Taq DNA polymerase mutant resistant to human whole blood and application thereof

Abstract

The application discloses a Taq DNA polymerase mutant resistant to human whole blood and application thereof, relates to the field of biology, and the amino acid sequence of natural Taq DNA polymerase is shown as SEQ ID NO. 1. The mutant comprises all combination mutants of two or three of G395A, L408I and F413Y sites. The application is based on natural Taq DNA polymerase, and the molecular structure of the Taq DNA polymerase is reformed by rational design and a site-directed mutation biological technology, so that the Taq DNA polymerase mutant is more suitable for PCR amplification of samples containing human whole blood and the like than the wild type, and is more beneficial to the accuracy of result evaluation of samples containing human whole blood inhibitors.

Description

Technical Field

[0001] This invention relates to the field of biology, and more specifically, to a Taq DNA polymerase mutant resistant to human whole blood and its applications. Background Technology

[0002] Taq DNA polymerase, a core enzyme in polymerase chain reaction (PCR), is currently the most widely used DNA polymerase. However, studies have shown that conventional Taq DNA polymerase completely loses its polymerization activity in whole blood samples containing 0.2% (v / v) or higher. Potential PCR inhibitors identified in blood mainly include heme, immunoglobulin G (IgG), hemoglobin, and lactoferrin. Given that both human whole blood and lactoferrin contain iron ions, their ability to release iron is considered one of the potential inhibitory mechanisms. Existing research has preliminarily elucidated the molecular mechanisms of action of these inhibitors: hemoglobin and heme can impair amplification efficiency by reducing DNA polymerase activity; simultaneously, in real-time fluorescence detection-based methods (such as qPCR and dPCR), hemoglobin and heme are also key molecules in blood samples causing fluorescence quenching. Furthermore, IgG is thought to delay the PCR amplification process by binding to single-stranded genomic DNA (ssDNA), interfering with the effective binding of primers or templates, thus manifesting as an increased cycle threshold (Ct). Given that existing studies mostly focus on whole blood samples or single inhibitor analysis, and generally use commercially available DNA polymerases that have been engineered (such as buffer system optimization, site-directed mutagenesis, or domain fusion), there is still a lack of systematic evaluation of the inhibitory effects of whole blood environment and key inhibitors on wild-type Taq DNA polymerase.

[0003] Taq DNA polymerase, the first thermostable DNA polymerase discovered, has a molecular weight of 94 kDa. It was initially extracted by Saiki et al. from a strain of thermophilic bacterium *Thermus aquaticus* isolated from hot springs. This enzyme is heat-resistant; after 2 hours at 70°C, its residual activity is greater than 90% of the original activity; after 2 hours at 93°C, its residual activity is 60% of the original activity; and after 2 hours at 95°C, its residual activity is 40% of the original activity. In molecular cloning, Taq DNA polymerase can be used for DNA sequencing and for in vitro amplification of specific DNA fragments using polymerase chain reaction (PCR). During PCR, because Taq DNA polymerase is not inactivated during the denaturation step (approximately 94°C), it can directly enter the second cycle, eliminating the need to add fresh enzyme at each cycle. This makes Taq DNA polymerase a unique enzyme in PCR reactions.

[0004] PCR technology is a cornerstone of modern molecular biology, and Taq DNA polymerase is the classic mainstay of PCR technology. Based on the inherent functions and characteristics of Taq DNA polymerase, it has been modified through techniques such as site-directed mutagenesis, domain recombination, and directed evolution. This has resulted in many mutants of Taq polymerase exhibiting improved catalytic performance or new functions, which are widely used in molecular biology fields, such as direct PCR, allele detection, Sanger sequencing, quantitative real-time PCR, and Taq cloning. However, because commonly used clinical samples contain many substances, especially human whole blood, that significantly inhibit PCR amplification, there is a problem of low tolerance of Taq DNA polymerase to human whole blood. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a Taq DNA polymerase mutant resistant to human whole blood. This mutant is obtained by mutating amino acids at positions 37 and / or 314 and / or 387 of the Taq DNA polymerase shown in SEQ ID NO.1. It can tolerate high concentrations of blood or blood products and can be directly applied in in vitro diagnostic or direct amplification blood reagent kits, simplifying the operation process.

[0006] The above-mentioned technical objective of the present invention is achieved through the following technical solution: A human whole blood resistant Taq DNA polymerase mutant, the amino acid sequence encoding the Taq DNA polymerase being shown in SEQ ID NO. 1, wherein the mutant comprises all combinations of two or three of the G395A, L408I, and F413Y sites.

[0007] SEQ ID NO.1: * In one embodiment, the G395A / F413Y site mutation involves mutating glycine at position 395 to alanine and phenylalanine at position 413 to tyrosine in the Taq DNA polymerase, as shown in SEQ ID NO.1, with the amino acid sequence shown in SEQ ID NO.2.

[0008] SEQ ID NO.2: * In one embodiment, the L408I / F413Y site mutation involves mutating leucine at position 408 of the Taq DNA polymerase, as shown in SEQ ID NO.1, to isoleucine and phenylalanine at position 413, to tyrosine, with the amino acid sequence shown in SEQ ID NO.3.

[0009] SEQ ID NO.3: * In another embodiment, the G395A / L408I / F413Y site mutation involves mutating glycine at position 395 to alanine, leucine at position 408 to isoleucine, and phenylalanine at position 413 to tyrosine in the Taq DNA polymerase, as shown in SEQ ID NO.1, with the amino acid sequence shown in SEQ ID NO.4.

[0010] SEQ ID NO.4: * This invention provides a method for preparing the above-mentioned Taq DNA polymerase mutant resistant to human whole blood, the specific steps of which are as follows: (1) Using the amino acid sequence shown in SEQ ID NO.1 as a template, design site-directed mutagenesis primers according to the rationally designed sites, perform PCR amplification to obtain the gene containing the mutation site, and then construct a vector containing the gene encoding the mutant. (2) Transform the gene vector containing the coding mutant into the host cell; (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Then, culture and ferment to produce enzymes, collect cells by centrifugation, break the cells using an ultrasonic cell disruptor, and centrifuge to obtain crude enzyme solution containing Taq DNA polymerase mutant.

[0011] The present invention also provides a gene encoding the above-mentioned Taq DNA polymerase mutant.

[0012] The present invention also provides a recombinant vector carrying the above-mentioned genes.

[0013] In one embodiment, the recombinant vector uses the pET-28a(+) vector as the expression vector.

[0014] The present invention also provides a recombinant cell carrying the above-mentioned gene or the above-mentioned recombinant vector.

[0015] In one embodiment, the recombinant cells are Escherichia coli (E. coli) Escherichia coli () is the expression host.

[0016] The present invention also provides a genetically engineered bacterium, which uses Escherichia coli as a host and expresses the above-mentioned Taq DNA polymerase mutant.

[0017] In one embodiment, the genetically engineered bacteria uses Escherichia coli BL21(DE3) as the expression host.

[0018] In another embodiment, the genetically engineered bacteria use the pET-28a(+) vector as the expression host.

[0019] This invention provides a method for constructing a Taq DNA polymerase mutant resistant to human whole blood, wherein the method involves mutating amino acids at positions 395, 408, or 413 of the Taq DNA polymerase as shown in SEQ ID NO.1.

[0020] The mutation improves enzyme activity, enzyme stability, and tolerance to higher concentrations of blood or blood products.

[0021] The present invention provides the use of the above-mentioned recombinant vector, or the above-mentioned recombinant cells, in the preparation of Taq DNA polymerase.

[0022] The present invention provides the application of the above-mentioned Taq DNA polymerase mutant, or the gene encoding the above-mentioned mutant, or the above-mentioned recombinant vector, or the Taq DNA polymerase expressed by the above-mentioned recombinant cells in the amplification of PCR reactions containing human whole blood samples.

[0023] The Taq DNA polymerase mutant described above can amplify in the presence of 1-20% (v / v) human whole blood, preferably in the presence of 1-10% (v / v) human whole blood.

[0024] Beneficial effects: 1. Based on natural Taq DNA polymerase, this invention modifies the molecular structure of Taq DNA polymerase through rational design and site-directed mutagenesis biotechnology, analyzes the effect of mutated residues on the enzyme's tolerance to human whole blood, and finally obtains two mutant strains, R37A, K314A and P387L, with improved stability due to single-point mutation.

[0025] 2. Natural Taq DNA polymerase can amplify in the presence of 0.02% (v / v) human whole blood. The Taq DNA polymerase mutant G395A / F413Y provided by this invention can amplify in the presence of 5% (v / v) human whole blood, which is 250 times that of natural Taq DNA polymerase; the Taq DNA polymerase mutant L408I / F413Y can amplify in the presence of 5% (v / v) human whole blood, which is 250 times that of natural Taq DNA polymerase; and G395A / L408I / F413Y can amplify in the presence of 10% (v / v) human whole blood, which is 500 times that of natural Taq DNA polymerase.

[0026] 3. The Taq DNA polymerase mutant obtained by this invention is more suitable for PCR amplification of human whole blood samples than the wild type, and is more conducive to the accuracy of result evaluation of samples containing human whole blood inhibitors. Attached Figure Description

[0027] Figure 1 This is a graph showing the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the washing buffer during the purification of Taq DNA polymerase. Figure 2 A standard curve for Taq DNA polymerase activity assay; Figure 3 Agarose gel electrophoresis results for Taq-wt, Taq-G395A / F413Y, Taq-L408I / F413Y, and Taq-G395A / L408I / F413Y in human whole blood at gradients of 0%, 0.02% (v / v), 1% (v / v), 5% (v / v), 10% (v / v), and 20% (v / v). Detailed Implementation

[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] The pET-28a(+) vectors used in the following examples were purchased from Invitrogen.

[0030] The culture media involved in the following examples are as follows: (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0031] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0032] The detection methods involved in the following embodiments are as follows: Taq DNA polymerase activity assay uses a fluorescence method. This method utilizes the fact that Taq DNA polymerase can amplify double-stranded DNA using long-chain oligonucleotides as templates and a short single-stranded oligonucleotide complementary to the long-chain oligonucleotide at the 5' end as a primer. The fluorescent dye SYBR Green binds to the minor groove of the double-stranded DNA and emits fluorescence; the more DNA double strands synthesized, the stronger the fluorescence signal. The real-time fluorescence signal collected by the DNA polymerase amplification is analyzed, and the initial slope of the real-time fluorescence signal curve can be used to determine the enzyme activity units at the beginning of the reaction. The method for determining enzyme activity mainly consists of two steps: (1) plotting a standard curve of known commercial Taq DNA polymerase activity units; (2) determining the activity units of unknown enzymes.

[0033] In the PCR detection system, a 236 bp amplicon from the human genome was used to investigate the tolerance of Taq DNA polymerase to human whole blood. The 25 μL PCR reaction mixture consisted of: 1×PCR buffer, 2.5 mM MgCl2, 0.2 μM upstream primer, 0.02 μM downstream primer, 200 μM dNTPs, 0.4×SYBR Green, and 1 U of enzyme. The template concentration was 1 ng / μL, and 2 μL was loaded. The concentration of human whole blood in the system was increased in a gradient, and the PCR products were analyzed by nucleic acid electrophoresis.

[0034] Example 1: Construction of recombinant plasmid containing Taq DNA polymerase mutant The specific steps are as follows: (1) Construction of recombinant plasmids containing wild-type Taq DNA polymerase The wild-type Taq DNA polymerase gene polA, with an amino acid sequence as shown in SEQ ID NO.1, was chemically synthesized and ligated with the pET-28a(+) vector after digestion with NdeI and MluI enzymes to prepare the recombinant vector pET-28a(+)-polA.

[0035] (2) Obtaining recombinant vectors containing mutants: Using whole plasmid PCR technology, the recombinant vector pET-28a(+)-polA prepared in step (1) was used as a template for site-directed mutagenesis to obtain recombinant plasmids pET-28a(+)-G395A / F413Y, pET-28a(+)-L408I / F413Y containing mutant genes.

[0036] The designed primer sequences are as follows: R37A-F: CTGACCACGAGCgcgGGCGAACCGGTG R37A-R: CTTGCACCGGTTCGCCcgcGCTCGTG K314A-F: CTTTGTGCTGAGCCGCgcgGAGCCGATG K314A-R: CACATCGGCTCcgcGCGGCTCAGCAC P387L-F: CAACACCACCttaGAAGGCGTGGCG P387L-R: GCCACGCCTTCtaaGGTGGTGTTGC The PCR amplification program was set as follows: first, pre-denaturation at 95℃ for 5 min; then 30 cycles; denaturation at 95℃ for 30 s, annealing at 72℃ for 30 s, extension at 58℃ for 3.5 min, and incubation at 4℃. PCR products were detected by 0.8% agarose gel electrophoresis.

[0037] The final amplified fragment was treated with Dpn I enzyme in a 37°C water bath for 1 h to remove the template. Then, the PCR mixture was chemically transformed into E. coli JM109 competent cells. The transformation solution was plated on LB solid medium containing kanamycin (50 μg / mL), and the plasmid was extracted and sequenced. The sequencing was performed by Genewiz Suzhou.

[0038] Example 2: Construction of recombinant Escherichia coli engineered strain with Taq DNA polymerase mutant and expression, isolation, and purification of Taq DNA polymerase. The specific steps are as follows: (1) The recombinant plasmids pET-28a(+)-G395A / F413Y, pET-28a(+)-L408I / F413Y, and pET-28a(+)-G395A / L408I / F413Y obtained in Example 1 were transformed into E. coli BL21 competent cells to prepare the following genetically engineered bacteria: E. coli BL21 / pET-28a(+)-polA, E. coli BL21 / pET-28a(+)-G395A / F413Y, E. coli BL21 / pET-28a(+)-L408I / F413Y, and E. coli BL21 / pET-28a(+)-G395A / L408I / F413Y.

[0039] (2) The genetically engineered bacteria prepared in step (1) were inoculated into 10 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate and cultured overnight at 37 °C and 200 rpm to prepare seed culture. The prepared seed culture was transferred to 100 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate at an inoculation rate of 2% (v / v) and cultured at 30 °C for 20 h to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 × g at 4 °C for 5 min to obtain cell cells. After washing the cells three times, they were resuspended in 10 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0).

[0040] The resuspended cells were treated with an ultrasonic disruptor in an ice bath for 30 min, centrifuged for 30 min (8000×g, 4℃), and the supernatant was discarded to obtain the crude enzyme solution. The supernatant was filtered through a 0.22 µm filter and then loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM wash buffer (20 mM Tris and 500 mM NaCl, pH 7.4). Unbound proteins and Taq DNA polymerase were then eluted with a linear gradient using elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4). Pure enzyme solutions containing wild-type Taq DNA polymerase, G395A / F413Y, L408I / F413Y, and G395A / L408I / F413Y were prepared.

[0041] The purified enzyme solutions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The results are as follows: Figure 1As shown in the figure, the results indicate that there is a clear band at 94 kDa, proving that Taq DNA polymerase is expressed.

[0042] (3) Perform enzyme activity assay on the pure enzyme solution prepared in step (2). The pure enzyme solutions containing wild-type Taq DNA polymerase, G395A / F413Y, L408I / F413Y, and G395A / L408I / F413Y prepared in step (2) were tested respectively.

[0043] The designed primer sequences are as follows: 236bp-F: TGGGCTTGAATAGTTAGATGCT 236bp-R: GCCTTCGCCTGTCCTCAT Plot a standard curve for known Taq DNA polymerase activity units (e.g.) Figure 2 As shown in Table 1, the curves from the real-time fluorescence PCR instrument were exported, and the initial slopes of each curve were analyzed using Origin software. Table 1 Initial slope of DNA polymerase activity quantification curve

[0044] Example 3: Resistance of Taq DNA polymerase mutants to human whole blood test This test used quantitative real-time PCR to detect the inhibitory activity of Taq-wt, Taq-G395A / F413Y, Taq-L408I / F413Y, and Taq-G395A / L408I / F413Y against human whole blood. Using 5 ng of human cDNA as a template, 525 bp fragments were amplified using wild-type Taq DNA polymerase and each Taq DNA polymerase mutant, respectively. The 25 μL PCR reaction system consisted of: 1×PCR buffer, 2.5 mM MgCl2, 0.2 μM upstream primer, 0.02 μM downstream primer, 200 μM dNTPs, 0.4×SYBR Green, and 1 U of enzyme. The template concentration was 1 ng / μL, and 2 μL was loaded. Human whole blood was used at gradients of 0%, 0.02% (v / v), 1% (v / v), 5% (v / v), 10% (v / v), and 20% (v / v). The reaction program was: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s / cycle, for a total of 45 cycles. After the reaction, the amplification curves were analyzed, and the reaction products were detected by electrophoresis on a 3% agarose gel. The nucleotide sequences of the primers used are as follows: 525bp-F:TTGGTGGAGGTATGTTTAGATTT 525bp-R:TCGCCTGTCCTCATGTATTG Experimental results are as follows Figure 3 Show.

[0045] In summary, this invention, based on natural Taq DNA polymerase, modifies the molecular structure of Taq DNA polymerase through rational design and site-directed mutagenesis biotechnology, analyzes the effect of mutated residues on the enzyme's tolerance to human whole blood, and ultimately obtains three mutant strains with improved tolerance to human whole blood: G395A / F413Y, L408I / F413Y, and G395A / L408I / F413Y. The Taq DNA polymerase mutants G395A / F413Y provided by this invention can amplify in the presence of 5% (v / v) human whole blood, which is 250 times that of natural Taq DNA polymerase; the Taq DNA polymerase mutant L408I / F413Y can amplify in the presence of 5% (v / v) human whole blood, which is 250 times that of natural Taq DNA polymerase; and G395A / L408I / F413Y can amplify in the presence of 10% (v / v) human whole blood, which is 500 times that of natural Taq DNA polymerase. In other words, the Taq DNA polymerase mutants are more suitable than the wild type for PCR amplification of samples containing human whole blood, and are more conducive to the accurate interpretation of results for samples containing human whole blood inhibitors.

[0046] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. A Taq DNA polymerase mutant resistant to human whole blood, characterized in that, The amino acid sequence encoding the Taq DNA polymerase is shown in SEQ ID NO. 1, and the mutant comprises a combination of two or three mutants selected from the G395A, L408I, and F413Y sites.

2. A gene encoding the Taq DNA polymerase mutant of claim 1.

3. A recombinant vector carrying the gene of claim 2.

4. A recombinant cell carrying the gene of claim 2 or the recombinant vector of claim 3.

5. A genetically engineered bacterium expressing the Taq DNA polymerase mutant of claim 1.

6. The genetically engineered bacterium according to claim 5, characterized in that, Its hosts include, but are not limited to, Escherichia coli, Bacillus subtilis, and Corynebacterium glutamicum.

7. A method for preparing a Taq DNA polymerase mutant resistant to human whole blood, characterized in that, The genetically engineered bacteria described in claim 5 are cultured, fermented to produce enzymes, and the cells are collected by centrifugation, broken, and centrifuged again to obtain a crude enzyme solution containing a Taq DNA polymerase mutant.

8. The use of the recombinant vector of claim 3 or the recombinant cell of claim 4 in the preparation of Taq DNA polymerase.

9. The use of the Taq DNA polymerase mutant of claim 1 in the amplification of PCR reactions containing human whole blood samples.

Images