Botrytis cinerea ibc-248 and application thereof in preventing and treating botrytis cinerea and / or promoting plant growth
By using the Botrytis cinerea IBc-248 microbial preparation, the problem of rapid drug resistance evolution in the control of gray mold by chemical fungicides has been solved, achieving environmentally friendly disease control and plant growth promotion effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-05-29
AI Technical Summary
Current technologies for controlling gray mold rely on chemical fungicides, leading to rapid evolution of resistance and excessive pesticide residues, and there is a lack of environmentally friendly control methods.
Botrytis cinerea IBc-248 microbial preparation was used. It was inoculated into PDB medium, fermented, and prepared into a working solution with an OD600≥0.3. This solution was used for foliar spraying and seed soaking to promote plant root development and limit the incidence of gray mold.
It effectively prevents gray mold, promotes tomato root development, reduces costs and simplifies application procedures, and provides protection throughout the entire growth period.
Smart Images

Figure CN122104444A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Botrytis cinerea IBc-248 and its application in the prevention and control of gray mold in plants and / or the promotion of plant growth. Background Technology
[0002] Gray mold is an important plant disease that is widespread worldwide. Its pathogen is a fungus belonging to the genus *Botrytis* (…). Botrytis *Botrytis cinerea* spp.). This genus contains over 30 clearly identified species. Among them, *Botrytis cinerea* (*Botrytis cinerea*) is the most prominent. Botrytis cinerea Gray mold has the widest host range and is the most damaging, infecting more than 1,400 plant species across nearly 600 genera. It is widely distributed, appearing wherever its host plants grow, whether in tropical or frigid regions. It is considered one of the most devastating plant diseases, causing enormous yield losses before and after harvest. Globally, it causes over $10 billion in economic losses annually. At least €1 billion is spent annually on controlling gray mold.
[0003] The sexual stage of Botrytis cinerea is *Botrytis floccosum* (…). Botryotinia fuckeliana ), belonging to the phylum Ascomycota, class Leotiomycetes, order Helotiales, family Sclerotiniaceae, genus Botrytis. Botryotinia Traditional taxonomy classifies this fungus as a necrotrophic pathogen; however, some studies indicate that *Botrytis cinerea* exhibits a very brief biotrophic phase before triggering host cell death in the early stages of infection. *Botrytis cinerea* inhibits autophagy in the host plant to ensure its own nutrient supply and promote biomass accumulation. When biomass reaches a certain level, the fungus releases secondary metabolites and effector proteins, inducing and accelerating the host cell death process, thus completing the entire pathogenesis.
[0004] Botrytis cinerea overwinters and oversummers as mycelium or sclerotia in plant debris and soil. Conidia attached to the seed surface also have overwintering capabilities. Under suitable environmental conditions, conidia germinated from diseased plant debris or sclerotia can cause primary infection, spreading via air currents, water currents, and agricultural practices. Botrytis cinerea can infect all parts of the crop throughout its entire developmental cycle. Conidia attach to the plant surface and germinate to form germ tubes, which further develop into appressoria and infection pads, producing invasive hyphae that directly invade the host. They can also directly invade through stomata or penetrate the host epidermis directly through short germ tubes, producing numerous conidia at the diseased site that are spread by air currents and rainwater for secondary infection.
[0005] Botrytis cinerea, a major disease affecting greenhouse agriculture globally, presents challenges. On one hand, crop genetic resistance resources are scarce, and current control methods heavily rely on chemical fungicides. On the other hand, the pathogen exhibits strong resistance and is prone to mutation, leading to rapid evolution of drug resistance and a continuous decline in the efficacy of some chemical agents. More seriously, the widespread overuse of pesticides in the field to maintain control has resulted in excessive pesticide residues and accumulated ecotoxicity, impacting agricultural product safety and sustainable agricultural development. Against this backdrop, identifying environmentally friendly Botrytis cinerea strains has become an urgent priority. Summary of the Invention
[0006] The purpose of this invention is to provide a strain of Botrytis cinerea IBc-248 and its application in the control of gray mold and / or the promotion of plant growth; the Botrytis cinerea ( Botrytis cinerea IBC-248 can promote tomato root development without causing disease reactions and can also effectively limit the severity of gray mold.
[0007] This invention provides a Botrytis cinerea ( Botrytis cinerea )IBc-248, its accession number is CCTCC M2026254.
[0008] The present invention provides a microbial preparation containing the above-mentioned Botrytis cinerea IBc-248 and / or its fermentation broth.
[0009] As a preferred embodiment, the working solution concentration of the microbial preparation is OD. 600 ≥0.3.
[0010] As a preferred embodiment, the method for preparing the fermentation broth includes: inoculating Botrytis cinerea IBc-248 into PDB medium and shaking it at 140-180 r / min for 24-30 h at 20°C.
[0011] This invention provides the application of the above-mentioned Botrytis cinerea IBc-248 or the above-mentioned microbial preparation in the prevention and control of gray mold in plants and / or the promotion of plant growth.
[0012] As a preferred embodiment, the plant includes: tomato.
[0013] As a preferred embodiment, the growth includes root development.
[0014] This invention provides a method for preventing and controlling gray mold in plants, comprising the following steps: foliar spraying of the above-mentioned microbial preparation.
[0015] As a preferred embodiment, the application rate of the microbial agent is 3-15 mL / mu.
[0016] This invention provides a method for promoting plant growth, comprising the following steps: soaking seeds in the aforementioned microbial preparation.
[0017] Beneficial effects: This invention provides a Botrytis cinerea (… Botrytis cinerea The strain described in this invention, Botrytis cinerea IBC-248, has the preservation number CCTCC M 2026254. This strain is not only non-pathogenic to tomato plants but also effectively controls gray mold and can colonize tomato roots through seed initiation. As the plant grows, Botrytis cinerea IBC-248 can endogenously expand to the stems and leaves, providing continuous protection throughout the tomato's growth cycle. This characteristic significantly simplifies application methods and reduces costs. Furthermore, Botrytis cinerea IBC-248 promotes root development: it promotes root growth in the early stages of tomato seed germination and significantly increases the number of interroots and total root length in mature plants.
[0018] Biological Preservation Information Botrytis cinerea ( Botrytis cinerea The strain IBc-248 was deposited at the China Center for Type Culture Collection (CCTCC) on January 27, 2026, at Wuhan University, Wuhan, China, with accession number CCTCC M2026254. Attached Figure Description
[0019] Figure 1 The image shows the results of identifying strain IBc-248 using primers for identifying Botrytis cinerea; where M is the DL 2000 bp Marker; and H2O is the negative control. Figure 2 The image shows the results of pathogenicity testing of strain IBc-248 on detached tomato leaves. Figure 3 Figure 1 shows the results of colony morphology observation and growth rate measurement of Botrytis cinerea strain. In this figure, A represents the colony morphology of Botrytis cinerea strain, and B represents the growth rate of Botrytis cinerea strain. Figure 4 The graph shows the evaluation results of the fermentation broth of strain IBc-248 inhibiting tomato gray mold; where A represents the statistical effect of IBc-248 on the control of gray mold on live tomato leaves; and B represents the control effect on tomato leaves gray mold. Figure 5 For IBC-248 under a confocal microscope GFP Observation results of luminescence; where the scale bar = 100 µm; Figure 6 For strains B05.10 and IBc-248 GFP Image showing the results of pathogenicity testing on detached tomato leaves; Figure 7Figure 1 shows the observation results of the growth of tomato seedlings with non-pathogenic strains in the endophytic environment; where A shows the condition of tomato seedlings with strains IBc-248, strain B05.10, and tomato seedlings after sterile water treatment; B shows the endophytic condition of strain IBc-248 in the tomato roots observed under a confocal microscope, scale bar = 100 µm. Figure 8 Figure 1 shows the results of the observation of the biological phenotype and growth rate of re-isolated endophytic fungi from tomato plants; where A is a photo taken on the 3rd day after the re-isolated endophytic fungi from tomato plants were inoculated on a PDA; and B is the analysis of the growth rate of the re-isolated endophytic fungi from tomato plants. Figure 9 Figure 1 shows the identification results of endophytic fungi isolated from the plant; where A represents the identification results of the endophytic fungus *Botrytis cinerea* isolated from the plant using specific primers; B represents the identification results of the endophytic fungus *Hygromycin* isolated from the plant using primers; M represents the DL 2000bp Marker; isolated fungi 1-2 are endophytic fungi isolated from the stem; isolated fungi 3-8 are endophytic fungi isolated from the leaves; Figure 10 The figure shows the effect of the fermentation broth of the non-pathogenic strain IBc-248 on the germination rate of tomato seeds; where A represents the germination rate of tomato seeds treated with the non-pathogenic strain 72 h after treatment; and B represents the germination rate of tomato seeds treated with the non-pathogenic strain 72 h after treatment. Figure 11 The graph shows the evaluation results of the growth-promoting effect of the non-pathogenic strain IBc-248 on tomato seeds; where A represents the root length of tomato seeds treated with the non-pathogenic strain 72 h later; and B represents the root length of tomato seeds treated with the non-pathogenic strain 72 h later. Figure 12 The image shows the evaluation results of the root growth promotion potential of the non-pathogenic strain IBc-248 on tomato plants; where A represents the evaluation of the effect of promoting total root length; B represents the evaluation of the effect of promoting root tip number; C represents the evaluation of the effect of promoting root surface area; and D represents a scan of the plant root system. The statistical method used was the t-test, and the error bars represent the standard deviation of the data within the group; in the figure... This indicates that there are significant differences between different samples. p <0.05), This indicates that there are significant differences between different samples. p <0.01), This indicates that there are significant differences between different samples. p <0.001), This indicates that there are highly significant differences between different samples. p<0.0001), ns indicates that there is no significant difference between different samples ( p >0.05). Detailed Implementation
[0020] This invention provides a Botrytis cinerea ( Botrytis cinerea )IBc-248, its accession number is CCTCC M2026254.
[0021] This invention isolates strain IBc-248 from strawberries. The mycelium of strain IBc-248 is milky white and lacks melanin deposition, with regular colony edges and no fan-shaped mutations. The strain IBc-248 described in this invention is non-pathogenic, can grow endophytically in tomatoes, and promotes tomato root development without inducing pathogenic reactions, while also effectively limiting the severity of gray mold.
[0022] As a preferred embodiment, using the extracted bacterial DNA as a template, 100 ng was mixed with the following reagents to prepare a 25 µL system: 0.5 µM each of Botrytis cinerea-specific forward and reverse primers Bc-f (as shown in SEQ ID NO.1: CAGGAAACACTTTTGGGGATA) and Bc-r (as shown in SEQ ID NO.2: GAGGGACAAGAAAATCGACTAA), 12.5 µL of 2 × Hieff® PCR Master Mix (With Dye) high-fidelity enzyme premix (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and deionized water was added to bring the volume to 25 µL. Primer information can be found in patent publication CN103146812A, entitled "A Botrytis cinerea-Specific PCR Detection Method". In a preferred embodiment, the PCR reaction conditions were as follows: 95℃ for 5 min; denaturation at 94℃ for 30 s; annealing at 58℃ for 30 s; extension at 72℃ for 30 min; 32 cycles; treatment at 72℃ for 10 min; and treatment at 16℃ for 5 min. Electrophoresis analysis showed that the strain exhibited a specific amplification product at the 327 bp position, which was identified as Botrytis cinerea.
[0023] This invention provides a microbial preparation containing *Botrytis cinerea* IBC-248 and / or its fermentation broth. 600The value can be any value within the range of ≥0.3, such as 0.3, 0.5, 0.8, 1.0, 1.2, or 1.5. As a preferred embodiment, the preparation method of the fermentation broth includes: inoculating Botrytis cinerea IBc-248 into PDB medium and shaking it at 140-180 r / min for 24-30 h at 20°C. The shaking speed can be any value within the range of 140-180 r / min, such as 140, 160, or 180 r / min; the shaking time can be any value within the range of 24-30 h, such as 24, 26, 28, or 30 h. Experimental results of this invention show that the fermentation broth of strain IBc-248 can inhibit tomato gray mold, promote root development in tomato plants, and has no pathogenicity.
[0024] This invention provides the application of the above-mentioned Botrytis cinerea IBc-248 or the above-mentioned microbial preparation in the control of gray mold and / or the promotion of plant growth. In a preferred embodiment, the plant includes: tomato. In a preferred embodiment, the growth includes: root development.
[0025] This invention provides a method for controlling gray mold in plants, comprising the following steps: foliar spraying of the aforementioned microbial preparation. The spraying dosage of the microbial preparation can be any value within the range of 3-15 L / acre, for example, 3, 5, 10, or 15 L / acre. As a preferred embodiment, when using manual spraying, the spraying dosage of the microbial preparation is 15 L / acre, containing 300 mL of *Botrytis cinerea* IBC-248 bacterial solution; when using drone spraying, the spraying dosage of the microbial preparation is 3 L / acre, containing 60 mL of *Botrytis cinerea* IBC-248 bacterial solution. Drone spraying has higher density and efficiency than manual spraying, and can significantly reduce the amount of biological preparation required. Spraying the aforementioned microbial preparation on tomato leaves can effectively limit the severity of gray mold.
[0026] This invention provides a method for promoting plant growth, comprising the following steps: soaking seeds in the aforementioned microbial preparation. Treatment of tomato seeds with the microbial preparation can promote seed and root development in the early stages of seed development.
[0027] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, describes a strain of Botrytis cinerea IBc-248 provided by the present invention and its application in the prevention and control of gray mold and / or the promotion of plant growth. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1 1. Strains Isolation Strawberry tissue blocks that have undergone surface sterilization were inoculated onto PDA plates containing ceftriaxone sodium (150 ppm), incubated at 20°C, and the resulting strain was isolated and designated as strain IBc-248.
[0029] 2. Extraction of genomic DNA from the strain Hyphae of strain IBC-248 were cultured on cellophane. Approximately 0.1 g of young hyphae were scraped using a sterile spatula, rapidly ground into powder in liquid nitrogen, and transferred to a 2 mL centrifuge tube. 1 mL of preheated (65℃) 2% CTAB extraction buffer was added, and the tube was incubated in a 65℃ water bath for approximately 30 min, gently inverting every 5 min to mix. After the water bath, the tube was centrifuged at 12000 r / min for 1 min at room temperature. The supernatant was collected, and hyphal fragments and insoluble impurities were removed. 500 µL of chloroform and Tris-saturated phenol were added separately and mixed thoroughly. The tube was centrifuged at 12000 r / min for 10 min at room temperature. Approximately 900 µL of the supernatant was collected in a new 2 mL centrifuge tube. An equal volume of chloroform (900 µL) was added for extraction again, and the tube was centrifuged at 12000 r / min for 10 min at room temperature. Approximately 800 µL of the supernatant was collected using a pipette tip with the tip cut off, and an equal volume of chloroform (800 µL) was added to the centrifuge tube. Add µL of isopropanol, mix thoroughly, and precipitate at -20℃ for 20 min. Centrifuge at 12000 r / min for 15 min at room temperature. Discard the supernatant, wash the precipitate twice with 70% ethanol solution and remove residual ethanol. Dry at 37℃ for 10 min, dissolve in 30 µL of RNase water to obtain the genomic DNA of the strain, and store at -20℃.
[0030] 3. Identification of isolated strains using Botrytis cinerea-specific primers Using the extracted bacterial DNA as a template, 100 ng was mixed with the following reagents to prepare a 25 µL system: 0.5 µM each of Botrytis cinerea-specific forward and reverse primers Bc-f (as shown in SEQ ID NO.1: CAGGAAACACTTTTGGGGATA) and Bc-r (as shown in SEQ ID NO.2: GAGGGACAAGAAAATCGACTAA), 12.5 µL of 2×Hieff® PCR Master Mix (WithDye) high-fidelity enzyme premix (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and deionized water was added to bring the volume to 25 µL. The system was placed in a PCR instrument and subjected to the following treatments: 95℃ for 5 min; 94℃ for 30 s denaturation; 58℃ for 30 s annealing; 72℃ for 30 min extension; 32 cycles; 72℃ for 10 min; 16℃ for 5 min. After the reaction was complete, the PCR products were analyzed by 1% agarose gel electrophoresis, and the band size was marked with a DL 2000 bp marker. The results are shown in the figure. Figure 1 .
[0031] from Figure 1 As can be seen from the electrophoretic analysis, the strain exhibited specific amplification products at the 327 bp position. The strain IBc-248 was identified as *Botrytis cinerea*.
[0032] Example 2 1. Strains, culture medium and culture conditions Non-pathogenic Botrytis cinerea strain IBc-248 (hereinafter referred to as strain IBc-248).
[0033] Highly pathogenic Botrytis cinerea strain B05.10 (hereinafter referred to as strain B05.10, strain information can be found in: Amselem J et al., "Genomic analysis of the necrotrophic fungal pathogens Sclerotiniasclerotiorum and Botrytis cinerea.", PLoS Genet, 2011 Aug 18;7(8):e1002230).
[0034] The non-pathogenic strain IBc-248 and the highly pathogenic strain B05.10 were inoculated onto potato dextrose agar (PDA) plates and incubated at 20°C.
[0035] 2. Observation of pathogenicity of the strain After 4 days of culture on PDA plates, young mycelia were picked and cultured for another 4 days on 9 cm petri dishes containing 20 mL of PDA. Mycelial blocks from the colony edge (tangential to the colony edge) were then punched using a 0.3 cm diameter punch and inoculated onto the upper surface of healthy detached tomato leaves of similar size and growth condition. The leaves were then kept moist and placed in a 20℃ plant culture room for 48 hours before observing disease development. Pathogenicity tests were repeated at least three times; one test result was randomly selected and photographed. Figure 2 .
[0036] from Figure 2 It can be seen that the tomato leaves treated with strain B05.10 showed obvious pathogenicity, while the tomato leaves treated with strain IBc-248 showed no pathogenicity, indicating that strain IBc-248 is non-pathogenic.
[0037] 3. Study on the biological characteristics of the strain Growth rate and colony morphology of strain IBC-248 were measured: Mycelial blocks were extracted from the edge of activated strain colonies using a 5 mm diameter punch and inoculated into the center of a quantitative (20 mL) PDA plate. Strain B05.10 was used as a control. Four replicates were set for each strain. The plates were incubated at 20℃, and colony morphology was observed and photographed at 3 and 7 days. Results are shown in the table below. Figure 3 A.
[0038] Growth rate was determined using the cross-multiplication method, with measurements taken at 24 h and 48 h. The mycelial growth rate (mm / d) was calculated as (48 h colony diameter - 24 h colony diameter) / 2. The experiment was repeated twice, and a t-test was used for significance analysis. The results are shown below. Figure 3 See Table B and Table 1.
[0039] Table 1. Growth rate of Botrytis cinerea strain on PDA medium
[0040] Note: Different letters in the table represent highly significant differences between samples. p <0.0001).
[0041] from Figure 3 As shown in Figure A, colony morphology observation reveals that strain IBc-248 has milky-white mycelia without melanin deposition, regular colony edges without fan-shaped mutations, and completely loses its sporulation and sclerotium formation capabilities on PDA plates. Strain IBc-248 exhibits significant aerial mycelial proliferation characteristics.
[0042] from Figure 3 As can be seen from Figure B, the growth rate of the control strain B05.10 was 16.01±0.61 mm / d, which was significantly higher than the growth rate of the non-pathogenic strain IBc-248 (10.97±0.78 mm / d) by the mycelial expansion rate assessment.
[0043] 4. Experiment on the control effect of fermentation broth of non-pathogenic strains on gray mold. Strain strain IBc-248 was inoculated into a 250 mL Erlenmeyer flask containing 150 mL of PDB medium and incubated at 20°C and 160 r / min for 30 h. The mycelial fermentation broth was then broken up with a mixer and diluted with sterile water to an OD value. 600 It is 0.3.
[0044] Select live tomatoes that have grown for about 7-8 weeks and are of uniform growth. Choose the 3rd-4th layer of healthy leaves from the top and prepare them as OD. 600A 0.3% mycelial suspension was evenly sprayed onto the surface of tomato leaves to moisten them. The leaves were cultured at 95% relative humidity for 48 hours, and then inoculated with the highly pathogenic strain B05.10. Young mycelial fragments from the tips of strain B05.10 were punched using a 3 mm diameter punch and inoculated onto tomato leaves, followed by moisturizing treatment; this was the treatment group. An equal volume of water was sprayed as a negative control, designated as a mock. Each treatment was replicated in triplicate. The experiment was repeated twice. Leaf disease incidence was assessed and recorded 48 hours after inoculation, and a t-test was used for significance analysis. The results are shown below. Figure 4 See Table 2. The control efficacy was calculated based on the lesion area: control efficacy = (negative control lesion area - treatment group lesion area) / negative control lesion area × 100%.
[0045] Table 2. Control efficacy of strain IBC-248 against tomato gray mold.
[0046] from Figure 4 It can be seen that the fermentation broth of strain IBc-248 has a protective effect on live tomatoes, with a protection efficacy of 34.98%.
[0047] Example 3 1. PEG-mediated protoplast transformation of non-pathogenic bacterial strains into GFP protein-encoding genes Non-pathogenic strains may endophyte within host plants. To facilitate observation of the endophytic behavior of non-pathogenic strains in the host tomato, PEG-mediated protoplast transformation was used. Plasmids expressing green fluorescent protein (GFP) and hygromycin resistance genes were transferred into the non-pathogenic strain IBc-248, resulting in a hygromycin-resistant fluorescent strain, IBc-248. GFP .
[0048] Preparation of protoplasts: Botrytis cinerea IBC-248 was cultured on PDA plates lined with cellophane for 3 days. After 3 days, the hyphae were scraped off using a sterile spatula and cultured in 150 mL of PDB solution for 36 h. Once fine hyphae formed on the surface of the mycelial blocks, the PDB was filtered off using a layer of lens paper, and the mycelial balls were rinsed with 0.7 mol / L NaCl solution. The filtered mycelial balls were placed in 30 mL of enzyme lysis buffer (0.3 g of lysin dissolved in 0.7 mol / L NaCl solution, filtered through a bacterial filter for sterilization). The mixture was lysed at 28°C for 1 h using a shaker at 110 r / min. The solution was then collected by filtration through three layers of lens paper, centrifuged at 4°C at 5000 r / min for 10 min, and the supernatant was discarded. The protoplasts were first washed with 1 mL of STC solution, and then resuspended in 200 µL of STC solution.
[0049] Take 100 µL of protoplasts (1×10⁻⁶) 8Add 5 µg of plasmid 2cGFP (carrying a hygromycin resistance marker and a GFP gene cassette; plasmid information can be found in: Haidu, Study on the Ecological Adaptation Mechanism and Biocontrol Potential of Low-Virus-Related Viruses of Sclerotinia sclerotiorum, 2023, Huazhong Agricultural University), gently mix, and place on ice for 30 min. Then, add 200 µL, 200 µL, and 800 µL of PEG3350 (60% concentration) sequentially, and incubate on ice for 30 min. Finally, add 1 mL of STC solution to terminate the reaction, obtaining the reaction solution. Drop the reaction solution into an empty petri dish, add the melted regeneration medium (RM) to the dish, gently mix with a pipette tip, and incubate upright at 20°C. After 48 h, cover with a layer of WA medium containing hygromycin (final concentration 75 ppm). After 72 h, pick hyphae and subculture three times on PDA medium containing hygromycin.
[0050] strain IBc-248 and strain IBc-248 GFP Observation was performed under a confocal microscope, and the results are shown below. Figure 5 .
[0051] from Figure 5 As can be seen, IBC-248 can be clearly observed under a confocal microscope. GFP The hyphae emitted green fluorescence. Strains with strong green fluorescence signals were selected for subsequent experiments using confocal microscopy.
[0052] 2. The fluorescently labeled strain IBc-248 GFP Non-pathogenic Strains expressing GFP and hygromycin resistance were obtained through PEG-mediated protoplast transformation. GFP To clarify whether inserting a label affects pathogenicity, pathogenicity was determined on detached tomato leaves following the method used in step 2 of Example 2. The highly pathogenic strain B05.10 was used as a positive control. After being placed in a plant culture room at 20℃ for 3 days (72 hours), the disease incidence was observed. The results are shown below. Figure 6 .
[0053] from Figure 6 It can be seen that strain IBc-248 GFP The treated tomato leaves did not show any signs of pathogenicity, indicating that inserting the label did not change the non-pathogenic phenotype of the strain. IBC-248 can be used. GFP Replace IBC-248 for subsequent testing.
[0054] 3. Endophytic observation of non-pathogenic strains in tomato seedlings Tomato seeds were surface-sterilized. Soaked in 75% ethanol for 5 minutes, inverting the seeds continuously to ensure full contact with the ethanol. The ethanol was then discarded, and the seeds were rinsed three times with sterile water. Next, the seeds were soaked in a 2.5% sodium hypochlorite solution for 4 minutes. The sodium hypochlorite solution was discarded, and the seeds were rinsed three times with sterile water. The rinsed seeds were then sporadically applied to 1 / 2 MS medium for germination.
[0055] strain IBC-248 GFP The mycelial fermentation broth was inoculated into 250 mL Erlenmeyer flasks containing 150 mL of PDB medium and incubated at 20°C and 160 r / min for 30 h. The mycelial fermentation broth was then broken up with a mixer and diluted with sterile water to an OD value. 600 The concentration was 0.3, resulting in strain IBc-248. GFP Mycelial suspension.
[0056] Once the tomatoes have germinated on 1 / 2 MS medium and the roots have grown to 2-3 cm, add 100 mL of strain IBC-248. GFP bacterial suspension (concentration of OD) 600 Add 0.3 g of bacterial solution (OD2.5 concentration) to the base of the tomato plant, using a bacterial solution of strain B05.10 (OD2.5 concentration). 600 0.3 g of sterile water (labeled as "mock") and sterile water were used as controls. After the added bacterial solution was dried, the treated tomato seedlings were placed in a 20°C incubation room for 72 h of culture. After 72 h of culture, the roots were cut into 5 mm segments, directly pressed into slides, and the fluorescence was observed under a confocal microscope. The results are shown in the figure. Figure 7 .
[0057] from Figure 7 It can be seen that the non-pathogenic strain IBC-248 was used. GFP Fermentation broth and water of the highly pathogenic strain B05.10 were used to treat the roots of germinating tomato seedlings. After 3 days, the tomato seedlings treated with strain B05.10 failed to grow normally and almost died. The non-pathogenic strain IBC-248... GFP The treated tomato seedlings grew normally, and compared with the mock strain, no pathogenic strain IBC-248 was observed. GFP The treatment did not show pathogenicity in tomato seedlings. The non-pathogenic strain IBC-248 was then used. GFP Tomato roots treated with fermentation broth were observed under a fluorescence microscope, and images were synthesized by Z-axis scanning. Figure 7 In Figure B), non-pathogenic strains can be clearly observed to grow endophytically in the tomato roots.
[0058] Example 4 1. Non-pathogenic strains were re-isolated from tomato plants. Tomato seeds were soaked in 75% ethanol for 5 minutes, inverting the solution continuously to ensure full contact between the seeds and the ethanol. The ethanol was then discarded, and the seeds were rinsed three times with sterile water. The seeds were then soaked in a 2.5% sodium hypochlorite solution for 4 minutes, the sodium hypochlorite solution was discarded, and the seeds were rinsed three times with sterile water. The rinsed seeds were then spotted onto 1 / 2 MS medium to germinate.
[0059] strain IBC-248 GFP The mycelial suspension was inoculated into a 250 mL Erlenmeyer flask containing 150 mL of PDB medium and incubated at 20 °C and 160 r / min for 30 h to obtain a mycelial suspension, which was then diluted to an OD concentration. 600 The concentration was 0.3. Tomato seeds were soaked in mycelial suspension for 10 min and then spotted onto 1 / 2 MS medium to germinate. After germination, the seed coats were removed, and the seeds were transferred to tissue culture flasks containing 50 mL of 1 / 2 MS medium and placed in a plant culture room at 20°C for growth.
[0060] Yellowed leaves from tomato plants cultured in 1 / 2 MS medium for 6 months were collected, sterilized, and inoculated onto PDA medium containing hygromycin (75 ppm) and cephalosporin (150 ppm) for re-isolation of endophytic strains. Parts of the tomato plant stems with small black spots were inoculated onto PDA plates containing hygromycin and cephalosporin resistance for re-isolation of endophytic strains. A total of 6 endophytic fungi were isolated from the leaves, labeled as Leaf Isolation 1, Leaf Isolation 2, Leaf Isolation 3, Leaf Isolation 4, Leaf Isolation 5, and Leaf Isolation 6, and 2 endophytic fungi were isolated from the stems. The isolated endophytic fungi were identified.
[0061] 2. Biological characteristics and strain determination of re-isolated fungi The growth rate and colony morphology of the isolated endophytic fungi were measured: mycelial blocks were extracted from the edge of the activated strain colony using a 5 mm diameter punch and inoculated into the center of a quantitative (20 mL) PDA plate, using strain IBc-248. GFP For control, each strain was set up in quadruplicate and incubated at 20℃. Growth rate was determined using the cross-multiplication method, measured at 24 h and 48 h. Mycelial growth rate (mm / d) = (48 h colony diameter - 24 h colony diameter) / 2. The experiment was repeated twice, and ANOVA was used to analyze the significance of differences. The results are shown below. Figure 8 And Table 3.
[0062] Table 3. Growth rate of Botrytis cinerea strain on PDA medium
[0063] from Figure 8As shown in Table 3, the endophytic fungi isolated from tomato plants have well-developed aerial hyphae but cannot produce conidia or sclerotia. Their colony morphology and growth rate are similar to those of IBC-248. GFP Similar, with no significant differences.
[0064] To identify the species of the re-isolated endophytic fungi, 100 ng of the extracted strain DNA was used as a template and mixed with the following reagents to prepare a 25 µL system: 0.5 µM each of the Botrytis cinerea-specific detection primer pair Bc-f / r and the hygromycin-specific detection primer pair HY-F 1100 (as shown in SEQ ID NO.3: AGAAGATGATATTGAAGGAGCACTTTT) and YG-R 1585 (as shown in SEQ ID NO.4: AAGAAGGATTACCTCTAAACAAGTGTACC), 12.5 µL of 2×Hieff® PCR Master Mix (With Dye) high-fidelity enzyme premix (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and deionized water was added to bring the volume to 25 µL. Place the sample in a PCR instrument and perform the following reactions: 95℃ for 5 min; denaturation at 94℃ for 30 s; annealing at 58℃ for 30 s; extension at 72℃ for 30 min; repeat 32 cycles; then treat at 72℃ for 10 min; finally, treat at 16℃ for 5 min. After the reaction is complete, perform 1% agarose gel electrophoresis on the PCR products. The results are shown below. Figure 9 .
[0065] from Figure 9 It can be seen that the endophytic fungus isolated from the tomato plant by PCR identification is IBc-248. GFP DNA was extracted from endophytic fungi isolated from tomato plants and amplified using Botrytis cinerea-specific primers and hygromycin for identification. The amplification results showed that all eight endophytic strains were Botrytis cinerea and carried hygromycin resistance tags. IBc-248 GFP After treatment with tomato seeds, this strain exhibits remarkable endophytic characteristics. It not only colonizes the tomato roots but also extends its endophytic growth to the stems and leaves as the plant grows, without inducing plant diseases. This unique endophytic characteristic allows IBC-248 to provide continuous protection throughout the entire growth cycle of the plant via seed initiation, simplifying the application process and significantly reducing labor and material costs.
[0066] 3. Evaluation of the growth-promoting potential of non-pathogenic strains on tomatoes Tomato seeds were surface-sterilized. Soaked in 75% ethanol for 5 minutes, inverting the seeds frequently to ensure full contact with the ethanol. The ethanol was then discarded, and the seeds were rinsed 2-3 times with sterile water. Next, the seeds were soaked in a 2.5% sodium hypochlorite solution for 4 minutes. The sodium hypochlorite solution was discarded, and the seeds were rinsed 3 times with sterile water. The mycelial suspension was diluted to OD...600 After the concentration of the disinfectant was reduced to 0.3, the tomato seeds were soaked in a mycelial suspension for 10 minutes. The treated seeds were then removed and placed in a 25°C incubator in a humidified, dark environment to promote germination. Simultaneously, sterile water treatment was used as a negative control. The germination status of the tomato seeds was photographed and recorded 72 hours after treatment. The results are shown below. Figure 10 See Table 4; simultaneously, photographs were taken to record the length of the sprouting roots, ImageJ was used to measure the root length, and a t-test was used for statistical analysis. The results are shown in Table 4. Figure 11 See Table 5.
[0067] Table 4. Effects of fermentation broth treatment with non-pathogenic strain IBC-248 on tomato seed germination rate.
[0068] Table 5. Effects of non-pathogenic strain IBC-248 fermentation broth treatment on early root development of tomato after 72 h.
[0069] Note: Different letters in the table represent highly significant differences between samples. p <0.0001).
[0070] from Figure 10 As shown in Table 4, at 72 h, the germination rates of tomato seeds treated with mock and IBC-248 were 95.60±0.80% and 97.60±1.20%, respectively, with no significant difference. Therefore, the treatment of tomato seeds with the fermentation broth of non-pathogenic strains did not affect the germination rate of tomato seeds.
[0071] from Figure 11 As shown in Table 5, at 72 h, the root length of tomato seeds treated with IBC-248 bacterial solution increased significantly by 31.37%. Treatment of tomato seeds with the bacterial solution can promote seed development in the early stages of seed development.
[0072] The fermentation broth of a non-pathogenic strain was broken up and diluted, then used to treat surface-sterilized tomato seeds. Sterile water treatment served as a negative control. Seeds were spread on moistened filter paper and germinated in an incubator at 25°C. Three days after germination, the seedlings were transplanted into seedling trays and randomly placed in a plant culture room at 20°C. Five weeks later, the agronomic traits of the underground parts of the tomato plants were investigated. After gently washing away the soil from the tomato roots, agronomic traits were measured using a root scanner (WinRHIZO root analysis system, LA2400). The results are shown below. Figure 12 See Table 6.
[0073] Table 6. Effects of fermentation broth treatment with non-pathogenic strain IBC-248 on tomato root development.
[0074] from Figure 12 As shown in Table 6, after treatment with IBC-248 bacterial solution, the number of root tips and the total root length of tomato plants were significantly increased, with the number of root tips increasing by 60.55%, the total root length increasing by 36.67%, and the root surface area increasing by 20.50%.
[0075] Therefore, it can be seen that strain IBc-248 can grow endophytically in tomatoes, promote tomato root development without causing disease, and direct foliar spraying can effectively limit the incidence of gray mold on tomato leaves.
[0076] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A type of Botrytis cinerea ( Botrytis cinerea IBC-248, characterized in that, Its accession number is CCTCC M2026254.
2. A microbial preparation, characterized in that, Contains Botrytis cinerea IBc-248 as described in claim 1 and / or its fermentation broth.
3. The microbial preparation according to claim 2, characterized in that, The working solution concentration of the microbial preparation is OD. 600 ≥0.
3.
4. The microbial preparation according to claim 2, characterized in that, The method for preparing the fermentation broth includes: inoculating Botrytis cinerea IBc-248 into PDB medium and shaking it at 140~180 r / min for 24~30 h at 20℃.
5. The use of Botrytis cinerea IBc-248 as described in claim 1 or the microbial preparation as described in any one of claims 2 to 4 in the prevention and control of gray mold and / or the promotion of plant growth.
6. The application according to claim 5, characterized in that, The plant mentioned includes: tomato.
7. The application according to claim 5, characterized in that, The growth includes: root development.
8. A method for controlling gray mold in plants, characterized in that, Includes the following steps: Foliar spraying of the microbial preparation described in any one of claims 2 to 5.
9. The method according to claim 8, characterized in that, The application rate of the microbial agent is 3-15 L / mu.
10. A method for promoting plant growth, characterized in that, Includes the following steps: Seeds are soaked in the microbial preparation described in any one of claims 2 to 5.
Citation Information
Patent Citations
Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea
CN103146812A