Halomonas sp. NX3-5 strain and application thereof

Abstract

The application discloses a strain of Lactobacillus plantarum NX3-5 and application thereof, and belongs to the technical field of beneficial bacteria. Halomonas sp. The application discloses a strain of Lactobacillus plantarum NX3-5 and application thereof, and belongs to the technical field of beneficial bacteria. Halomonas sp. The application discloses a strain of Lactobacillus plantarum NX3-5 and application thereof, and belongs to the technical field of beneficial bacteria. The application provides the strain of Lactobacillus plantarum NX3-5, which is preserved in the China Center for Type Culture Collection on December 18, 2025, and has a preservation number of CCTCC M 20252959; the provided strain has high salt and alkali tolerance; has the ability of reducing salt and alkali, and the alkali reduction rate is 18.22 %; further has the abilities of nitrogen fixation, potassium solution, organic phosphorus dissolution, protease production and IAA production, and can significantly promote the growth of the aboveground and underground parts of cucumber plants under normal conditions and salt and alkali stress conditions.

Description

Technical Field

[0001] This invention relates to the field of beneficial bacteria technology, and in particular to a strain of beneficial bacteria. Halomonas sp . NX3-5 strain and its applications. Background Technology

[0002] Plant rhizosphere microorganisms refer to the collection of bacteria, fungi, archaea, protozoa, and other microorganisms living on the surface of plant roots and in the soil area a few millimeters around them (i.e., the rhizosphere). They are not passive inhabitants but form a highly interactive "symbiotic functional group" with the plant, playing a vital role in promoting plant growth performance and enhancing its resistance to stress and pests. Different plant roots selectively recruit or domesticate different microorganisms through their root exudates and rhizosphere microenvironment, shaping unique and specific rhizosphere microbial communities.

[0003] Halomonas The genus *Halophilus*, also known as the genus *Halophilus*, exists in high-salt environments and has wide applications in biology, materials manufacturing, environmental science, agriculture, and medicine. Its known functions include: preparation of biodegradable plastics such as PHB and PHBV; preparation of cosmetics, protein protectants, dyes, and biosurfactants; degradation of environmental pollutants such as petroleum hydrocarbons and heavy metals; use as a feed additive to improve gut health in fish and shrimp, enhance animal immunity and survival rates, and is a potential antibiotic alternative; and production of secondary metabolites with inhibitory activity against pathogens such as *Staphylococcus aureus*, *Pseudomonas aeruginosa*, and *Candida albicans*, as well as polysaccharides with antioxidant activities, showing broad application prospects in new drug development. Summary of the Invention

[0004] The purpose of this invention is to provide a plant Halomonas sp . The NX3-5 strain and its application provide a new strain for improving saline-alkali land, which is tolerant to salinity and alkali, and has the functions of reducing alkali, fixing nitrogen, solubilizing potassium, dissolving organic phosphorus, producing protease and IAA, thereby improving crop yield and quality under normal conditions and saline-alkali stress.

[0005] To achieve the above objectives, the present invention provides a plant Halomonas sp . The NX3-5 strain was deposited on December 18, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252959.

[0006] Preferably, the Halomonas sp . The 16S rDNA sequence of strain NX3-5 is shown in SEQ ID NO.3.

[0007] A plant as described above Halomonas sp . Application of NX3-5 strain in the preparation of saline-alkali land improvement products, wherein the product is added with the aforementioned strain. Halomonas sp . The NX3-5 strain, the function of which is to reduce salinity and alkalinity.

[0008] A plant as described above Halomonas sp . Application of NX3-5 strain in fertilizer preparation, wherein the fertilizer is added with the above-mentioned strain. Halomonas sp . NX3-5 strain; the fertilizer has at least one effect in promoting the growth of the aboveground and / or underground parts of the plant; the fertilizer includes foliar fertilizer.

[0009] Preferably, the fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content and absorbable potassium content by at least one.

[0010] A plant as described above Halomonas sp . Application of NX3-5 strain in the preparation of a formulation that promotes the decomposition of organic matter, wherein the formulation is a formulation that promotes the decomposition of animal and plant residues, and wherein the formulation contains the aforementioned... Halomonas sp . NX3-5 strain.

[0011] A plant as described above Halomonas sp . Application of NX3-5 strain in the preparation of bactericidal agents, wherein the bactericidal agent is added with the aforementioned strain. Halomonas sp . NX3-5 strain.

[0012] A plant as described above Halomonas sp . Application of NX3-5 strain in the preparation of a specific formulation for salt-stressed plants, wherein the formulation contains the aforementioned... Halomonas sp . NX3-5 strain; the formulation is used to promote crop growth and development under salt stress conditions.

[0013] Therefore, the present invention provides a plant Halomonas sp . The NX3-5 strain and its applications, and its specific technical effects are as follows: (1) The present invention provides a plant Halomonas sp .After being cultured at 28°C on LB agar for 24-48 hours, strain NX3-5 typically forms colonies with a diameter of 2-4 mm. These colonies are round with smooth, regular edges, and are opaque milky white or pale yellow in color. The colony surface is smooth, moist, and glossy, with a thick texture, and remains soft and moist overall. It was deposited on December 18, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, China, with accession number CCTCC M 20252959. (2) The present invention provides Halomonas sp . The NX3-5 strain exhibits high salt and alkali tolerance, and can survive in environments containing 10% NaCl, pH=9, or containing Na+. + It grows well on a 500 mmol / L compound saline-alkali medium (NaCl∶Na2SO4∶Na2CO3∶NaHCO3=1∶9∶1∶9, molar ratio, pH=8.9±0.1); it has the ability to reduce alkali, with a reduction rate of 18.22%; (3) The present invention provides Halomonas sp . The NX3-5 strain also possesses the ability to fix nitrogen, solubilize potassium, dissolve organic phosphorus, produce protease, and produce IAA, which can significantly promote the growth of both the above-ground and underground parts of cucumber plants under normal conditions and salt-alkali stress conditions.

[0014] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is in Embodiment 1 of the present invention Halomonas sp . Photograph of NX3-5 strain growing on LB solid medium; Figure 2 It is the phylogenetic tree constructed in Embodiment 1 of the present invention; Figure 3 These are the salt and alkali tolerance test results from Example 2 of this invention; where a is a culture medium containing 10% NaCl and pH=9; b is Na... + A culture medium with a concentration of 300 mmol / L of compound saline-alkali; c is Na +Culture medium containing a 500 mmol / L complex saline-alkali solution; Figure 4 These are the results of growth-promoting characteristic detection in Example 2 of this invention; where a is the nitrogen fixation result; b is the potassium solubilization result; c is the protease production result; d is the organic phosphorus solubilization result; and e is the IAA production result (i is the negative control, ii is the positive control, and iii is NX3-5). Figure 5 This is in embodiment 3 of the present invention Halomonas sp . Results of NX3-5 strain on promoting the growth of cucumber seedlings; Figure 6 This is in embodiment 5 of the present invention. Halomonas sp . Results of stress relief of cucumber seedlings under salt-alkali stress by strain NX3-5.

[0017] Halomonas sp . The NX3-5 strain was deposited on December 18, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252959. Detailed Implementation

[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0019] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0020] The instruments, equipment, reagents, and materials used in the examples were all commercially available; methods not described in detail are conventional techniques in the art; letters after the values ​​in the table indicate significance, with different letters indicating significant differences. P <0.05.

[0021] The component information of the culture medium used in the examples is as follows: (1) LB solid medium: 5.0g yeast extract, 10g peptone, 10g sodium chloride, 15g agar, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15 minutes; LB liquid medium is the same as LB solid medium, except that agar is not added; (2) Assabeth medium: 0.2g potassium dihydrogen phosphate, 10.0g mannitol, 0.2g sodium chloride, 0.1g calcium sulfate, 5.0g calcium carbonate, 15.0g agar, 0.2g magnesium sulfate, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15min; (3) Skim milk culture medium: 10g skim milk powder and 20g agar are heated and dissolved in 1L of distilled water and autoclaved at 105℃ for 20min to avoid the formation of flocculent protein; (4) Organic phosphorus-soluble bacteria culture medium: glucose 10.0g, lecithin 0.2g, ammonium sulfate 0.5g, yeast extract 0.5g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium carbonate 1.0g, sodium chloride 0.3g, agar 15.0g, pH 7.0-7.5. 1L distilled water, autoclaved at 121℃ for 15min; (5) Inorganic phosphate-solubilizing bacteria culture medium: glucose 10.0g, ammonium sulfate 0.5g, yeast extract 0.5g, sodium chloride 0.3g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium phosphate 5.0g, agar 15.0g, pH 7.0-7.5, distilled water 1000mL, autoclave at 121℃ for 15min; (6) Sodium carboxycellulose medium: 10.0g peptone, 10.0g yeast powder, 10.0g sodium carboxycellulose, 5g sodium chloride, 1g potassium dihydrogen phosphate, 18g agar, 1L distilled water, autoclave at 121℃ for 15min; (7) Silicate bacteria culture medium: sucrose 5.0g, magnesium sulfate 0.5g, calcium sulfate 0.1g, disodium hydrogen phosphate 2.0g, ferric chloride 0.005g, glass powder 1.0g, agar 15.0g, pH 7.0±0.2. Weigh 23.6g of the purchased silicate bacteria culture medium and 1000mL of distilled water, and autoclave at 116℃ for 30min; (8) Chromium azurite CAS detection medium: Chromium azurite S (CAS) 0.06g, hexadecyltrimethylammonium bromide (HDTMA) 0.07g, ferric chloride hexahydrate 0.002g, sodium dihydrogen phosphate dihydrate 0.3g, disodium hydrogen phosphate dodecahydrate 0.3g, ammonium chloride 0.1g, potassium dihydrogen phosphate 0.04g, sodium chloride 0.06g, agar 9g, pH 6.8±0.1, distilled water 1000mL, autoclaved at 116℃ for 30min; (9) Preparation of bacterial suspension: The bacterial strain was cultured in LB medium at 28°C to activate it to the logarithmic phase, and OD was prepared. 600 A bacterial suspension with a concentration of approximately 0.8.

[0022] Example 1 strain Halomonassp . The isolation, identification, and preservation of NX3-5 are detailed below: (1) Sampling. Soil samples were collected from the rhizosphere of reed plants in Yanzidun Township, Huinong District, Ningxia Hui Autonomous Region (39°13'48"N, 106°46'48"E) using the five-point sampling method. The method for collecting rhizosphere soil was as follows: First, use a shovel to dig out as much of the entire root system of the chili pepper plant as possible, including the rhizosphere soil. Then, gently shake the root system to remove large clumps of soil without roots. Use a brush to gently brush off the soil attached to the plant roots and collect it into a resealable bag. Approximately 100g of rhizosphere soil was collected from each plant. Labels were affixed to the resealable bags, recording the collection location name, latitude and longitude, soil characteristics, plant name, and sampling time. After the samples were collected, the sampling bags were placed in an icebox and transported back to the laboratory as soon as possible for temporary storage at -20℃. The rhizosphere microbial isolation experiment was completed within 3-5 days.

[0023] (2) Isolation. Salt-tolerant bacterial strains were isolated from the collected soil samples using the dilution plating method. The soil suspension was diluted to 10... -1 10 -2 10 -3 10 -4 and 10 -5 For each gradient, 100 μL of LB solid medium was pipetted evenly onto plates, sealed with sealing film, numbered, labeled, and dated. The plates were then incubated upside down at 28°C for 24-48 hours. Each concentration was repeated three times. Colonies with different morphologies were selected and promptly transferred to LB medium for streaking again until single colonies were isolated and labeled. The isolated colonies were purified twice. The selected single colonies were then transferred to LB medium containing 10% NaCl and pH=9 and streaked again. The plates were incubated upside down at 28°C for 48-72 hours to screen for salt-tolerant strains, named NX3-5. The strains were temporarily stored at 4°C on slant agar or at -80°C to prevent loss of activity.

[0024] (3) Morphological identification. The salt-tolerant strain NX3-5, selected and activated on LB solid medium, was incubated in a 28℃ biochemical incubator for 2 days. Basic morphological characteristics such as colony morphology, size, color, texture viscosity, gloss, transparency, and edge smoothness were observed and recorded by photograph. (Photos are shown below.) Figure 1 As shown, under 28℃ incubation conditions, NX3-5 grows rapidly on LB solid medium, usually forming colonies with a diameter of 2-4 mm. These colonies are round with smooth and neat edges, and are opaque milky white or pale yellow in color. The surface of the colonies is smooth, moist, and glossy, with a thick texture, and the whole colony remains soft and moist.

[0025] (4) Molecular identification: Single colonies of NX3-5 strain were picked and placed in 1 mL of sterile water. Bacterial DNA was extracted by boiling lysis method, i.e., lysis at 100℃ for 10 min. Bacterial DNA was obtained. The strain was amplified by PCR using primers 27F (sequence shown in SEQ ID NO.1) and 1492R (sequence shown in SEQ ID NO.2).

[0026] A 50 μL PCR reaction system was used, and the amounts of each component were as per the instructions attached to the Taq enzyme package: 4 μL template (genomic DNA), 2 μL each of primers (27F and 1492R), 17 μL ddH2O, and 25 μL MIX (2×Taq plus Master Mix).

[0027] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min.

[0028] The PCR product was sent to the company for sequencing, and the 16S rDNA sequence of strain NX3-5 was obtained, as shown in SEQ ID NO.3.

[0029] SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG SEQ ID NO.2: GGTTACCTTGTTACGACTT SEQ ID NO.3: The 16S rDNA sequence of strain NX3-5 was subjected to multiple alignment in the NCBI database, and a phylogenetic tree was constructed using MEGA12 software (e.g., Figure 2 Homology comparison was performed on strain NX3-5 (as shown in the image), and the results showed that the gene sequence of strain JQ860233.1.11-1429 was similar to that of strain JQ860233.1.11-1429. Halomonas sp . Based on the fact that they are in the same branch and adjacent to each other, strain NX3-5 was identified as... Halomonas sp . Bacteria, named Halomonas sp . For convenience, NX3-5 will be referred to as strain NX3-5 below.

[0030] Strain NX3-5 was deposited on December 18, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, China, with accession number CCTCC M 20252959.

[0031] Example 2 The salt and alkali tolerance and growth-promoting properties of strain NX3-5 were tested, as detailed below: (1) Salt and alkali resistance test.

[0032] Single colonies of the isolated strain NX3-5 were transferred to LB medium (modified LB medium) containing 10% NaCl and pH=9 (adjusted with 1% NaOH) and streaked again. The medium was then incubated upside down at 28℃ for 48-72 hours. Strains that grew well on these plates were preliminarily considered salt-tolerant strains. Further labeling of the salt-tolerant strains and determination of their salt tolerance thresholds were performed. The initially screened salt-tolerant strains were then inoculated with different NaCl concentrations. + LB medium containing NaCl∶Na2SO4∶Na2CO3∶NaHCO3=1∶9∶1∶9 (molar mass ratio, pH=8.9±0.1) at concentrations (100, 200, 300, 400, 500 mmol / L) was incubated upside down in a 28℃ incubator for 48h-72h, and its salt and alkali tolerance was tested based on whether colonies grew.

[0033] Test results as follows Figure 3 As shown. The results showed that strain NX3-5 could grow well on LB medium containing 10% NaCl and pH=9. Figure 3 (part a), the results showed that strain NX3-5 could thrive in Na+-containing... +Growth was carried out on LB medium containing a 300 mmol / L compound saline solution (NaCl∶Na2SO4∶Na2CO3∶NaHCO3=1∶9∶1∶9, molar ratio, pH=8.9±0.1). Figure 3 (part b) The results showed that strain NX3-5 could thrive in Na+-containing... + It grows well on 500 mmol / L compound saline-alkali LB medium. Figure 3 (Part C).

[0034] (2) Determine the alkali reduction rate of strain NX3-5.

[0035] Strain NX3-5 was activated to the logarithmic growth phase in LB liquid medium, centrifuged, washed, and resuspended in sterile water to prepare OD. 600 A bacterial suspension with a pH of approximately 0.8 was used. A specific liquid LB medium simulating a saline-alkali environment (containing 10% NaCl, pH=9) was initially adjusted to pH 9.0. 1 mL of the bacterial suspension was added as the treatment group, while 1 mL of sterile water was added to the blank control group. The culture was incubated at 28°C and 180 rpm for 24 h in a constant temperature shaker, and the pH was measured afterward. The culture was centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The pH value of the supernatant was measured using a precisely calibrated pH meter and recorded.

[0036] Using the pH value of the blank control group as a benchmark, the relative alkalinity reduction rate of the treatment group was calculated using the following formula I to quantify the efficiency of the strain in reducing environmental alkalinity. The results are shown in Table 1. The alkalinity reduction rate of strain NX3-5 was 18.22%.

[0037] Alkalinity reduction rate (%) = [(control group pH - treatment group pH) / control group pH] × 100 (Formula I).

[0038] Table 1 pH values ​​of the supernatant

[0039] (3) Detection of the growth-promoting characteristics of strain NX3-5. This includes the detection of nitrogen fixation capacity, inorganic phosphorus solubility, organic phosphorus solubility, potassium solubilization, protease production, cellulase production, siderophore production, and IAA production capacity. The specific methods are as follows: Nitrogen fixation capacity: Strain NX3-5 was inoculated into Assumption medium and cultured at 28°C for 7 days. The presence or absence of bacteria on the medium was observed.

[0040] Phosphorus solubility: Strain NX3-5 was inoculated onto solid organic phosphorus-solubilizing bacteria culture medium and inorganic phosphorus-solubilizing bacteria culture medium plates, respectively, and cultured at 28°C for 7 days. The presence or absence of transparent phosphorus-solubilizing zones on the culture medium was then observed.

[0041] Siderogenetic vector: Inoculate strain NX3-5 onto a chromaine CAS detection medium plate and incubate at 28°C for 7 days, then observe for the appearance of a yellow-green halo.

[0042] Protease production capacity: The strain NX3-5 was inoculated onto a skim milk culture medium plate and cultured at 28°C for 3 days. The presence or absence of a clear zone was then observed.

[0043] Cellulase production capacity: Strain NX3-5 was inoculated onto sodium carboxycellulose medium plates and cultured at 28°C for 3 days. After staining with 1 mg / mL Congo red solution for 30 min, the staining solution was discarded, and the sample was washed with 1 mol / L sodium chloride for 30 min. The presence or absence of a clear zone was observed.

[0044] IAA detection: Take 1 mL of NX3-5 bacterial culture in the logarithmic growth phase and inoculate it into LB liquid medium containing L-tryptophan (100 mg / L). Incubate at 28℃ and 200 r / min for 24 h. Take 100 μL of bacterial culture and drop it onto a white ceramic plate. Add the same volume of Salkowski colorimetric reagent and mix well. React in the dark at room temperature for 30 min. If the color turns red, it indicates that the strain has the ability to produce IAA; otherwise, it does not.

[0045] Potassium solubilization capacity: Strain NX3-5 was inoculated into a silicate bacteria culture medium and cultured at 28°C for 7 days. The presence or absence of an oily liquid in the culture medium was then observed.

[0046] The results are as follows Figure 4 As shown in Table 2, strain NX3-5 has the ability to promote growth by fixing nitrogen, solubilizing potassium, dissolving organic phosphorus, producing proteases, and producing IAA.

[0047] Table 2. Results of growth-promoting characteristics detection for strain NX3-5

[0048] Note: "+" indicates that the ability exists, and "-" indicates that the ability does not exist.

[0049] Example 3 Using cucumber seedlings as experimental material, the growth-promoting effect of strain NX3-5 was tested, as detailed below: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60-80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm, at a depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with half a dose of Hoagland's nutrient solution. For cucumber seedlings at the one-leaf-one-heart stage with uniform growth, four holes, each about 2cm deep, were made around the base of the seedling stem. A suspension of strain NX3-5 (OD500) was then placed inside the holes. 600 ≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL, and inoculate 12 seedlings per treatment, repeating 3 times. The control group (CK) is inoculated with only an equal volume of water. Inoculate again after 7 days. On day 7 after the second inoculation, measure and record the cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, and underground dry weight. Calculate the seedling vigor index using Formula II below.

[0050] Strong seedling index = (stem diameter / plant height + root dry weight / aboveground dry weight) × total plant dry weight (Formula II).

[0051] The results are as follows Figure 5 As shown in Table 3, inoculation with strain NX3-5 significantly promoted cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, underground dry weight, and seedling vigor index, increasing by 58.65%, 18.67%, 32.13%, 28.55%, 10.96%, 19.93%, 58.33%, and 9.30% respectively compared to the control.

[0052] Table 3. Growth-promoting effect of strain NX3-5 on cucumber seedlings

[0053] Example 4 Using cucumber seedlings as experimental material, the effect of strain NX3-5 in alleviating salt-alkali stress in cucumbers was tested, as detailed below: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60-80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm, at a depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with half a dose of Hoagland's nutrient solution. For cucumber seedlings at the one-leaf-one-heart stage with uniform growth, four holes, each about 2cm deep, were made around the base of the seedling stem. A suspension of strain NX3-5 (OD500) was then placed inside the holes. 600 ≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL of water. Each treatment has 12 seedlings, and the treatment is repeated 3 times. The control (CK) is inoculated with only an equal volume of water. A second inoculation is performed 7 days later. On the 3rd day after the second inoculation, a solution of 75 mmol·L⁻¹ NaCl:Na₂SO₄:Na₂CO₃:NaHCO₃ in a ratio of 1:9:1:9 (molar ratio, pH=8.9±0.1) is prepared. -1 A compound saline-alkali solution was applied. 40 mL of the compound saline-alkali solution was applied to each pot for treatment, repeated every 2 days. Based on previous laboratory research, the fresh weight of the entire cucumber seedling, proline, and malondialdehyde content were measured and recorded after 5 days of treatment. The salt damage index was calculated using Formula II.

[0054] Salt damage grading standards: Grade 0, no salt damage characteristics; Grade 1, true leaves intact, leaf edges yellowed; Grade 2, 25% of true leaves are wilted and yellowed; Grade 3, 50% of the true leaves are wilted and yellowed; Grade 4, 75% of true leaves are wilted and yellowed; Level 5, all leaves are wilting due to water loss.

[0055] (II).

[0056] The results are as follows Figure 6 As shown in Table 4, inoculated strain NX3-5 significantly promoted the fresh weight of cucumber seedlings under salt-alkali stress, increasing it by 28.51% compared to the control. It also reduced the proline, malondialdehyde (MDA) content, and salt-alkali index in cucumber roots, decreasing them by 33.33%, 32.14%, and 55.58% respectively compared to the control.

[0057] Table 4. Alleviating effect of strain NX3-5 on cucumber seedlings under salt-alkali stress.

[0058] Therefore, the present invention provides Halomonas sp .The NX3-5 strain was isolated for the first time and deposited at the China Center for Type Culture Collection (CCTCC) on December 18, 2025, with accession number CCTCC M 20252959. It exhibits good salt and alkali tolerance and can thrive in environments containing Na+. + It grows well on LB medium with a concentration of 500 mmol / L of compound salt and alkali; it also has the ability to reduce alkali, fix nitrogen, solubilize potassium, dissolve organic phosphorus, produce protease and IAA, and can significantly promote the growth of both the above-ground and underground parts of cucumber plants under normal conditions and salt and alkali stress conditions.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A plant Halomonas sp . The NX3-5 strain was deposited on December 18, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M20252959.

2. A plant according to claim 1 Halomonas sp . NX3-5 strain, characterized by: The Halomonas sp . The 16S rDNA sequence of strain NX3-5 is shown in SEQ ID NO.

3.

3. A plant as described in claim 1 or 2 Halomonas sp . The application of strain NX3-5 in the preparation of saline-alkali land improvement products is characterized by: Add the aforementioned to the product Halomonas sp . The NX3-5 strain, the function of which is to reduce salinity and alkalinity.

4. A plant as described in claim 1 or 2 Halomonas sp . The application of NX3-5 strain in fertilizer preparation is characterized by: The fertilizer contains the aforementioned Halomonas sp . NX3-5 strain; the fertilizer has at least one effect in promoting the growth of the aboveground and / or underground parts of the plant; the fertilizer includes foliar fertilizer.

5. A plant according to claim 4 Halomonas sp . The application of NX3-5 strain in fertilizer preparation is characterized by: The fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content and absorbable potassium content by at least one.

6. A plant as described in claim 1 or 2 Halomonas sp. The application of strain NX3-5 in the preparation of formulations that promote the decomposition of organic matter is characterized by: The formulation is a preparation that promotes the decomposition of animal and plant residues, and the formulation contains the aforementioned... Halomonas sp . NX3-5 strain.

7. A plant as described in claim 1 or 2 Halomonas sp . The application of NX3-5 strain in the preparation of bactericidal agents is characterized by: The bactericidal agent contains the aforementioned Halomonas sp . NX3-5 strain.

8. A plant as described in claim 1 or 2 Halomonas sp . The application of strain NX3-5 in the preparation of a specific formulation for salt-stressed plants is characterized by: The formulation contains the aforementioned Halomonas sp . NX3-5 strain; the formulation is used to promote crop growth and development under salt stress conditions.

Images