A method for constructing a high-yield strain of lincomycin biosynthesis intermediate and its separation and preparation process

Abstract

The application provides a high-yield strain construction method of a lincomycin biosynthesis intermediate and a separation and preparation process of the lincomycin biosynthesis intermediate. Specifically, the application provides a gene engineering modification method of an engineering strain for efficiently producing a lincomycin biosynthesis intermediate, a fermentation culture medium, a separation and preparation method of the intermediate, and a method for preparing ergothioneine by using the intermediate.

Description

Technical Field

[0001] This invention relates to the field of biotechnology. Specifically, this invention relates to a method for constructing a high-yield strain of lincomycin biosynthetic intermediate and its isolation and preparation process. Background Technology

[0002] Streptomyces lincolnensis is an actinomycete that ferments to produce lincomycin, a antibiotic primarily used to treat infections caused by Gram-positive bacteria. Its molecular structure consists of amino acids and glycosyl groups, classifying it as a lincosamide. The lincomycin biosynthesis gene cluster is approximately 35 kb in length and contains one regulatory gene, three resistance genes, and 26 structural genes. In previous studies of the lincomycin biosynthesis mechanism (Nature 518, 115-119, 2015 and authorized patent ZL201410625571.4), the inventors discovered that two small molecule thiols, ergothioneine (EGT) and mycothiol (MSH), are involved in lincomycin biosynthesis. EGT acts as a cyclic carrier, mediating the transfer of glycosyl groups from GDP-octose sugars to EGT. Subsequently, under the synergistic action of adenylate laccosylase LmbC, N-terminal carrier protein LmbN, and LmbD protein, it condenses with trans-4-propyl-L-proline (PPL) units derived from L-tyrosine to form the lin-EGT574 intermediate in the biosynthesis of lincomycin.

[0003] Based on the above research findings, knocking out the lmbV gene in *Streptomyces lincosae* can accumulate the intermediate product lin-EGT574, which can be hydrolyzed to form EGT, an antioxidant with significant application value, and another octose sugar-PPL structure. However, after knocking out the lmbV gene in *Streptomyces lincosae* strain NRRL ISP 5355, the mutant strain SLINC-ΔlmbV-5355 produced a relatively low yield of lin-EGT574 through fermentation, only about 37 mg / L, which is insufficient to meet the requirements for subsequent industrialization development.

[0004] Furthermore, lin-EGT574 can be converted to EGT by acid hydrolysis through the breaking of the CS bond. EGT, initially discovered in ergot fungi, is a rare natural antioxidant with high antioxidant activity. It has certain effects in anti-tumor, anti-aging, whitening, anti-inflammatory, and acne-reducing applications, and is currently mainly used as an additive in high-end cosmetics. The EU approved it as a new food resource in 2017. EGT has a wide range of sources, existing in bacteria, fungi, and cereals. EGT biosynthetic pathways have been found in some bacteria and fungi. Current methods for producing EGT mainly include chemical synthesis, natural extraction, and biofermentation. However, as a newly discovered compound, lin-EGT574 lacks a mature separation and extraction process, and the hydrolysis process for obtaining EGT requires further optimization.

[0005] Therefore, there is a need in the field to develop methods to further improve the yield of lin-EGT574. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a high-yield strain of lincomycin biosynthetic intermediate and its isolation and preparation process.

[0007] The present invention provides a method for constructing a high-yield strain of lin-EGT574, an intermediate product of lincomycin biosynthesis.

[0008] The present invention also provides a fermentation culture medium formulation for a high-yield strain of lin-EGT574, an intermediate product of lincomycin biosynthesis.

[0009] The present invention also provides a process for the isolation and preparation of lin-EGT574, an intermediate product in the biosynthesis of lincomycin.

[0010] In a first aspect of the present invention, a method for engineering strains to increase the yield of lincomycin biosynthetic intermediates is provided, the method comprising the steps of:

[0011] A starting strain for fermentation production of lincomycin is provided, wherein the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the genome of the starting strain are knocked out, and the EGT biosynthesis gene cluster in the genome of the starting strain is multiplied.

[0012] In another preferred embodiment, the EGT biosynthetic gene cluster includes genes selected from the group consisting of egtA (SLINC_7407), egtB (SLINC_7408), egtC (SLINC_7406), egtD (SLINC_7405), egtE (SLINC_2488), or combinations thereof.

[0013] In another preferred embodiment, the starting strain is wild-type Streptomyces lincosum or SLINC-ΔlmbV-5355 strain.

[0014] In another preferred embodiment, the method includes the steps of: knocking out the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the *Streptomyces lincosae* genome, and doubling the egtA, egtB, egtC, egtD and egtE genes in the *Streptomyces lincosae* genome.

[0015] In another preferred embodiment, the method is performed via site-specific recombination.

[0016] In another preferred embodiment, the site-specific recombination is a site-specific recombination mediated by VWB and / or ΦC31 integrase.

[0017] In another preferred embodiment, the method includes the steps of:

[0018] (S1) Knock out the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the starting strain and introduce the attB site recognized by the exogenous ΦC31 integrase.

[0019] (S2) The vector containing (i) the VWB integrase module and the ΦC31 integrase module and (ii) the EGT biosynthesis gene cluster is introduced into the strain obtained in step (S1) to obtain the engineered strain of Streptomyces lincosae.

[0020] In another preferred embodiment, in step (S1), the SLINC6338, SLINC6339 and SLINC63340 genes are knocked out using a homologous recombination vector, and the attB site sequence recognized by the ΦC31 integrase is introduced into the middle of the homologous arm of the homologous recombination vector, thereby introducing the exogenous attB site recognized by the ΦC31 integrase into the meo gene cluster of the originating strain.

[0021] In another preferred embodiment, the homologous arm amplification gene is shown in SEQ ID NO:1-4.

[0022] In another preferred embodiment, the method further includes the step of screening strains in which the EGT biosynthetic gene cluster is integrated into the endogenous attB site and the exogenous attB site in the genome, wherein the endogenous attB site is an endogenous attB site recognized by the VWB integrase of Streptomyces lincospores.

[0023] In another preferred embodiment, the carrier is a plasmid or a viscous particle.

[0024] In another preferred embodiment, the attB site of the *Streptomyces lincosae* genome and the phage attachment site target sequence attP recombine under the mediation of ΦC31 integrase and / or VWB integrase to form heterozygous sites attL and attR.

[0025] In a second aspect of the invention, a fermentation medium is provided, the fermentation medium comprising, or composed of, the following components:

[0026] Starch 6-23 g / L;

[0027] Corn steep liquor dry powder: 1-4.9 g / L;

[0028] Glucose 45-90g / L;

[0029] Soybean meal powder 27-30g / L;

[0030] Potassium dihydrogen phosphate 0.2-0.3 g / L;

[0031] Magnesium sulfate 0.05-0.15 g / L;

[0032] Calcium carbonate 5-10g / L;

[0033] Sodium chloride 0-7 g / L;

[0034] Sodium nitrate 0-9 g / L;

[0035] Ammonium sulfate 0-3 g / L;

[0036] Ammonium nitrate 0-15g / L.

[0037] In another preferred embodiment, the fermentation medium contains 19-23 g / L of starch, preferably 21 g / L.

[0038] In another preferred embodiment, the fermentation medium contains 4.5-4.9 g / L of corn steep liquor powder, more preferably 4.8 g / L.

[0039] In another preferred embodiment, the fermentation medium contains 47-90 g / L of glucose, preferably 85 g / L.

[0040] In another preferred embodiment, the fermentation medium contains 28-29 g / L of soybean meal, preferably 28 g / L.

[0041] In another preferred embodiment, the fermentation medium contains 0.2-0.25 g / L potassium dihydrogen phosphate, more preferably 0.22 g / L.

[0042] In another preferred embodiment, the fermentation medium contains 0.05-0.1 g / L magnesium sulfate, preferably 0.1 g / L.

[0043] In another preferred embodiment, the fermentation medium contains 7-9 g / L of calcium carbonate, preferably 8 g / L.

[0044] In another preferred embodiment, the fermentation medium contains 0-5 g / L sodium chloride, preferably 0 g / L.

[0045] In another preferred embodiment, the fermentation medium contains 0-6 g / L sodium nitrate, preferably 0 g / L.

[0046] In another preferred embodiment, the fermentation medium contains 0-2 g / L of ammonium sulfate, preferably 0 g / L.

[0047] In another preferred embodiment, the fermentation medium contains 0-1 g / L of ammonium nitrate, preferably 0 g / L.

[0048] In another preferred embodiment, the fermentation medium comprises, or is composed of, the following components:

[0049] Starch 21g / L, corn steep liquor powder 4.8g / L, glucose 85g / L, soybean meal powder 28g / L, potassium dihydrogen phosphate 0.22g / L, magnesium sulfate 0.1g / L, calcium carbonate 8g / L.

[0050] In another preferred embodiment, the fermentation medium is free of sodium chloride, sodium nitrate, ammonium sulfate, and ammonium nitrate.

[0051] In another preferred embodiment, the fermentation medium is used for the fermentation of *Streptomyces lincosinate* to produce lin-EGT574.

[0052] In another preferred embodiment, the *Streptomyces lincosum* is selected from wild-type *Streptomyces lincosum* or engineered strains of *Streptomyces lincosum* as described in the first aspect of the invention.

[0053] In a third aspect of the present invention, a method for preparing the lin-EGT574 intermediate product in the biosynthesis of lincomycin is provided, comprising the steps of:

[0054] (a) Fermentation of the engineered strain of Streptomyces lincosae as described in the first aspect of the present invention;

[0055] (b) Extract the intermediate product lin-EGT574 from the fermentation product.

[0056] In another preferred embodiment, in step (a), fermentation is carried out using a fermentation medium as described in the second aspect of the invention.

[0057] In another preferred embodiment, step (b) includes the step:

[0058] (b1) Separate the solid and liquid components of the fermentation product, break down the bacteria in the filter residue obtained after separation, and mix it with the fermentation supernatant to obtain the first solution;

[0059] (b2) The first solution is filtered and ultrafiltered to obtain a second solution;

[0060] (b3) The second solution is purified by resin adsorption, and the resin is eluted to obtain the third solution;

[0061] (b4) The third solution was purified by medium-pressure liquid chromatography to obtain the intermediate product lin-EGT574.

[0062] In another preferred embodiment, in step (b2), a 50 nm ceramic membrane is used for filtration.

[0063] In another preferred embodiment, in step (b2), ultrafiltration is performed using a 5kD-10kD ultrafiltration membrane (preferably 10kD).

[0064] In another preferred embodiment, in step (b3), D101 resin is used for adsorption purification.

[0065] In another preferred embodiment, in step (b4), two medium-pressure liquid chromatography purifications are performed, wherein:

[0066] The chromatographic column packing material is C18;

[0067] The mobile phase for the first purification was water and acetonitrile;

[0068] The mobile phase for the second purification was an aqueous solution of ammonium acetate and acetonitrile.

[0069] In another preferred embodiment, the volume ratio of acetonitrile in the mobile phase is 5%.

[0070] In another preferred embodiment, the concentration of the ammonium acetate aqueous solution is 4 g / L.

[0071] In a fourth aspect of the present invention, a method for preparing ergothioneine is provided, comprising the steps of:

[0072] The lin-EGT574 intermediate in the biosynthesis of lincomycin was hydrolyzed, and the hydrolysis product was purified using resin to obtain ergothioneine.

[0073] The hydrolysis is carried out under conditions of pH 1.1-1.2 (preferably pH 1.1).

[0074] In another preferred embodiment, the resin purification is performed using a 001*7 strong acid cation exchange resin.

[0075] In another preferred embodiment, the pH of the eluent during resin purification is 12.3-12.5.

[0076] In another preferred embodiment, the eluent used in the resin purification is 0.2% NaOH.

[0077] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0078] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0079] Figure 1 The lincomycin biosynthetic pathway involving EGT and MSH, as well as the intermediates therein, are shown.

[0080] Figure 2 The HPLC detection chromatogram after lin-EGT574 extraction is shown.

[0081] Figure 3 The LC-MS detection chromatogram of EGT prepared after hydrolysis of lin-EGT574 is shown. Detailed Implementation

[0082] Through extensive and in-depth research, the inventors have, for the first time, developed a method for constructing a high-yield strain of lincomycin biosynthetic intermediates and its isolation and preparation process. Specifically, this invention uses the NRRL ISP-5355 strain with the lmbV gene knocked out as the starting strain. The Moenomycin gene cluster (moe) is knocked out of this strain, and simultaneously, a new gene is introduced at the knockout site. The site sequence was determined to facilitate subsequent integration and gene duplication. The EGT biosynthetic gene cluster (egt) was then multiplied at this site, ultimately resulting in the screening of a strain SLINC-ΔlmbV-5355 that produces a high-yield lin-EGT574 intermediate compound. This invention also provides an optimized fermentation medium formulation, making it more suitable for the fermentation production of lin-EGT574.

[0083] Furthermore, through experimentation with different separation and purification methods, this invention has screened out a highly efficient method for separating the intermediate product lin-EGT574. The purification method of this invention first involves solid-liquid separation and cell disruption, followed by ceramic membrane filtration and ultrafiltration to remove large solid particles and proteins. After adsorption and enrichment with macroporous resin, the intermediate product lin-EGT574 with a purity of over 95% is obtained using chromatographic column separation. EGT is further prepared by acid hydrolysis.

[0084] Based on this, the present invention was completed.

[0085] the term

[0086] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.

[0087] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0088] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0089] Lin-EGT574

[0090] As used herein, the term "lin-EGT574" refers to the lin-EGT574 intermediate in the biosynthesis of lincomycin. In the biosynthesis of lincomycin, EGT acts as a cycling carrier, mediating the transfer of glycosyl groups from GDP-octose sugars to EGT. Subsequently, under the synergistic action of adenylate laccosylase LmbC, the N-terminal carrier protein LmbN, and the LmbD protein, it condenses with an L-tyrosine-derived trans-4-propylproline unit to form the lin-EGT574 intermediate. Lin-EGT574, catalyzed by the LmbV protein, undergoes a specific thiol exchange reaction with MSH to release EGT. Subsequently, it undergoes hydrolysis under the action of the LmbE protein to form another intermediate, lin-507, releasing GlcN-Ins to regenerate MSH. lin-507 is then further modified to ultimately form lincomycin A.

[0091] The biosynthetic pathway of lincomycin and the structure of the intermediate lin-EGT574 are as follows: Figure 1 As shown.

[0092] engineered strains

[0093] This invention also provides engineered bacteria that can be used to produce Lin-EGT574. The engineered strain of this invention is obtained by engineering the existing Streptomycin lincolnensis strain SLINC-ΔlmbV-5355 from the group consisting of:

[0094] (1) Knock out the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the Streptomyces lincosae genome;

[0095] (2) The EGT biosynthesis gene cluster in the genome of Streptomyces lincosae;

[0096] (3) The combination of (1) and (2) above.

[0097] Integrase system

[0098] The engineered *Streptomyces lincosae* strains of this invention can be constructed via site-specific recombination mediated by an integrase system. As used herein, the term "site-specific recombination" refers to a type of homologous recombination that relies on the pairing of small homologous sequences and requires the assistance of integrase systems (such as VWB, etc.). The involvement of specific recombination sites (such as attB / attP) ultimately integrates the exogenous plasmid into the genome.

[0099] Site-specific recombinant integrase can accurately recognize the bacterial attachment site attB and the attP site in the plasmid, catalyzing the integration between attB and attP to form attL and attR. However, attL and attR do not have significant duplication and cannot serve as substrates for integrase recombination. The reaction is unidirectional and irreversible, and can be stably passed down with the host.

[0100] 1. VWB-attP integrase module

[0101] VWB-attP integrase is a specific recombination and integration of attP and attB sites mediated by the VWB temperate phage. The VWB-attP integrase module contains the gene expressing the VWB integrase and the attP site sequence, as follows:

[0102] gtcgacctgcagcccaagcttcgcgccctccatgaggcgtacccgaagttcaccgaagagcgcattttcgccg

[0103] cggcccgccgggccgcgccgggcccgctcgacgaggacgccgaggaacgcctgctcaccctgttccgtggtctcac

[0104] cgaggagcagcagcgttccaagctgatcgagatgagcgcgctgaacgagtccaacaagcagtagccgacgcccgta

[0105] caaccgtcggcctgcctcgcgggtctaacgaaaatggactccaccactccccgtgattcctcgggcacttggtgcacgc

[0106] agagtggtcgcatattcacctacaagggggtacggtcggtcgagcggcctgccctcccccatggccgacggtcaaac

[0107] gtcgcctgcctgcccgggggatacccatgtgcattcgtgtccgcttcgcgcctctcgacccgctcaacttccggccgtac

[0108] gacgccgctggaaacacggtcaccctgcctgccaccctcccccgggatgcttccctcgtagcccttcgagccgtccttg

[0109] aagaactggctgtagagcagcccccggacggtgcagtctgctggtgtggggcagccgtacacatcctgccccgcgtt

[0110] cccgaacagcggaggagcggacaggtgacccatggcgcctagagcgacgaacaacccacggcagttgagggcga

[0111] agagctgcggctgccagctgtgcatggagaagtacccgcccgagaagtacggagagcggaaccgccgacgcgact

[0112] gcaccggctcgtggcaggcgcgttaccgcgacccggccggcaaccagaagcagaaatgctttgcgatcaaggacgg

[0113] cggtaagaaggcagccgaggcgcacctcgacaagatccgcacgcaggtccgcgaacggacgtacgccgacccgaa

[0114] gcgtggcgagatcaccctgtcccagtggtggaaactgtggtgggaggcgcagccggaccgagcagtcacgaccgcc

[0115] aaccggaagcggtcgaactgggccgcgcacatcgagccgaagtgggggcagtggcgtctctgcgacttggagtaca

[0116] tcgagctgcaggcgtggatcacgaaggaggtgaagggctaccacacccggaagaaggttcatgaggtgctgaactcg

[0117] atgctccgggccgccgtcaaggacggccggcgtatcccgttcaacccggcggccgacctggacattggcgaggcgc

[0118] cggcgaagcatccggacgaactgatgccgcccgaccgcgcgcagtgcgcgctgatcgtcagtcacctgccgatgtac

[0119] taccggccgctcgtcgtcttccttgaacacaccggtctccggtggggcgaggcgacggcgctgcgctgggagaacgt

[0120] cgacctggacgcccactacctcaaggtgaaggaagtgctcagtgacgacgaaggcaagctgttccggaagcctgcgc

[0121] cgaagagcaacgccgggttccgcacggtcccgctcacgccgcaggccgaggacgcgatccgcaccatggtcaccc

[0122] ggtggcggccgactcccacgatcaccccgattggcgaggacccgtacgacctcgcgccggatgagctcgtgttccgc

[0123] ggcccacagggcggcgtcctgacccggcacaacttccggcgcacatggatccctgcaatcaaggctgcaggcctcg

[0124] cccgcgaggtgaagaaccgggacaccggccgcatggagtggtggccgcgggtgcacgaccttcgccacgtgttcgc

[0125] cacgtggctcaaggatgtgggcattgacgagaaggacacgcagaccgtgatgggtcacgagcgagggtcgaaggtg

[0126] acgtggttgtaccagcattcgccggccgacgtggcggcgaaggtgcgggcggcgatggctcccgagaccgagggtg

[0127] ttcgaacgctgcgggcggtgtgacgccggatgccacgcagatgccacagggatgccacaacaccccctcactgaga

[0128] ctcaccgagactcactgaaactcatttatgcaggtgaagcccctatggcgacaggctcactgagactcactcagactca

[0129] ctgaggctcatgatcgctttacgttctctcctaaagcgggtgtcgcaggttcgaatcctgccgggggcacaacctgcatc

[0130] gcaggtcagggagtcaacggccccccgttccattcgaacggggggccgttgtcgtacccggatgccacatagatgcc

[0131] acatccccacggaatcctgcggatcacgtcgctcgaaagagtgatgtgcacagcagccacaatgcgtagagtgctgtc

[0132] taccgagcgggccggcgtgctccccacacgcgtcagacggac(SEQ ID NO:11)

[0133] The VWB integrase module used in this application is the integrase module contained in plasmid pSOK804.

[0134] Integrase modules can also be obtained by digesting plasmid pSOK804, DNA synthesis, or PCR.

[0135] 2. φC31-attP integrase module

[0136] Integrases are chain site-specific recombination integrases that accurately recognize the bacterial attachment site attB and the attP site in plasmids, catalyzing the integration between attB and attP to form attL and attR. AttL and attR do not exhibit significant duplication and cannot serve as substrates for integrase recombination. The reaction is unidirectional and irreversible, and can be stably passaged with the host. Fungal bacteriophages utilize their φC31 integrase to mediate specific recombination integration of attP and attB sites. The φC31-attP integrase module contains the gene expressing the φC31 integrase and the attP site sequence, as shown below:

[0137] aagctctagcgattccagacgtcccgaaggcgtggcgcggcttccccgtgccggagcaatcgccctgggtgg

[0138] gttacacgacgcccctctatggcccgtactgacggacacaccgaagccccggcggcaaccctcagcggatgccccg

[0139] gggcttcacgttttcccaggtcagaagcggttttcgggagtagtgccccaactggggtaacctttgagttctctcagttgg

[0140] gggcgtagggtcgccgacatgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacgaccgtcagtc

[0141] gcgcgagcgcgagaattcgagcgcagcaagcccagcgacacagcgtagcgccaacgaagacaaggcggccgacc

[0142] ttcagcgcgaagtcgagcgcgacgggggccggttcaggttcgtcgggcatttcagcgaagcgccgggcacgtcggc

[0143] gttcgggacggcggagcgcccggagttcgaacgcatcctgaacgaatgccgcgccgggcggctcaacatgatcattg

[0144] tctatgacgtgtcgcgcttctcgcgcctgaaggtcatggacgcgattccgattgtctcggaattgctcgccctgggcgtg

[0145] acgattgtttccactcaggaaggcgtcttccggcagggaaacgtcatggacctgattcacctgattatgcggctcgacgc

[0146] gtcgcacaaagaatcttcgctgaagtcggcgaagattctcgacacgaagaaccttcagcgcgaattgggcgggtacgt

[0147] cggcgggaaggcgccttacggcttcgagcttgtttcggagacgaaggagatcacgcgcaacggccgaatggtcaatg

[0148] tcgtcatcaacaagcttgcgcactcgaccactccccttaccggacccttcgagttcgagcccgacgtaatccggtggtg

[0149] gtggcgtgagatcaagacgcacaaacaccttcccttcaagccgggcagtcaagccgccattcacccgggcagcatca

[0150] cggggctttgtaagcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagaccgcttcaag

[0151] cgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggcttcgccgctgaggtgatctacaa

[0152] gaaagccggacggcacgccgaccacgaagattgagggttaccgcattcagcgcgacccgatcacgctccggccg

[0153] gtcgagcttgattgcggaccgatcatcgagcccgctgagtggtatgagcttcaggcgtggttggacggcagggggcg

[0154] cggcaaggggctttcccggggcaagccattctgtccgccatggacaagctgtactgcgagtgtggcgccgtcatgac

[0155] ttcgaagcgcggggaagaatcgatcaaggactcttaccgctgccgtcgccggaaggtggtcgacccgtccgcacctg

[0156] ggcagcacgaaggcacgtgcaacgtcagcatggcggcactcgacaagttcgttgcggaacgcatcttcaacaagatc

[0157] aggcacgccgaaggcgacgaagacgttggcgcttctgtgggaagccgccgacgcttcggcaagctcactgagg

[0158] cgcctgaagagagcggcgaacgggcgaaccttgttgcggagcgcgccgacgccctgaacgccccttgaagctgta

[0159] cgaagaccgcgcggcaggcgcgtacgacggacccgttggcaggaagcacttccggaagcaacaggcagcgctgac

[0160] gctccggcagcaaggggcgggaagagcggcttgccgaacttgaagccgccgaagccccgaagcttcccccttgaccaa

[0161] tggttccccgaagacgccgacgctgacccgaccggccctaagtcgtggtgggggcgcgcgtcagtagacgacaagc

[0162] gcgtgttcgtcgggctcttcgtagacaagatcgttgtcacgaagtcgactacgggcagggggcagggaacgcccatcg

[0163] agaagcgcgcttcgatcacgtgggcgaagccgccgaccgacgacgacgaagacgacgcccaggacggcacggaa

[0164] gacgtagcggcgtagcgagacacccgggaagcctg(SEQ ID NO:12)

[0165] The φC31 integrase module can be obtained by digesting plasmid pSET152, DNA synthesis, or PCR.

[0166] The main advantages of this invention include:

[0167] 1) Through optimization of the culture medium formulation and a series of genetic modifications to the *Streptomyces lincosae* strain, the yield of the lin-EGT574 compound on shake flasks was increased to 1.1 g / L, laying a foundation for further industrial production.

[0168] 2) This invention establishes an extraction process for the lin-EGT574 compound, and optimizes the hydrolysis method of lin-EGT574 and the extraction method of EGT after hydrolysis, thus establishing a novel process for obtaining EGT.

[0169] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0170] Example 1: Fermentation method for lin-EGT574, an intermediate product in the biosynthesis of lincomycin

[0171] Fermentation was performed using the mutant strain SLINC-ΔlmbV-5355, which contains the lin-EGT574 intermediate in the biosynthesis of lincomycin. This strain was obtained by knocking out the lmbV gene in wild-type Streptomyces lincomyces NRRL-ISP-5355. For specific strain construction methods, please refer to patent ZL201410625571.4.

[0172] The fermentation intermediate lin-EGT574, a commonly used culture medium component in lincomycin production, was used. The slant culture medium formula (g / L) was: starch 19g, soybean meal 5g, sodium chloride 0.5g, potassium nitrate 1g, ferrous sulfate 0.01g, dipotassium hydrogen phosphate 0.5g, agar powder 20g, pH: 7.2. The seed culture medium formula (g / L) was: starch 19g, corn steep liquor powder 1.04g, ammonium sulfate 2g, ammonium nitrate 2.2g, soybean meal 23g, glucose 25g, calcium carbonate 6.8g, sodium chloride 0.7g, potassium dihydrogen phosphate 0.5g, pH: 7.2.

[0173] Initial fermentation medium formula (g / L): glucose 47, starch 6, soybean meal 28, corn steep liquor powder 12, calcium carbonate 8, sodium nitrate 6, potassium dihydrogen phosphate 0.3, ammonium sulfate 2, sodium chloride 5, ammonium nitrate 1, pH: 7.0.

[0174] Fermentation method: Spread the Lincocel bacteria on a slant agar plate and incubate at 30℃ for 5-7 days until the spores are dense. Inoculate a 1cm block with a bamboo stick. 2 Spore agar blocks were transferred to 50 ml of seed culture medium (500 ml shake flask) and cultured at 28°C and 220 rpm for 3 days. Then, 10% inoculum was transferred to 50 ml of fermentation culture medium (500 ml shake flask) and cultured at 28°C and 220 rpm for 7 days. Samples were taken from the flasks to detect the lin-EGT574 content.

[0175] Fermentation broth detection method: Mix 500 μL of fermentation broth with 500 μL of methanol for 30 min, centrifuge, collect the supernatant, filter and enter the HPLC for detection results.

[0176] Example 2: Optimization of fermentation medium composition for lin-EGT574, an intermediate in the biosynthesis of lincomycin.

[0177] The intermediate product lin-EGT574 was fermented using existing initial seed and fermentation medium formulations for lincomycin production. The yield was low, and batch-to-batch fermentation data were unstable, with a yield of 37.9 mg / L. The fermentation medium composition was optimized by modifying its main components and their amounts. Adjustments were made to the amounts and removal of reagents such as starch, glucose, corn steep liquor powder, sodium chloride, calcium carbonate, soybean meal, sodium nitrate, potassium dihydrogen phosphate, ammonium sulfate, and ammonium nitrate in the fermentation medium. The specific scheme and results after 5 days of fermentation are shown in Table 1.

[0178] Table 1

[0179]

[0180]

[0181] Note: Soybean meal powder A and B come from different manufacturers.

[0182] As shown in Table 1, reducing the amount of corn steep liquor powder and removing nitrates significantly improved the yield of lin-EGT574. Among them, the G formula, which simultaneously removed nitrates, ammonium salts, and sodium chloride, reduced the amount of corn steep liquor powder, and increased the starch and glucose content, achieved the highest lin-EGT574 yield of 217.2 mg / L. Based on the C formula with a corn steep liquor powder content of 2.5 g / L, the starch and glucose content was further optimized on the basis of the G formula. The optimized scheme and fermentation results are shown in Table 2.

[0183] Table 2

[0184]

[0185] With the optimized formula, starch content is 24 g / L and glucose content is 80 g / L, and the yield of lin-EGT574 can reach a maximum of 617.8 mg / L.

[0186] Example 3: Knocking out the moe gene cluster-related gene in the fermentation strain SLINC-ΔlmbV-5355, which produces the lin-EGT574 intermediate in the biosynthesis of lincomycin.

[0187] The monoxamycin gene cluster *moe* is not related to the biosynthesis of *Streptomyces lincosae*, but it competes with the accumulation of lincosaecin and the intermediate lin-EGT574 for precursors. It is speculated that knocking it out could increase the yield of the intermediate lin-EGT574. The SLINC6338, SLINC6339, and SLINC63340 genes in the *moe* gene cluster were knocked out. Homologous recombination was used to design primers *moe-1*, *moe-2*, *moe-3*, and *moe-4* for the left and right homologous arms, respectively. A 51 bp artificially designed ΦC31-attB site sequence was introduced into the *moe-2* and *moe-3* primer sequences, ultimately inserted between the left and right homologous arms, and a homologous recombination knockout plasmid was constructed. *Streptomyces lincosae* lacks the ΦC31-attB integration site; by introducing the ΦC31-attB integration site at the site of the monoxamycin-related gene knockout, it is possible to facilitate the subsequent multi-site integration and multiplication of related genes. The knockout plasmid was introduced into the SLINC-ΔlmbV-5355 strain via conjugation transfer. The positive mutant strain SLINC-Δmoe-ΔlmbV-5355 was obtained by double exchange screening, PCR and sequencing verification.

[0188] The primer sequences used to amplify the left and right homologous arms are shown below:

[0189] moe-1:cttgcggcagcgtgaagcttGCCGAAGCCCAGCAGATGAC(SEQ ID NO:1)

[0190] moe-2: gcccaagggcacgcctggcacccgcaccgGCTGTTCTCCGGCATGTGGC (SEQ ID NO: 2)

[0191] moe-3: cggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccaccAGGGAGGGCAGGTCTGTCACG (SEQ ID NO: 3)

[0192] moe-4:acctgcaggcatgcaagcttATCTTCGCCGCCTGGGAGTG(SEQ ID NO:4)

[0193] The selected positive mutant strains were fermented using the optimized culture medium, and the highest yield of the intermediate compound lin-EGT574 reached 893 mg / L (Table 3).

[0194] Table 3

[0195] strain name lin-EGT574 yield / mg / L SLINC-Δmoe-ΔlmbV-5355-1# 683.9 SLINC-Δmoe-ΔlmbV-5355-2# 537.6 SLINC-Δmoe-ΔlmbV-5355-3# 630.7 SLINC-Δmoe-ΔlmbV-5355-4# 768.4 SLINC-Δmoe-ΔlmbV-5355-5# 851.5 SLINC-Δmoe-ΔlmbV-5355-6# 893.0 SLINC-Δmoe-ΔlmbV-5355-7# 810.3 SLINC-Δmoe-ΔlmbV-5355-8# 809.2 SLINC-Δmoe-ΔlmbV-5355-9# 833.4 SLINC-Δmoe-ΔlmbV-5355-10# 797.6

[0196] Example 4: Doubling of the egt gene cluster in the fermentation strain SLINC-Δmoe-ΔlmbV-5355-6# of lin-EGT574, an intermediate in the biosynthesis of lin-codone.

[0197] Within *Streptomyces lincomycetes*, EGT participates in the lincomycin biosynthesis pathway as a circulating carrier. It mediates the transfer of glycosyl groups from GDP-octose sugars to EGT, which then condenses with the PPL unit in synergistic action with adenylate glycosylase LmbC, the N-terminal carrier protein LmbN, and the LmbD protein to form the lin-EGT574 intermediate compound. Therefore, doubling the entire egt gene cluster and enhancing EGT biosynthesis may help increase the accumulation of the lin-EGT574 intermediate compound. Amino acid sequence alignment analysis with the EgtABCDE proteins involved in EGT biosynthesis in the mycobacterium *Mycobacterium smegmatis* revealed that the EGT biosynthesis gene cluster in *Streptomyces lincosum* comprises five genes, totaling 6.3 kb in length: egtA (SLINC_7407), egtB (SLINC_7408), egtC (SLINC_7406), egtD (SLINC_7405), and egtE (SLINC_2488). egtABCD are clustered together, while egtE is distributed in other locations. Using a multi-fragment recombination cloning method, the PermE promoter, egtABCD gene fragments, and egtE gene were ligated into the pSOK804 vector, successfully constructing the plasmid Dme-egtABCDE, which multiplies the egt gene cluster. In order to enable the egtABCDE gene cluster to undergo multiple site-specific integrations in Streptomyces lincosae, the φC31-attP-int integration module on the pSET152 plasmid was cloned into the Dme-egtABCDE plasmid, and finally the plasmid Dme-egt-C31 containing two integration systems, VWB and φC31, was constructed.

[0198] The primer sequences for amplifying the egtABCDE gene fragment and the φC31-attP-int integration module are as follows:

[0199] egtABCD-F:AGCCCCGCCGCCCTGCCGtctagaggttcccgcggccacgatcc(SEQ ID NO:5)

[0200] egtABCD-R:catggagggcgcgaagcttGTTCCACCGTGCCTCAGGCC(SEQ ID NO:6)

[0201] egtE-F: CCTGAGGCACGGTGGAACgaccaaaccctagccgacgc (SEQ ID NO:7)

[0202] egtE-R:atggagggcgcgaagcttCAAGGCCTACGGGCATGAGG(SEQ ID NO:8)

[0203] 152 aacagctatgacatgattacCAGGCTTCCCGGGTGTCTCG (SEQ ID NO:9)

[0204] 152 gtcgggctggtaccgaattcAAGCTCTAGCGATTCCAGAC(SEQ ID NO:10)

[0205] The chromosome of strain SLINC-△moe-△lmbV-5355-6# contains two types of integration sites: VWB-attB and φC31-attB. Plasmid Dme-egt-C31 was conjugated into this strain, and PCR verification of the integration sites on the conjugates revealed a mutant strain [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31, which integrates both VWB-attB and φC31-attB. After shake-flask fermentation using optimized culture medium, the highest yield of the intermediate compound lin-EGT574 reached 1046.9 mg / L (Table 4).

[0206] Table 4

[0207] strain name lin-EGT574 yield / mg / L [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-1# 680.1 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-2# 577.5 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-3# 656.4 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-4# 1036.5 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-5# 910.7 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-6# 647.3 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-7# 637.3 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-8# 1046.9 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-9# 968.6 [SLINC-△moe-△lmbV-5355-6#]Dme-egt-C31-10# 595.3

[0208] Example 5: Extraction of a segment of lin-EGT574, an intermediate in the biosynthesis of lincomycin.

[0209] 1. Solid-liquid separation and pretreatment of fermentation broth

[0210] Compound Lin-EGT574 was present in both the supernatant and the bacterial cells of the fermentation broth. The fermentation broth was filtered through a 400-600 mesh filter cloth to separate the solid and liquid components, yielding the supernatant and filter residue. The filter residue was soaked in methanol and subjected to ultrasonic-assisted bacterial disruption. The methanol soaking solution was then concentrated to a solid state, dissolved in pure water, and mixed with the supernatant.

[0211] 2. Ceramic membrane filtration

[0212] The pretreated fermentation supernatant was filtered through a 50 nm ceramic membrane to remove residual fine particles. To minimize the permeate volume while maximizing the permeate yield of lin-EGT574, the principle of maintaining a relatively small retentate volume was followed, and makeup water was added in small, multiple batches. The resulting permeate was used for the next purification step, achieving a lin-EGT574 recovery rate of 99%.

[0213] 3. Ultrafiltration

[0214] The permeate from the ceramic membrane was purified using 5kD or 10kD ultrafiltration membranes to retain large molecules in the fermentation broth, removing most proteins and some small molecule impurities. Based on the overall separation results, the 5kD ultrafiltration membrane showed better filtration efficiency than the 10kD membrane. To minimize the permeate volume while maximizing the permeate yield of lin-EGT574, the principle of maintaining a relatively small retentate volume was followed, and makeup water was added in small, multiple batches. The resulting permeate was used for the next purification step, achieving a lin-EGT574 recovery rate of 99%.

[0215] 4. Macroporous resin adsorption and enrichment

[0216] XAD-2 resin was used. Before loading onto the column, the resin was pretreated by soaking it in saturated saline solution and shaking for 16-19 hours. Then, the saline solution was removed, and the resin was soaked in 4% sodium hydroxide solution and shaking for 4 hours. It was then washed with pure water until neutral. The ultrafiltrate was then mixed with the pretreated resin and adsorbed for approximately 12 hours using shaking. The solution was then packed into a chromatography column with a column adhesion rate of approximately 96%. The column was washed with pure water until colorless, and then eluted with 30% methanol. The collected solution was concentrated, with an elution efficiency of approximately 70%, indicating some loss.

[0217] Purification was performed using D101 resin, with adjustments made to the column loading and elution methods. Before use, the D101 macroporous resin was soaked in 95% ethanol for at least 24 hours. Before loading, the ethanol was first replaced with pure water until the effluent was colorless. With the bottom valve fully open, the ultrafiltration permeate obtained in the previous step was loaded onto the column. After all the ultrafiltration permeate had been loaded, it was washed with pure water until the effluent was colorless. Then, elution was performed with 95% ethanol or anhydrous ethanol until the effluent was nearly colorless. The resulting ethanol eluent was concentrated to a solid state and dissolved in a small amount of pure water for use in the next purification step. The elution efficiency of this step was approximately 95%. Using D101 resin, the resin adhesion rate of lin-EGT574 reached 100%, with each 100g of resin adsorbing at least 200mg of lin-EGT574.

[0218] Example 6: Two-stage extraction of lin-EGT574, an intermediate in the biosynthesis of lincomycin

[0219] The aqueous solution obtained from the resin elution step was subjected to a first-stage preparative purification using a medium-pressure liquid chromatography (LC) system from Lishui Technology. The packing material was C18, and the sample loading per injection was approximately 300 mg, with a volume of about 20 mL. The mobile phase consisted of water and acetonitrile. The LC program was as follows: acetonitrile ratio 5%, flow rate 60 mL / min, detection wavelength 280 nm, collection wavelength 243 nm. Equilibration was allowed for 10-15 min before injection. Compound lin-EGT574 eluted and began to be collected at 5-6 min, ending collection at 18-19 min. The resulting effluent was concentrated to a solid state and dissolved in a small amount of pure water for further purification. The recovery rate of lin-EGT574 in this step was 86%.

[0220] The first prepared aqueous solution was subjected to a second preparation and separation. Ammonium acetate aqueous solutions of 0.4 g / L, 1 g / L, 2 g / L, and 4 g / L were selected as the aqueous phase and acetonitrile as the organic phase to prepare lin-EGT574. According to the experimental results, the 4 g / L ammonium acetate aqueous solution and acetonitrile as the mobile phase had the best separation effect between lin-EGT574 and impurities.

[0221] The HPLC program was as follows: acetonitrile ratio 5%, flow rate 60 mL / min, detection wavelength 280 nm, collection wavelength 243 nm. Equilibration was performed for 10-15 min before injection. lin-EGT574 eluted and began collection after 2-2.5 min. To ensure maximum recovery, purification was performed twice: the first collection interval was 2-5 min, and the second collection interval was 5-10 min. The purity of lin-EGT574 in the first collection interval reached 95% (HPLC detection details are available). Figure 2 The purity of the second collection interval was low, requiring a third purification. The effluent collected for 2.5-4 minutes also achieved a purity of 95%. The recovery rate of lin-EGT574 prepared under the second medium-pressure method was 87%.

[0222] In summary, the recovery rate of lin-EGT574 was 75% across all steps of this medium-pressure preparation.

[0223] Example 7: Hydrolysis process of lin-EGT574, an intermediate in the biosynthesis of lincomycin

[0224] Acid hydrolysis: The product obtained in the second preparation was concentrated to a certain volume by rotary evaporation, and the pH was adjusted to a strongly acidic system using concentrated hydrochloric acid. The mixture was then refluxed in a water bath at 95-98℃. The EGT of the hydrolyzed product was measured (LC-MS results are shown in [link]). Figure 3 ).

[0225] 1. Take 200 mg of the purified lin-EGT574 compound from the second preparation, dissolve it in 40 mL of hydrochloric acid solution with a pH of 0.5, and reflux it magnetically at 95 °C for 3 h in a round-bottom flask. After the reaction is complete, remove the reaction solvent by rotary evaporation, and then dissolve it in ethanol.

[0226] Phenomenon: The reaction system remained clear and transparent from start to finish. After rotary evaporation, the hydrolysis product was dissolved in 12 mL of ethanol, and a large amount of substances insoluble in ethanol were found. The insoluble matter was then separated from the supernatant by centrifugation. The supernatant was diluted 100 times and analyzed by HPLC, which showed that 38 mg of EGT was present in the hydrolysis product, but no lin-EGT574 was found. The hydrolysis recovery rate was 47.6%.

[0227] Given that the precipitate is insoluble in ethanol, it was initially suspected that the precipitate is a macromolecule. An attempt was made to dissolve the precipitate with pure water, and it was found that the precipitate is soluble in water, but the solubility is not very good. It will appear as flocculent material in aqueous solution, suggesting that it is a polysaccharide.

[0228] 2. Take 400 mg of the second purified lin-EGT574 compound, adjust the pH to 1.1 with sulfuric acid or hydrochloric acid, reflux at 98℃ for 4 hours to obtain 96 mg of EGT, with a hydrolysis recovery efficiency of 62.7%.

[0229] 3. Take 474 mg of the second purified lin-EGT574 compound, adjust the pH to 2.1 with sulfuric acid or hydrochloric acid, reflux at 98℃ for 4 hours to obtain 40 mg of EGT, with a hydrolysis recovery efficiency of 21.1%.

[0230] 4. Take 1300 mg of the second purified lin-EGT574 compound, adjust the pH to 1.1 with sulfuric acid or hydrochloric acid, reflux at 98℃ for 4 hours to obtain 300 mg of EGT, with a hydrolysis recovery efficiency of 58%.

[0231] The above hydrolysis examples show that the hydrolysis efficiency is relatively high at around pH 1.1, about 60%, and that too strong or too weak acidity will have a certain impact on its hydrolysis.

[0232] Example 8: Purification of EGT from Hydrolysis Products

[0233] The hydrolysis products of lin-EGT574 were analyzed by LC-MS. Based on the mass spectrometry ion current intensity analysis, EGT accounted for 40% and PPL-octose sugar accounted for approximately 50%, these two fractions being the main components. The hydrolysis products were separated and purified using a 001*7 strong acid cation exchange resin.

[0234] Hydrolysate containing 220 mg of EGT was taken, and the pH value was measured to be 1.2. The sample was loaded into the prepared 001*7 strong acid cation exchange resin. After washing with pure water for 5 column volumes, it was eluted with 0.2% NaOH (pH value 12.3-12.5). The final EGT yield after elution was 72%.

[0235] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A method for engineering strains to increase the yield of lincomycin biosynthetic intermediates, characterized in that, The method includes the following steps: A starting strain for fermentation production of lincomycin is provided, wherein the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the genome of the starting strain are knocked out, and the EGT biosynthesis gene cluster in the genome of the starting strain is multiplied.

2. The method as described in claim 1, characterized in that, The EGT biosynthesis gene cluster includes genes selected from the following group: egtA (SLINC_7407), egtB (SLINC_7408), egtC (SLINC_7406), egtD (SLINC_7405), egtE (SLINC_2488), or combinations thereof.

3. The method as described in claim 1, characterized in that, The starting strain is wild-type Streptomyces lincosum or SLINC-ΔlmbV-5355 strain.

4. The method as described in claim 1, characterized in that, The method includes the following steps: (S1) Knock out the SLINC6338, SLINC6339 and SLINC63340 genes in the meo gene cluster of the starting strain and introduce the attB site recognized by the exogenous ΦC31 integrase. (S2) The vector containing (i) the VWB integrase module and the ΦC31 integrase module and (ii) the EGT biosynthesis gene cluster is introduced into the strain obtained in step (S1) to obtain the engineered strain of Streptomyces lincosae.

5. A fermentation culture medium, characterized in that, The fermentation medium contains, or is composed of, the following components: Starch 6-23 g / L; Corn steep liquor dry powder 1-4.9g / L; Glucose 45-90g / L; Soybean meal powder 27-30g / L; Potassium dihydrogen phosphate 0.2-0.3 g / L; Magnesium sulfate 0.05-0.15 g / L; Calcium carbonate 5-10g / L; Sodium chloride 0-7 g / L; Sodium nitrate 0-9 g / L; Ammonium sulfate 0-3 g / L; Ammonium nitrate 0-15g / L.

6. The fermentation medium as described in claim 5, characterized in that, The fermentation medium contains, or is composed of, the following components: Starch 19-23 g / L, corn steep liquor powder 4.5-4.9 g / L, glucose 47-90 g / L, soybean meal powder 28-29 g / L, potassium dihydrogen phosphate 0.2-0.25 g / L, magnesium sulfate 0.05-0.1 g / L, calcium carbonate 7-9 g / L, sodium chloride 0-5 g / L, sodium nitrate 0-6 g / L, ammonium sulfate 0-2 g / L, ammonium nitrate 0-1 g / L.

7. A method for preparing lin-EGT574, an intermediate product in the biosynthesis of lincomycin, characterized in that, Including the following steps: (a) Fermenting the engineered strain of Streptomyces lincosae as described in claim 1; (b) Extract the intermediate product lin-EGT574 from the fermentation product.

8. The preparation method according to claim 7, characterized in that, In step (a), fermentation is carried out using the fermentation medium as described in claim 5 or 6.

9. The preparation method according to claim 7, characterized in that, Step (b) includes the following steps: (b1) Separate the solid and liquid components of the fermentation product, break down the bacteria in the filter residue obtained after separation, and mix it with the fermentation supernatant to obtain the first solution; (b2) The first solution is filtered and ultrafiltered to obtain a second solution; (b3) The second solution is purified by resin adsorption, and the resin is eluted to obtain the third solution; (b4) The third solution was purified by medium-pressure liquid chromatography to obtain the intermediate product lin-EGT574.

10. A method for preparing ergothioneine, characterized in that, Including the following steps: The lin-EGT574 intermediate in the biosynthesis of lincomycin was hydrolyzed, and the hydrolysis product was purified using resin to obtain ergothioneine. The hydrolysis is carried out under pH 1.1-1.2 conditions.

Images