA of the CD47 recombinant protein expressed in Example 2 was introduced into the CAR-T cells via electroporation. Electroporation was performed using a Celestix electroporation system, following the instructions. Electroporation buffer was prepared at a 1:1 ratio of solution A to solution B. CAR-T cells were counted at 10 million. 100 μl of electroporation buffer was added to resuspend the cells, and 10 μg of mRNA was added. The Celestix electroporator was set to cellline mode at 480V. After electroporation, the cells were transferred to culture medium and cultured for 24 hours. GFP expression was observed (as explained in Example 1, GFP indirectly indicates the expression efficiency of the CD47 recombinant protein). The results showed that the expression efficiency of both the CD47 recombinant protein and CAR reached over 80% (see results below). Figure 4 A). Furthermore, the expansion of T cells in electroporated CAR-T cells compared to unelectroplated CAR-T cells (see results). Figure 4 B) and killing of target cells (results are shown in...) Figure 4C) No significant differences were observed. This indicates that the introduction of recombinant CD47 protein had no effect on T cell proliferation and effector activity.

[0052] Example 6: Functional verification of CAR-T cells expressing recombinant CD47 protein against macrophage phagocytosis To further verify that the recombinant CD47 protein can effectively inhibit macrophage killing in the presence of CD47 monoclonal antibody, CD19 CAR-T cells expressing recombinant CD47 protein prepared in Example 5 were first co-incubated with induced macrophages at a ratio of 2:1, in the same manner as in Example 3. Since different CD47 monoclonal antibodies may bind to CD47 protein in different ways, to further test whether the recombinant CD47 protein of this invention is effective against macrophage phagocytosis mediated by different CD47 monoclonal antibodies, three CD47 monoclonal antibodies with different binding modes (H59-G4, B6H12, CV-1) were selected in this example. Figure 5 Figure A shows a flow cytometry diagram of the phagocytic activity of macrophages on CAR-T cells expressing small short peptides and control CAR-T cells in the presence of H59-G4 monoclonal antibody. Figure 5 B is a statistical graph showing the phagocytic activity of macrophages on CAR-T cells under the action of three different monoclonal antibody drugs. It indicates that the binding sites of CD47 monoclonal antibody drugs with different binding mechanisms do not affect the inhibition of macrophage phagocytosis by recombinant CD47 protein.

[0053] Example 7: CAR-T cells expressing recombinant CD47 protein combined with CD47 monoclonal antibody enhance antitumor activity. This embodiment further verifies whether CD19 CAR-T cells expressing recombinant CD47 protein, as described in Example 6, can enhance antitumor activity when used in combination with CD47 monoclonal antibody. First, the following co-culture system was set up: the experimental group consisted of CD19 CAR-T cells expressing recombinant CD47 protein, macrophages, and target cells (Raji cells naturally expressing CD19 or HeLa cells stably overexpressing CD19) mixed and seeded at different effector-target ratios. 10 μg / ml of CD47 monoclonal antibody (MCE, H59-G4) was added to the experimental group co-culture system, while no CD47 monoclonal antibody was added to the control group. After 8 hours of incubation, the lysis rate of tumor cells was detected by bioluminescence to quantify its antitumor activity. The results are as follows: Figure 6 A- Figure 6As shown in Figure B, in the presence of CD47 monoclonal antibody, the lysis rate of CD19 CAR-T cells expressing recombinant CD47 protein against target cells was significantly higher than that of the control group without CD47 monoclonal antibody. This result confirms that the expression of recombinant CD47 protein can significantly enhance the antitumor activity of CAR-T cells in combination with CD47 monoclonal antibody, indicating that the CAR-T cells expressing recombinant CD47 protein constructed in this invention, when used in combination with CD47 monoclonal antibody, have a superior tumor-killing effect.

[0054] The above are merely embodiments of the present invention and do not limit the scope of the patent. Any equivalent modifications made based on the content of this specification, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.

Claims

1. A recombinant CD47 protein that inhibits macrophage phagocytosis, characterized in that, The recombinant protein is composed of a CD47 extracellular domain, a signal peptide, and a transmembrane domain, in sequence; the amino acid sequence of the CD47 extracellular domain is shown in SEQ ID NO:

1.

2. The CD47 recombinant protein for inhibiting macrophage phagocytosis according to claim 1, characterized in that, The nucleic acid encoding the CD47 extracellular domain is selected from any one of the following two: 1) Nucleic acids with sequences as shown in SEQ ID NO:2; 2) A protein that has at least 80% homology with the nucleic acid described in 1) and encodes the same or similar function as the nucleic acid described in 1).

3. The CD47 recombinant protein for inhibiting macrophage phagocytosis according to claim 1, characterized in that, The signal peptide is selected from one of CD8, CD28, IL-2, and GM-CSF.

4. The CD47 recombinant protein for inhibiting macrophage phagocytosis according to claim 1, characterized in that, The transmembrane domain is selected from one of CD28, CD3, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD134, CD137, ICOS, and CD154.

5. A nucleic acid molecule encoding the CD47 recombinant protein as described in any one of claims 1-4, characterized in that, The nucleic acid encoding the CD47 recombinant protein is selected from any one of the following two: 1) Nucleic acids with sequences as shown in SEQ ID NO:5; 2) A protein that has at least 80% homology with the nucleic acid described in 1) and encodes the same or similar function as the nucleic acid described in 1).

6. A biomaterial, characterized in that, The biomaterial is any one of the following: 1) An expression cassette containing the nucleic acid molecule as described in claim 5; 2) A recombinant vector containing the nucleic acid molecule as described in claim 5; 3) Recombinant microorganisms containing the nucleic acid molecules as described in claim 5; 4) Recombinant cells containing the nucleic acid molecules as described in claim 5.

7. An engineered immune cell, characterized in that, The immune cells express the recombinant CD47 protein as described in any one of claims 1-4.

8. The engineered immune cells according to claim 7, characterized in that, The engineered immune cells are CAR-T or CAR-NK cells.

9. The use of the CD47 recombinant protein as described in any one of claims 1-4, the nucleic acid molecule as described in claim 5, the biomaterial as described in claim 6, or the engineered immune cell as described in any one of claims 7-8 in the preparation of a drug for treating tumors.

10. The use of engineered immune cells combined with CD47 monoclonal antibody as described in any one of claims 7-8 in the preparation of a drug for treating tumors.

Images