Biotin-labeled exogenous circular dna, its construction method and application in protein interaction

By designing specific primers to amplify and self-ligate linear DNA to form biotin-labeled circular DNA, and combining enzyme digestion and magnetic bead purification techniques, the technical challenges of studying the structural stability of circular DNA in cells and protein interactions were solved, achieving efficient identification of circular DNA and protein interactions.

CN122104678APending Publication Date: 2026-05-29ZHEJIANG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2026-01-23
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies struggle to stably construct and maintain the structural integrity of circular DNA within cells, and there is a lack of effective methods to explore its interaction network with proteins, resulting in a technical bottleneck in the study of eccDNA-protein interactions.

Method used

By designing specific primers containing enzyme cleavage sites, linear DNA was amplified and self-ligated to form biotin-labeled circular DNA. High-purity circular DNA was obtained using enzyme digestion and magnetic bead purification techniques, and intracellular protein interactions were captured using the streptavidin system.

Benefits of technology

It enables stable delivery and maintenance of the integrity of circular DNA structures within cells, efficiently enriches and identifies interacting proteins, and provides a method that truly reflects the interaction between circular DNA and proteins under physiological conditions, with broad applications in functional genomics and disease mechanism research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104678A_ABST
    Figure CN122104678A_ABST
Patent Text Reader

Abstract

The application provides a biotin-labeled exogenous circular DNA and a construction method and application in protein interaction thereof, and belongs to the technical field of gene interaction. The application provides a construction method of the biotin-labeled exogenous circular DNA, wherein a target sequence is amplified by using a biotin-labeled primer to obtain linear DNA containing a preset restriction enzyme cutting site; the obtained linear DNA is subjected to single enzyme cutting treatment by using a corresponding restriction endonuclease; and the DNA after enzyme cutting is subjected to a self-ligation reaction to generate closed circular DNA. The preparation process of the biotin-labeled circular DNA is stable and controllable, and has high repeatability; the biotin labeling of the circular DNA can be combined with a streptavidin system to realize high-affinity and specific enrichment of a DNA-protein complex; and the circular DNA can be stably delivered in cells and maintain the structural integrity of the circular DNA, thereby providing an effective means for truly reflecting the interaction between the circular DNA and the protein in a physiological environment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene interaction technology, specifically relating to a biotin-labeled exogenous circular DNA, its construction method, and its application in protein interaction. Background Technology

[0002] Extrachromosomal circular DNA (eccDNA) is a class of closed circular DNA molecules widely found in eukaryotic cells. Recent studies have shown that eccDNA plays a crucial role in chromatin structure maintenance, gene expression regulation, cell plasticity, and tumorigenesis. eccDNA can not only serve as a template for transcript production but can also be recognized and bound by specific chromatin regulatory proteins or transcription factors, thereby exerting multi-level regulatory functions within the cell. Therefore, systematically identifying proteins that bind to specific eccDNA molecules is a core scientific question in understanding the biological functions of eccDNA.

[0003] However, current research on eccDNA-protein interactions still faces significant technical bottlenecks. First, natural eccDNA sequences are diverse in origin, low in abundance, and highly heterogeneous, making it difficult to isolate specific eccDNA molecules with well-defined structures and unique sequences. Therefore, it is challenging to establish a correspondence between specific sequences or structures and their binding proteins. Second, existing methods for studying DNA-protein interactions (such as EMSA and DNA pull-down) primarily rely on linear DNA probes, which cannot simulate the closed circular topology of eccDNA. This structure is considered closely related to its protein-binding properties, making it difficult for linear DNA-based methods to accurately reflect the natural protein-binding state of eccDNA within cells. Furthermore, although techniques exist for preparing circular DNA in vitro, it is generally difficult to introduce markers suitable for subsequent specific separation (such as biotin) during the construction process, and a circular DNA probe system suitable for intracellular analysis has not yet been established.

[0004] Therefore, there is currently a lack of technical means to directly investigate which proteins bind to specific circular DNA in the cellular environment. Due to the lack of effective in vivo research methods, the interaction network and regulatory mechanisms between eccDNA and proteins have been difficult to systematically elucidate. In particular, there is a lack of a technology that can integrate the following key steps in a single process: constructing circular DNA with separable tags, delivering it into cells, maintaining its circular structure stably within the cell, and finally specifically isolating and identifying the proteins that bind to the circular DNA.

[0005] In summary, the key bottleneck in current research on eccDNA-protein interactions lies in the lack of an effective method for capturing the actual binding proteins within cells. To fill this technological gap, there is an urgent need to establish a complete methodology capable of constructing biotin-labeled circular DNA, delivering it into cells, and specifically enriching and identifying its interacting proteins. Summary of the Invention

[0006] This invention provides a biotin-labeled exogenous circular DNA, its construction method, and its application in protein interactions. It can stably construct biotin-labeled circular DNA and deliver it into cells to specifically enrich and identify its interacting proteins.

[0007] This invention provides a method for constructing biotin-labeled exogenous circular DNA, comprising the following steps: using target DNA as a template, designing specific primers, wherein the upstream primer of the specific primers is a biotin-labeled primer, and both the upstream and downstream primers of the specific primers contain the same restriction enzyme site; Linearized target DNA containing the enzyme cleavage site is amplified using the specific primers. The linearized target DNA is then digested with an enzyme corresponding to the enzyme cleavage site. The digested fragments are then self-ligated to obtain biotin-labeled exogenous circular DNA.

[0008] In one specific embodiment of the present invention, the restriction enzyme site is different from the restriction enzyme site contained in the target DNA sequence.

[0009] In one specific embodiment of the present invention, the biotin-labeled primer is labeled on the first T near the 5' end.

[0010] In one specific embodiment of the present invention, after the self-ligation, the process further includes selective degradation of linear DNA and enrichment of circular DNA.

[0011] In one specific embodiment of the present invention, the enzyme used for the selective degradation of linearized DNA includes an ATP-dependent double-stranded linear DNA exonuclease.

[0012] In one specific embodiment of the present invention, the method for enriching circular DNA includes magnetic bead or column purification methods.

[0013] The present invention also provides biotin-labeled exogenous circular DNA constructed using the above-described construction method.

[0014] The present invention also provides the application of the above-mentioned biotin-labeled exogenous circular DNA in screening proteins that interact with target DNA.

[0015] In one specific embodiment of the present invention, the protein that interacts with the target DNA is located inside the cell.

[0016] The present invention also provides a method for identifying intracellular proteins that interact with target DNA, comprising the following steps: transfecting cells with the above-mentioned biotin-labeled exogenous circular DNA, fixing and terminating the cross-linking reaction of transfected positive cells, collecting the cell lysate, and obtaining the lysate; Streptavidin magnetic beads were used to bind to and capture endogenous proteins in the lysate that interact with the biotin-labeled exogenous circular DNA.

[0017] Beneficial Effects: This invention provides a method for constructing biotin-labeled exogenous circular DNA. The method involves amplifying the target sequence using biotin-labeled primers to obtain linear DNA containing pre-defined restriction enzyme sites. The obtained linear DNA is then digested with corresponding restriction endonucleases, followed by a self-ligation reaction to generate closed circular DNA. The biotin-labeled circular DNA prepared by this invention has well-defined ligation sites and a closed circular structure. The preparation process is stable, controllable, and highly reproducible. Furthermore, the biotin labeling of the circular DNA can efficiently bind to the streptavidin system, achieving high affinity and specific enrichment of DNA-protein complexes. The method described in this invention can stably deliver and maintain the structural integrity of the circular DNA within cells, providing an effective means to realistically reflect the interaction between circular DNA and proteins under physiological conditions. The complete system established by this invention, from preparation, verification, delivery to protein capture, fills the current technological gap in eccDNA-protein interaction research, which lacks structurally controllable, labeling-stable, and intracellularly detectable technologies. It has broad application value in functional genomics and disease mechanism research. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the Biotin-ecc DNA synthesis and transfection process; Figure 2 Image showing the enrichment effect of eccDNA; Figure 3 This is a diagram showing the transfection results; Figure 4 Image showing the results of circular enrichment identification in DNA; Figure 5 Figure showing the results of enrichment and identification of circular DNA transcripts in RNA; Figure 6 The graph shows the results of functional analysis of 61 biotin-eccDNA interacting nucleoproteins identified by mass spectrometry. Figure 7 This is a graph showing the results of histones interacting with biotin-eccDNA identified by mass spectrometry. Detailed Implementation

[0019] This invention provides a method for constructing biotin-labeled exogenous circular DNA, comprising the following steps: using target DNA as a template, designing specific primers, wherein the upstream primer of the specific primers is a biotin-labeled primer, and both the upstream and downstream primers of the specific primers contain the same restriction enzyme site; Linearized target DNA containing the enzyme cleavage site is amplified using the specific primers. The linearized target DNA is then digested with an enzyme corresponding to the enzyme cleavage site. The digested fragments are then self-ligated to obtain biotin-labeled exogenous circular DNA.

[0020] The target DNA described in this invention can be any DNA in the art. For example, in the embodiments, three eccDNAs were constructed, and commonly used restriction endonuclease cleavage sites not present in the sequence were selected. One of these restriction endonuclease sequences was added to each end of the upstream and downstream primers, and a biotin label was added to the first T near the 5' end. In one embodiment of this invention, the selected restriction endonuclease was HindIII.

[0021] In this embodiment of the invention, the three constructed eccDNA sequences are shown below: The nucleotide sequence of Biotin-eccDNA-1 is shown in SEQ ID No. 1: CCC AAGCTT AAGCTT GGG; The nucleotide sequence of Biotin-eccDNA-2 is shown in SEQ ID No.2: CCC AAGCTT caactctactcccagatgtgcaataatttctctggccaccaggaggcatcacagctatcttcatctttgtcgttcttttttaatgaacagaagtgtattctacagagtaatgaatgttatgaaaatatttattataataacaattctgtttggaaaattcacatgcatattaaaaacagtcctatttgctgttcaccccaaatctacatcgaattcattgatttatctcttccctcctcggtgtagattgaggtgtccacactgtagaggggtgccttccagagagctgggtgttcaccctccgttaccctaccgttgtacaggcttctcaaacctctcactccctctcactcatcccctctccaggacattatggacgcagctgcccaggacccacttaggcacgcccatactctctcagtcaccttctgcctgccttgcactattaatgctaatgattgccaacgtgtgctagagctgtctggtgtttcattgttgatgccatacatatatacagacttattttacacctatcatcaggtttttttctgacagaattagaattactctgtaatctagattcataagctaagttttaagggaggtattttattttttgctccttgcagacccttcttgatagagttcgataatggtggtaccgtggtgccctctcgtgacagaaggctgaactacagctagaacatcgcgagc AAGCTT GGG; The nucleotide sequence of Biotin-eccDNA-3 is shown in SEQ ID No.3: CCC AAGCTTctccctggagaaacaggtatgatggggagggccctgcacagccctggggttgattgcacagcccataagagagaaaaagcccaaacacgtgaacataagaggtcaagttagaagaacctagagagataacctggcttccagagacccagatatatcacatccatccatccatccatccatccatccatccatccatcatcccatccacctgctcagaagtggtcccagcctatggagggagggcctcatcaatccctggccataacccaagggtggctcaagccccagggaaaagtggccgaggagagcagaacaagttctggcctaaaagtcaagacccctggttcctctttttggctcgccattagctaactacatgaaccagatcatttggcttgactttctggacctcagtctccccacctgtaaaatggggacagttggaccaggaggtggatggggatttccagttctaacattctgtagctgagcctctggcctctgacgtcacaatatggagctggcctcacccagctctgctgctctgttggtcatgggagcaaggtggacttgccctggaccttccctacttgtgctcctctgttatgggcagctcttgccttggctcaggatcaagggtgaacacagtttaggtgtggctgggaccccaagaagcatgggaccagacaaagggactgggtgcggacaggaccttctcag AAGCTT GGG。

[0022] The specific primers designed in the embodiments of the present invention are as follows: Biotin-eccDNA-1-eccSyn-F (SEQ ID No.4): CCCAAGC / iBiodT / TAAGAAGCATGAAGACTAGTTTC; Biotin-eccDNA-1-eccSyn-R (SEQ ID No.5): CCCAAGCTTATCAGAACTTCTGGGAGACAAC; Biotin-eccDNA-2-eccSyn-F (SEQ ID No. 6): CCCAAGC / iBiodT / TCAACTCTACTCCCAGATGTGCA; Biotin-eccDNA-2-eccSyn-R (SEQ ID No. 7): CCCAAGCTTGCTCGCGATGTTCTAGCTGTAG; Biotin-eccDNA-3-eccSyn-F (SEQ ID No. 8): CCCAAGC / iBiodT / TCTCCCTGGAGAAACAGGTATG; Biotin-eccDNA-3-eccSyn-R (SEQ ID No. 9): CCCAAGCTTCTGAGAAGGTCCTGTCCGCA.

[0023] In this invention, the amplification system, in 50 μL increments, comprises: no more than 100 ng of template DNA, 0.5 μM of biotinylated forward and reverse primers, 200 μM of dNTPs, and high-fidelity DNA polymerase and its accompanying buffer. The template DNA in this invention can be genomic DNA, plasmid, viral DNA, or cDNA.

[0024] The amplification procedure described in this invention includes: pre-denaturation at 95°C for 3 minutes; followed by 35 cycles of amplification, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30-45 seconds (the extension time is adjusted according to the fragment length); and a final extension at 72°C for 5 minutes. After amplification, the PCR product is detected by 1% agarose gel electrophoresis, the target band is excised, and DNA is purified and recovered to obtain a high-purity linear PCR product.

[0025] This invention utilizes an endonuclease with the same restriction site for digestion. In the examples, HindIII is used to perform single digestion of the linear PCR product, generating sticky ends at both ends of the DNA that can be used for subsequent ligation. Then, self-ligation is performed. The self-ligation is carried out under the conditions of DNA ligase, so that the two ends of the DNA self-join through the sticky ends to form a closed circular structure. After the reaction, the DNA is purified to obtain a preliminarily circularized DNA product.

[0026] Following the self-ligation, this invention further includes selective degradation of linear DNA and enrichment of circular DNA. The enzymes used for the selective degradation of linear DNA include ATP-dependent double-stranded linear DNA exonucleases, which selectively degrade the linear DNA. The DNA is then recovered using magnetic bead or column purification methods to ultimately obtain high-purity biotin-labeled circular DNA.

[0027] The present invention also provides biotin-labeled exogenous circular DNA constructed using the above-described construction method.

[0028] In this embodiment of the invention, specific primers spanning the circularization junction were used to verify the circular structure of the aforementioned DNA. The results showed that the method described in this invention can stably prepare biotin-labeled circular DNA with various different sequences. Through cell transfection and expression detection of the circular DNA, the results showed that the constructed circular DNA can be recognized by transcriptional mechanisms as a template within cells, exhibiting transcriptional activity.

[0029] The present invention also provides the application of the above-mentioned biotin-labeled exogenous circular DNA in screening proteins that interact with target DNA.

[0030] The protein that interacts with the target DNA described in this invention is located inside the cell.

[0031] The present invention also provides a method for identifying intracellular proteins that interact with target DNA, comprising the following steps: transfecting cells with the above-mentioned biotin-labeled exogenous circular DNA, fixing and terminating the cross-linking reaction of transfected positive cells, collecting the cell lysate, and obtaining the lysate; Streptavidin magnetic beads were used to bind to and capture endogenous proteins in the lysate that interact with the biotin-labeled exogenous circular DNA.

[0032] In this embodiment of the invention, protein pull-down of biotin-labeled circular DNA and identification of interacting proteins are performed. Specifically, cells transfected with biotin-labeled circular DNA are fixed with 1% formaldehyde at room temperature for 10 minutes, followed by the addition of glycine to terminate the cross-linking reaction. After cell collection, cell lysis buffer is added, and the cells are incubated on ice and sonicated to release the nuclear DNA-protein complex. The detergent concentration in the lysis buffer is adjusted to a suitable range for the binding reaction, streptavidin magnetic beads are added, and the cells are gently rotated and incubated at 4°C for 1-2 hours to allow the magnetic beads to specifically bind to the biotin-labeled circular DNA, thereby capturing endogenous proteins interacting with the circular DNA. After incubation, the magnetic beads are washed multiple times with PBST buffer containing a nonionic surfactant to remove non-specifically bound proteins. The washed magnetic beads can be used to recover bound proteins through a protein elution system, and further SDS-PAGE electrophoresis or mass spectrometry analysis can be performed to systematically identify the intracellular protein components bound to the circular DNA.

[0033] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides a biotin-labeled exogenous circular DNA, its construction method, and its application in protein interactions. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0034] Unless otherwise specified, the materials used in the embodiments of this invention are all derived from conventional commercially available products, wherein: 2×Taq Plus Master Mix II (Dye Plus) (Vazyme, #P213); FastPure Gel DNA Extraction Mini Kit (Vazyme, #DC301); T4 DNA ligase (Vazyme, #C301); Plasmid-Safe™ ATP-Dependent DNase (Epicentre, #E3101K); VAHTS DNA Clean Beads (Vazyme, #N411); Taq Pro Universal SYBR qPCR Master Mix (Vazyme, #Q712-03); Polyethylenimine Linear (PEI) MW40000 (rapid lysis) linear PEI transfection reagent (fast dissolving type) MW40000 (Yeasen, #40816ES02); Opti-MEM™ serum-reduced medium (Thermo, #31985070); CCK-8 Cell Counting Kit (GLPBIO, #GK10001); DNA / RNA co-extraction kit (TIANGEN, #DP422); HiScript III All-in-oneRT SuperMix Perfect for qPCR (Vazyme, #R333).

[0035] Example 1 1. Design primers Based on sequencing data, three eccDNAs were selected: Biotin-eccDNA-1 (SEQ ID No. 1), Biotin-eccDNA-2 (SEQ ID No. 2), and Biotin-eccDNA (SEQ ID No. 3). HindIII restriction endonuclease cleavage sites were selected, and one of these cleavage site sequences was added to each end of the upstream and downstream primers. At the same time, a biotin label was added to the first T near the 5' end, and specific primer pairs as shown in SEQ ID No. 4 to SEQ ID No. 9 were designed.

[0036] Meanwhile, qPCR primers that cross the breakpoints of eccDNA ligation were designed to identify the enrichment level of eccDNA. The primer sequences are shown in Table 1.

[0037] Table 1 Primers for qPCR identification of eccDNA enrichment level

[0038] according to Figure 1 The process involves Biotin-eccDNA synthesis and transfection. 2. Linear DNA amplification: The target fragment was amplified using 2×KeyPo Master Mix (Dye Plus) (Vazyme, #PK511).

[0039] The target fragment was extracted and recovered using a vazyme DC301 gel, followed by elution with 50 μL of Elution Buffer. If the amount of DNA obtained the first time was insufficient, the DNA from the first product could be used as a template for amplification again.

[0040] 3. Linear DNA single enzyme digestion: The recovered DNA is digested with HindIII, 2 μg per reaction. Multiple reactions can be performed on each original DNA. A backup of the linear DNA is required for transfection control.

[0041] HindIII digestion system (50 μl, 2 μg): 2 μg linear DNA, 5 μl 10×Buffer r2.1, 3 μl HindIII, and the remainder ddH2O. Note: 1 μg DNA is digested with 1 μl (10 U) of the enzyme.

[0042] Enzyme digestion at 37℃ for 2 h; enzyme inactivation at 80℃ for 20 min.

[0043] The enzyme digestion product was recovered using a vazyme DC301 and eluted with 45 μl of Elution Buffer.

[0044] 4. Self-ligation of single-enzyme-digested DNA fragments into circular forms: Single-enzyme-digested fragments were ligated into circular forms using T4 DNA ligase (Vazyme, #C301) (50 μl system): 10×Buffer 5 μl, digestion product 40 μl, and T4 ligase 5 μl. Incubate overnight at 16°C, then inactivate at 65°C for 10 min.

[0045] The ligation product was purified using a DC301 elution buffer followed by elution with 32 μl of Elution Buffer.

[0046] 5. Linear DNA Digestion: The ligation product was linearly digested using Plasmid-safe DNase (40 μl system): 31 μl ligation DNA, 1.6 μl 25 mM ATP (final concentration 1 mM), 4 μl 10× Reaction Buffer, 1 μl Plasmid-safe DNase (10 U / μl), and 1.4 μl ddH2O. Digestion was performed at 37℃ for 16 h; 70℃ for 30 min; and 4℃ for forever.

[0047] 6. The product digested with Plasmid-safe DNase was purified using 2× DNA clean Beads (Vazyme, #N411) and eluted with 16 μl TE.

[0048] 7. Use qPCR primers (Table 1) that cross the breakpoint of circular DNA to enrich and detect the circular DNA synthesized in vitro, with gDNA as a control. The template for each reaction is 1 ng (1 ng / 2 μl), and each sample is repeated in two replicates.

[0049] 10μl system: 2×SYBR (Vazyme, #Q712-03) 5μl, F primer 0.2μl, R primer 0.2μl, DNA 2μl and ddH2O 2.6μl. The result is as follows Figure 2 As shown, in the genomic DNA (gDNA) control, the Ct values ​​amplified by specific qPCR primers designed for the eccDNA ligation sequence were high, generally between 27 and 32, indicating that the content of the target ligation sequence was extremely low against a normal genomic background. However, in the biotin-labeled eccDNA-enriched samples, the Ct values ​​of the same primer pair significantly decreased to between 10 and 14, a decrease exceeding 15 cycles, meaning that the template amount of the target sequence increased by tens of thousands of times. This result indicates that the target eccDNA ligation sequence exists in large quantities and specifically in biotin-eccDNA samples, confirming the successful in vitro synthesis of eccDNA.

[0050] Example 2 Example 1 describes the transfection experiment of synthesized eccDNA using the method described in Example 1. The transfection method was PEI transfection (YEASEN, #40816ES02).

[0051] 1. Seed cells in 6-well plates one day before transfection. The cells should be seeded when they reach 70%-80% confluence, approximately 8 × 10⁸ cells per well. 5 Prepare three 6-well plates for transfection with cells (depending on cell size).

[0052] 2. Mix the three externally synthesized eccDNAs in equal molar proportions, with a total eccDNA amount of 200 ng; at the same time, prepare 3 wells of cells for transfection with H2O control and GFP positive control.

[0053] 3. Prepare the DNA-PEI complex Prepare the DNA-PEI nucleic acid-transfection reagent complex according to the following system: 1) For each well of cells, dilute 200 ng of eccDNA with 100 μL of serum-free medium and mix thoroughly to prepare a DNA dilution buffer. Opti-MEM or ddH2O is recommended as the serum-free dilution buffer. 2) Immediately add 4 μL of PEI 40000 transfection reagent to 100 μL of DNA dilution buffer and mix gently.

[0054] 3) Incubate at room temperature for 15 min to form the DNA-PEI cationic nucleic acid transfection reagent complex.

[0055] 4. Transfecting cells 1) During the formation of the complex, remove the cell growth medium and add 2 ml of fresh, preheated complete medium to each well.

[0056] 2) Add 100 μL of DNA-PEI nucleic acid-PEI complex directly to the cells, shake the culture plate, and mix gently.

[0057] 3) Incubate at 37℃ in a 5% CO2 incubator for 24 hours.

[0058] The results are as follows Figure 3 As shown, GFP transfection was successful, indicating that the transfection operation was successful.

[0059] 5. Identification of cross-linked and transfected cells 1) Collect and count all cells transfected with eccDNA mixer and H2O, respectively. Take about 200,000 eccDNA-transfected cells or H2O-transfected cells for DNA / RNA co-extraction and enrichment and identification of eccDNA in DNA and RNA. Perform single cross-linking with 1% FA (add FA to a final concentration of 1%, rotate at room temperature for 20 min for single cross-linking; then add glycine to a final concentration of 0.2 M to terminate the cross-linking reaction, rotate at room temperature for 5 min; centrifuge at 2000 g at room temperature for 5 min to collect cells, discard the supernatant, resuspend cells in PBS pre-chilled for 10 min, count; centrifuge at 2000 g at 4℃ for 5 min to collect cells, resuspend cells in a certain volume of pre-chilled PBS, aliquot cells into approximately 3 M / tube, and freeze at -80℃ for later use).

[0060] The enrichment of circular DNA and cDNA breakpoints in DNA was detected using an RNA / DNA co-extraction kit (TIANGEN, #DP422) and qPCR primers that cross circular DNA breakpoints. EIF4A2 was used as an internal reference gene, and H2O cells were transfected as a control.

[0061] Results of DNA circular enrichment identification as follows Figure 4 As shown, compared to the transfection control, the eccDNA enrichment in the biotin-eccDNA transfected samples was 5173 (eccDNA-1), 1518 (eccDNA-2), and 160 (eccDNA-3) times, respectively. Simultaneously, this invention also detected the transcription of biotin-eccDNA, and the enrichment identification results of the transcribed RNA are shown below. Figure 5 As shown, compared with the control, the enrichment folds of biotin-eccDNA transcripts were 146 (eccDNA-1), 18.5 (eccDNA-2), and 2.2 (eccDNA-3), respectively.

[0062] 2) Biotin pull-down Single-crosslinked cells were lysed on ice for 15 min using 500 μl of lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 1% SDS, 1% NP-40, 1 mM PMSF, 1 mM DTT, 1×Cocktail (proteinase inhibitor), and 0.4% sodium deoxycholate). The lysates were sonicated for 3 min (3 s ON / 3 s OFF) to disrupt the cells. The sonicated cells were then centrifuged at 16,000 g at 10°C for 4°C. The supernatant was collected, and the SDS in the sample was diluted to 0.2% using 1×lysis buffer (SDS-free). Dynabeads™ M-280 streptavidin (Invitrogen, #11205D) was washed twice with 1 ml 1×lysis buffer (0.2% SDS), and then 50 μl beads were added to each sample and incubated at 4°C for 4 hours by rotation. Subsequently, the beads were washed twice with 1 ml PBST and sent to the company for mass spectrometry identification. Mass spectrometry identification revealed that biotin-eccDNA-1 captured 61 nuclear localization proteins. Functional enrichment analysis of these proteins (performed via https: / / bioinformatics.sdstate.edu / go / ) yielded the following results: Figure 6As shown, the significantly enriched pathways mainly involve chromatin assembly and nucleosome formation, suggesting that biotin-eccDNA may participate in the chromatin assembly process after entering the cell. Further analysis revealed that these 61 nuclear proteins contain a large number of histones related to chromatin assembly. Figure 7 Examples include family members such as H2A, H2B, and H3, which constitute the nucleosome core octamer, as well as the linker histone H1. This result supports, at the protein-protein interaction level, that biotin-eccDNA may interact with chromatin assembly mechanisms within the cell.

[0063] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing biotin-labeled exogenous circular DNA, characterized in that, Includes the following steps: Using the target DNA as a template, specific primers are designed. The upstream primer of the specific primer is a biotin-labeled primer, and both the upstream and downstream primers of the specific primer contain the same restriction enzyme site. Linearized target DNA containing the enzyme cleavage site is amplified using the specific primers. The linearized target DNA is then digested with an enzyme corresponding to the enzyme cleavage site. The digested fragments are then self-ligated to obtain biotin-labeled exogenous circular DNA.

2. The construction method according to claim 1, characterized in that, The restriction enzyme sites are different from those contained in the target DNA sequence.

3. The construction method according to claim 1, characterized in that, The biotin-labeled primer is labeled on the first T near the 5' end.

4. The construction method according to claim 1, characterized in that, Following the self-ligation, the process also includes selective degradation of linear DNA and enrichment of circular DNA.

5. The construction method according to claim 4, characterized in that, The enzymes used for the selective degradation of linearized DNA include ATP-dependent double-stranded linear DNA exonucleases.

6. The construction method according to claim 4, characterized in that, The methods for enriching circular DNA include magnetic bead or column purification methods.

7. Biotin-labeled exogenous circular DNA constructed using the construction method according to any one of claims 1 to 6.

8. The use of the biotin-labeled exogenous circular DNA of claim 7 in screening proteins that interact with target DNA.

9. The application according to claim 8, characterized in that, The protein that interacts with the target DNA is located inside the cell.

10. A method for identifying intracellular proteins that interact with target DNA, characterized in that, The process includes the following steps: transfecting cells with the biotin-labeled exogenous circular DNA as described in claim 7, fixing and terminating the cross-linking reaction of the transfected positive cells, collecting the cell lysate, and obtaining the lysate. Streptavidin magnetic beads were used to bind to and capture endogenous proteins in the lysate that interact with the biotin-labeled exogenous circular DNA.