Abc110 gene and application thereof in increasing production of natural rubber of rubber grass
By overexpressing the ABC110 gene in rubber grass, the diameter of the taproot and root biomass are increased, and the natural rubber content is improved, thus solving the problem of low natural rubber yield in rubber grass and promoting its genetic improvement and industrialization.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-29
AI Technical Summary
The low yield of natural rubber in rubber grass limits its industrial development, and research on ABCG transporters in rubber grass is limited, affecting its genetic improvement.
The ABC110 gene in rubber grass was isolated and overexpressed. By introducing the overexpression vector into rubber grass, the content or activity of ABC110 protein was increased, the taproot diameter and root biomass of rubber grass were increased, and the natural rubber content was increased.
Significantly increasing the taproot diameter and dry root weight of rubber grass, and improving the natural rubber content and yield in the roots, provides a new target for the genetic improvement of rubber grass and promotes its industrial development.
Smart Images
Figure CN122104729A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the ABC110 gene and its application in increasing the yield of natural rubber from rubber grass. Background Technology
[0002] Natural rubber (NR), whose main component is cis-1,4-polyisoprene, is an important strategic resource, ranking alongside coal, oil, and steel as one of the four major industrial raw materials. While approximately 2,500 plant species can synthesize natural rubber, commercial production still relies heavily on the Brazilian rubber tree (Hevea brasiliensis Muell. Arg.). Due to the rubber tree's rigid requirements for tropical climate, labor, and land, as well as biological stresses such as South American leaf blight, the global natural rubber supply chain is chronically exposed to risks, necessitating the development of more rubber crops.
[0003] Taraxacum kok-saghyz (TKS), a perennial herbaceous plant belonging to the genus Taraxacum in the family Asteraceae, produces natural rubber from its roots. The physicochemical properties of this natural rubber are similar to those of rubber trees, suggesting its potential as a substitute for rubber tree production. However, it currently exists in a wild or semi-wild state, with low rubber content and small root biomass, hindering its industrial development. Identifying key genes regulating root development could provide targets for breeding high-yielding rubber germplasm and accelerate the domestication of Taraxacum kok-saghyz.
[0004] ATP-binding cassette (ABC) proteins are a family of membrane transport proteins widely found in various organisms. Based on phylogenetic analysis, the similarity of nucleotide-binding domain sequences, and the organization of domains, they can be divided into eight subfamilies: ABCA-ABCG and ABCI. Plants possess a greater number of ABCG transport proteins than other eukaryotes, which play important biological functions, including resisting biotic and abiotic stresses, maintaining cellular osmotic homeostasis, controlling nutrient uptake, and signal transduction (Sun, J.T., Jing, X.J., Zhao, D.N., et al. 2024. Research progress on the function of plant ABCG transport proteins. Science Bulletin 69, 1866–1880). Research on ABCG transport proteins in rubber grass is very limited, which greatly restricts their application in rubber grass domestication and genetic improvement. Summary of the Invention
[0005] The inventors of this application isolated a natural rubber yield control gene from rubber grass, named ABC110 (ATP-binding cassette transporter G 110). The genomic sequence of the ABC110 gene is shown in SEQ ID NO:1, and the coding sequence (CDS) is shown in SEQ ID NO:2. This gene encodes the ABC110 protein with the amino acid sequence shown in SEQ ID NO:3. Experiments have shown that overexpression of the ABC110 gene in rubber grass can significantly increase the diameter of the taproot (…). Figure 5 A) Increase the dry root weight of each rubber plant ( Figure 5 B) and increase the natural rubber content in the roots of rubber grass ( Figure 6 ).
[0006] Based on the above research results, the present invention provides a nucleic acid molecule, the nucleotide sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:2.
[0007] Expression cassettes, vectors, or host bacteria containing the aforementioned nucleic acid molecules are also within the scope of this invention.
[0008] The expression cassette consists of a promoter capable of initiating the expression of the nucleic acid molecule, the nucleic acid molecule, and a transcription terminator.
[0009] The vector can be a cloning vector, containing the aforementioned nucleic acid molecules and other elements required for plasmid replication. The vector can also be an expression vector, containing the aforementioned nucleic acid molecules and other elements enabling successful protein expression. The expression vector can be any suitable plant expression vector, such as the pFGC5941 vector.
[0010] The host bacterium can be a host bacterium containing the above-mentioned cloning vector, such as E. coli DH5α. The nucleic acid molecules are replicated by culturing the host bacterium under appropriate conditions. Alternatively, the host bacterium can be a host bacterium containing the above-mentioned expression vector, such as Agrobacterium tumefaciens AGL1. The expression vector is transferred into rubber grass recipient material using Agrobacterium tumefaciens-mediated genetic transformation technology to obtain transgenic rubber grass plants.
[0011] The application of the nucleic acid molecules in cultivating rubber grass plants with increased root biomass and natural rubber content also falls within the scope of this invention.
[0012] The application of the nucleic acid molecules in the production of natural rubber also falls within the scope of this invention.
[0013] The present invention also provides a method for increasing the root biomass and natural rubber content of rubber grass, which includes increasing the content or activity of ABC110 protein in rubber grass; the amino acid sequence of said ABC110 protein is shown in SEQ ID NO:3.
[0014] In the above method, the content or activity of ABC110 protein in rubber grass can be increased by overexpressing the nucleic acid molecule in rubber grass.
[0015] The present invention also provides a method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: introducing an overexpression vector for overexpressing the nucleic acid molecule into rubber grass recipient material, and culturing to obtain transgenic rubber grass plants with increased root biomass and natural rubber content.
[0016] In the above method, the overexpression vector can be introduced into the rubber grass receptor material via Agrobacterium-mediated transformation.
[0017] The rubber grass recipient material can be any suitable rubber grass (Taraxacum kok-saghyz Rodin, TKS) variety or strain, such as rubber grass genome sequencing strain 1151.
[0018] Transgenic rubber grass plants with increased root biomass and natural rubber content obtained by the method also fall within the scope of this invention.
[0019] The present invention also provides a method for producing natural rubber, comprising: cultivating transgenic rubber grass plants with increased root biomass and natural rubber content and extracting natural rubber from the roots.
[0020] The present invention also provides a protein having the amino acid sequence shown in SEQ ID NO:3.
[0021] This invention provides new gene targets and methods for the genetic improvement of rubber grass, and has broad application prospects in the breeding of new high-yield rubber grass varieties. Attached Figure Description
[0022] Figure 1 : Schematic diagram of the structure of the ABC110 gene.
[0023] Figure 2 Diagram of conserved structural regions of the ABC110 protein.
[0024] Figure 3 A heatmap of normalized RPKM values shows the relative expression levels of the ABC110 gene in 12 tissues of rubber grass.
[0025] Figure 4Figure A shows the transcriptional level of the ABC110 gene in wild-type (WT) and ABC110 overexpressing line (35S::ABC110) of rubber grass, as detected by qRT-PCR. The vertical axis represents the relative expression level of the ABC110 gene, and the values are mean ± SD (n = 3). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), **P < 0.01, ***P < 0.001; Figure B shows the phenotype of wild-type (WT) and ABC110 overexpressing line (35S::ABC110) of rubber grass after 3 months of growth. The scale bar is 5 cm long.
[0026] Figure 5 Statistical results of root phenotype of transgenic rubber grass overexpressing ABC110; A shows the taproot diameter of wild-type rubber grass (WT) and ABC110 overexpression line (35S::ABC110) after 3 months of growth. The values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t test. Compared with wild-type (WT), *P < 0.05, ***P < 0.001; B shows the dry root weight of each plant of wild-type rubber grass (WT) and ABC110 overexpression line (35S::ABC110) after 3 months of growth. The values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t test. Compared with wild-type (WT), *P < 0.05, **P < 0.01.
[0027] Figure 6 Analysis results of the relative content and yield of natural rubber in the roots of ABC110-overexpressing transgenic rubber grass: A shows the relative content of natural rubber in the roots of wild-type (WT) and ABC110-overexpressing lines (35S::ABC110) after 3 months of growth. The values in the figure are mean ± SD (n = 3). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), ***P < 0.001. B shows the natural rubber yield per plant of wild-type (WT) and ABC110-overexpressing lines (35S::ABC110) after 3 months of growth. The values in the figure are mean ± SD (n = 25). The significance analysis was performed using Student's t-test. Compared with wild-type (WT), ***P < 0.001. Detailed Implementation
[0028] The present invention will be described in detail below with reference to embodiments. The embodiments described below are for illustrative purposes only and do not limit the scope of the invention in any way. Unless otherwise specified, the reagents used in the following embodiments are conventional reagents in the art, commercially available or prepared according to conventional methods in the art. Unless otherwise specified, the methods used in the following embodiments are conventional methods in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0029] The rubber grass (Taraxacum kok-saghyz Rodin, TKS) strain 1151 used in the following examples is described in the article "Lin, T., Xu, X., Ruan, J., Liu, S., Wu, S., Shao, X., Wang, X., Gan, L., Qin, B., Yang, Y., et al. (2018). Genome analysis of Taraxacum kok-saghyz Rodin provides new insights into rubber biosynthesis. Natl Sci Rev 5, 78-87." This strain is preserved and propagated in our laboratory and is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is used solely for verifying the present invention.
[0030] The pFGC5941 vector used in the following examples is an Agrobacterium binary expression vector, described in the article "Lei, X.;Tan, B.; Liu, Z.; Wu, J.; Lv, J.; Gao, C. (2021). ThCOL2 Improves the SaltStress Tolerance of Tamarix hispida. Front Plant Sci 12, 653791." This vector is preserved in our laboratory and is publicly available from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It is used solely for verifying this invention.
[0031] The Escherichia coli DH5α and Agrobacterium tumefaciens AGL1 strains used in the following examples are commercially available strains.
[0032] The main reagents used in the following examples are: DNA polymerase KOD Plus (Toyobo, catalog number KOD-201); agarose gel extraction kit (Beijing Bomei Gene Technology Co., Ltd., catalog number DH101-01); In-Fusion Snap Assembly Master Mix (Takara, catalog number 638949); and the basic PCR enzyme TaKaRaTaq. TM The following products were purchased: Takara (product number R001A); Plasmid mini-rapid extraction kit (product number DP102-01, Beijing Bomed Gene Technology Co., Ltd.); MS medium (product number M0222.0050, Beijing Qiweiyicheng Technology Co., Ltd.); MES, 6-BA, NAA, and plant gel (product number Sigma-Aldrich); Sucrose (product number Sinopharm Chemical Reagent Co., Ltd.); RNA rapid extraction kit (product number 0416-50, Beijing Huayueyang Biotechnology Co., Ltd.); SuperScript® III First-Strand Synthesis System (product number 18080051, Invitrogen); SsoFast EvaGreen® Supermix (product number 1725201, Bio-Rad); Natural rubber standard (product number 431257-100G, Sigma-Aldrich); Narrow distribution polystyrene standard (NIM-RM2068, China National Institute of Metrology).
[0033] Example 1. Analysis of the ABC110 gene in rubber grass
[0034] Based on the rubber grass genome data, the ABC110 gene sequence of rubber grass was located and obtained using local bioinformatics tools such as BLAST. The genomic sequence of the ABC110 gene is shown in SEQ ID NO:1. Structural analysis of the ABC110 gene was performed, as follows... Figure 1 As shown, the ABC110 gene has 6 exons and 5 introns. The coding sequence of the ABC110 gene is shown in SEQ ID NO:2, and its encoded amino acid sequence is shown in SEQ ID NO:3 for the ABC110 protein.
[0035] The ABC110 protein was predicted to be an ABCG transporter (ATP-binding cassette transporter G). Analysis of conserved regions in the amino acid sequence of the ABC110 protein (SEQ ID NO:3) was performed, such as... Figure 2 As shown, the ABC110 protein contains an ATPase domain associated with a variety of cellular activities, as well as three transmembrane regions.
[0036] To understand the expression pattern of ABC110 in rubber grass in detail, we analyzed RNA-seq data from 12 tissues, including rubber grass flowers, latex, and mature leaves, which were previously measured by our research group. Figure 3 As shown, ABC110 is a broad-spectrum gene that is expressed in all tissues of rubber grass, with high expression in flowers, mature leaves, and seeds.
[0037] Example 2. Construction of a vector for overexpressing the ABC110 gene
[0038] Using root cDNA from wild-type plants of the rubber grass (Taraxacum kok-saghyz Rodin, TKS) 1151 as a template, PCR was performed using primers PF-ABC110-F / PF-ABC110-R and DNA polymerase KOD Plus (Toyobo, catalog number KOD-201) to amplify the full-length coding sequence of the ABC110 gene. The nucleotide sequences of the primers are as follows:
[0039] Upstream primer PF-ABC110-F:
[0040] 5'-CAATTACCATGGGGCGCGCC ATGGGGCCATCCGGAAGTG -3';
[0041] Downstream primer PF-ABC110-R:
[0042] 5'-CTAGACTCACCTAGGATCC TTAGTCCCCCATGAAATAAACAATTAGGAG -3'.
[0043] The PCR system consisted of: 10×KOD Plus Buffer, 5 μL; 2 mM dNTPs, 5 μL; 25 mM MgSO4, 2 μL; DNA polymerase KOD Plus (1.0 U / μL), 1 μL; PF-ABC110-F (10 μM), 0.75 μL; PF-ABC110-R (10 μM), 0.75 μL; cDNA, 2 μL; and ddH2O to a final volume of 50 μL. The PCR program was: 94℃ for 3 min; (98℃ for 10 s, 55℃ for 30 s, 68℃ for 2 min) for 30 cycles; and 68℃ for 10 min.
[0044] PCR products were detected by 1% agarose gel electrophoresis, and the ABC110 gene fragment was recovered from the gel using an agarose gel recovery kit (Beijing Bomei Gene Technology Co., Ltd., catalog number DH101-01) in accordance with the kit instructions.
[0045] The recovered ABC110 gene fragment was recombined into the pFGC5941 vector, which had been double-digested with restriction endonucleases BamHI and AscI, using a recombination reaction. The reaction mixture consisted of 150 ng of the ABC110 gene fragment, 150 ng of the double-digested pFGC5941 vector, 2 μL of 5× In-Fusion Snap Assembly Master Mix (Takara, catalog number 638949), and ddH2O to a final volume of 10 μL. The reaction was carried out at 50°C for 15 min to obtain the recombinant product.
[0046] The recombinant reaction product was transformed into *E. coli* DH5α competent cells using a heat shock method and plated onto LB agar plates containing 50 µg / mL kanamycin, incubated overnight at 37°C. Single colonies were picked from the LB agar plates and inoculated into 500 μL of LB liquid medium containing 50 µg / mL kanamycin, incubated at 37°C and 200 rpm for 3 h. Colony identification was performed using the forward primer qABC110-F for the ABC110 gene and the reverse primer PF-R for the pFGC5941 vector.
[0047] Forward primer qABC110-F: 5'-CCTAAGTTTGCTCGGAGGGAG-3';
[0048] Reverse primer PF-R: 5'-CGTGCACAACAGAATTGAAAGC-3'.
[0049] The PCR system consisted of: 10 μL of 2×GC Buffer; 2 μL of 2 mM dNTPs; 0.2 μL of DNA polymerase TaKaRa Taq (5 U / μL); 0.3 μL of qABC110-F (10 μM); 0.3 μL of PF-R (10 μM); 2 μL of bacterial culture; and ddH2O to a final volume of 20 μL. The PCR program was as follows: 94℃ for 3 min; 30 cycles of (94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min); and 72℃ for 10 min.
[0050] The size of the PCR products was checked by 1% agarose gel electrophoresis. The bacterial culture with correct PCR identification was sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. 200 μL of the correctly sequenced bacterial culture was inoculated into 10 mL of LB liquid medium containing 50 µg / mL kanamycin and incubated overnight at 37°C and 200 rpm. Plasmids were extracted using a rapid plasmid extraction kit (centrifuge column type, Beijing Bomed Gene Technology Co., Ltd., catalog number DP102-01) according to the kit instructions to obtain the ABC110 recombinant expression vector pFGC5941-ABC110.
[0051] Example 3. Obtaining ABC110 overexpression transgenic rubber grass
[0052] 1. Agrobacterium tumefaciens transformation
[0053] The recombinant expression vector pFGC5941-ABC110 obtained in Example 2 was transformed into Agrobacterium tumefaciens AGL1 via electroporation to obtain recombinant Agrobacterium AGL1-pFGC5941-ABC110. Single clones of AGL1-pFGC5941-ABC110 were picked and inoculated into an appropriate amount of YEP liquid medium (10 g / L peptone + 10 g / L yeast extract + 5 g / L NaCl, pH 7.0) containing 25 mg / L rifampin and 50 mg / L kanamycin, and cultured overnight at 28°C with shaking. The bacterial culture was then inoculated at a 1:100 volume ratio into YEP liquid medium containing 25 mg / L rifampin and 50 mg / L kanamycin, and acetylsuccinone was added to a final concentration of 100 μM, and cultured until OD... 600 = 0.6-0.8. Collect bacterial cells by centrifugation at room temperature, discard the supernatant, and fully resuspend the bacterial cells in an equal volume of infection solution containing 100 μM acetylsyleugenol (MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + glucose 10 g / L, pH 5.2) to obtain AGL1-pFGC5941-ABC110 infection solution.
[0054] 2. Genetic transformation of rubber grass
[0055] Genetic transformation was performed using the rubber grass genome sequencing strain 1151. Tissue culture seedlings of the healthy rubber grass strain 1151 were taken and cut into segments approximately 5 mm in length. These segments were then infected with the aforementioned AGL1-pFGC5941-ABC110 bacterial solution for approximately 20 minutes. The infected root segments were then transferred to sterile filter paper to absorb excess bacterial solution and air-dried. They were then co-cultured at 21-23℃ in the dark for 2-3 days. After co-culturing, the rubber grass root segments were transferred to a resistant callus induction medium (400 mg / L termethin + Basta 10 mg / L + MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + plant gel 3.6 g / L, pH 5.8) for selection culture until green resistant buds appeared. Then, they were transferred to a resistant seedling strengthening medium (400 mg / L termethin + Basta 10 mg / L + MS 2.2 g / L + MES 0.5 g / L + sucrose 10 g / L + plant gel 3.6 g / L, pH 5.8) for selection culture for 1-2 months at 21℃, with 16 h light / 8 h dark, and a light intensity of 80-120 μmol·m⁻¹. -2 ·s -1 Rooted resistant rubber grass seedlings were obtained, namely T0 generation ABC110 overexpression transgenic rubber grass (35S::ABC110).
[0056] 3. Identification of genetically modified rubber grass
[0057] The rooted, resistant rubber grass seedlings were transplanted into a greenhouse for cultivation. The cultivation substrate was a 1:1 (v / v) mixture of nutrient soil and vermiculite. The cultivation conditions were: temperature 21℃, long day (16 h light / 8 h dark), and light intensity 80-120 μmol·m⁻¹. -2 ·s -1 After three months of greenhouse cultivation, the roots were dug out of the soil, washed, and dried. A portion of the root tissue was then rapidly frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted from the roots of the T0 generation ABC110 overexpressing transgenic rubber grass (35S::ABC110) using a rapid RNA extraction kit (Beijing Huayueyang, Cat# 0416-50) according to the kit's instructions. The extracted total RNA was then reverse transcribed using the SuperScript® III First-Strand Synthesis System (Invitrogen, Cat#18080051) according to the kit's instructions to obtain root cDNA.
[0058] Using root cDNA from wild-type rubber grass and root cDNA from the T0 generation 35S::ABC110 transgenic rubber grass as templates, quantitative real-time PCR (qRT-PCR) was performed using PCR primers for the ABC110 gene and the internal control gene TkGAPDH (http: / / bigd.big.ac.cn / gwh / , accession number PRJCA000437, Gene ID: evm.model.utg9113.3). The qRT-PCR reaction system was prepared according to the product instructions using Bio-Rad's SsoFast EvaGreen® Supermix (Cat#1725201), and the reaction was performed using a Bio-Rad CFX96 real-time PCR instrument.
[0059] The primers used for qRT-PCR detection of ABC110 gene expression levels are:
[0060] Upstream primer qABC110-F: 5'-CCTAAGTTTGCTCGGAGGGAG-3';
[0061] Downstream primer qABC110-R: 5'-GATAAACGTAAAAGAGCCGCATATG-3'.
[0062] The primers used for qRT-PCR detection of TkGAPDH gene expression levels are:
[0063] Upstream primer qTkGAPDH-F: 5'-AGTTGGTTTCGTGGTATGAC-3';
[0064] Downstream primer qTkGAPDH-R: 5'-ACATGTCAGTGAACAGGTAGAC-3'.
[0065] The PCR reaction mixture consisted of: 2× SsoFast mix, 5 μL; cDNA, 2 μL; upstream primer (1 μM), 1.5 μL; and downstream primer (1 μM), 1.5 μL. The PCR program was as follows: 98℃, 30 s; (98℃, 5 s → 60℃, 5 s → data acquisition) 40 cycles; 60-95℃, 0.5℃ / 5 s, data acquisition / 5 s. After the program completed, the data were analyzed using BIO-RAD CFX Manager software.
[0066] The results showed that the relative expression level of the ABC110 gene was significantly higher in all lines of the T0 generation ABC110-overexpressing transgenic rubber grass (35S::ABC110) compared to the wild-type rubber grass (WT). Figure 4 A).
[0067] Example 4. Root phenotypic analysis of ABC110-overexpressing transgenic rubber grass
[0068] Clonal propagation of rubber grass was carried out through tissue culture. Leaves from vigorous wild-type rubber grass cultivars 1151 and the T0 generation ABC110 overexpressing transgenic rubber grass (35S::ABC110) obtained in Example 3 were taken. After disinfection with 12% (v / v) bleach, excess leaf edges were trimmed, and the leaves were placed in callus induction medium (MS 4.4 g / L + MES 0.5 g / L + 6-BA 0.5 mg / L + NAA 0.01 mg / L + sucrose 20 g / L + plant gel 3.6 g / L, pH 5.8). Once callus emerged from the wounds, the callus was inoculated into a new callus induction medium. After the callus grew, it was cut into small pieces, dried, and then inoculated into seedling growth medium (MS 2.2 g / L + MES 0.5 g / L + sucrose 10 g / L + plant gel 3.6 g / L, pH 5.8). Small buds will sprout from 5.8). After subculturing these buds 2-3 times, they will differentiate into seedlings. Once the aseptic seedlings have rooted, they will be transplanted to a greenhouse. The cultivation substrate is a 1:1 (v / v) mixture of nutrient soil and vermiculite. The greenhouse cultivation conditions are: temperature 21℃, long day (16 h light / 8 h dark), and light intensity 80-120 μmol·m⁻¹. -2 ·s -1 .
[0069] After transplanting tissue-cultured aseptic seedlings of wild-type and 35S::ABC110 transgenic rubber grass into a greenhouse for 3 months, the roots were dug up from the soil and washed. The entire plant was photographed, and the diameter of the taproot was measured using calipers. The entire root system was then placed in a 50℃ oven to constant weight, and the dry roots of each plant were weighed. Statistical analysis was performed on the taproot diameter and dry root weight. The results showed that the root morphology of the ABC110 overexpression lines (#1 and #2) was significantly larger than that of the wild-type rubber grass (WT). Figure 4 B). Compared with wild-type rubber grass (WT), the taproot diameter of the ABC110 overexpression lines (#1 and #2) was significantly increased. Figure 5 A), and the weight of the dry roots of each plant also increased significantly ( Figure 5 B).
[0070] Example 5. Extraction and yield analysis of natural rubber from the roots of ABC110-overexpressing transgenic rubber grass.
[0071] Tissue-cultured sterile seedlings of wild-type and 35S::ABC110 transgenic rubber grass were transplanted into a greenhouse and cultured for 3 months. The entire root system was then dug up from the soil, washed, and dried in a 50℃ oven until constant weight, yielding dried roots, which were then weighed. The dried roots were freeze-ground into powder. 100 mg of the dried root powder was placed in a 2.0 mL centrifuge tube, and the powder was completely suspended in 1 mL of toluene. The tube was then vortexed thoroughly for 1 min, extracted at 50℃ and 750 rpm for 2 h, and centrifuged at 10,000 rpm at room temperature for 10 min. The supernatant was collected to obtain a natural rubber solution.
[0072] The natural rubber content in the roots of wild-type and 35S::ABC110 transgenic rubber grass was determined using Fourier Transform Infrared Spectroscopy (FT-IR) as described in the paper “Rolere, S., Liengprayoon, S., Vaysse, L., Sainte-Beuve, J., and Bonfils, F. (2015). Investigating natural rubber composition with Fourier Transform Infrared (FT-IR) spectroscopy: a rapid and non-destructive method to determine both protein and lipid contents simultaneously. Polym. Test. 43, 83-93.”. Details are as follows:
[0073] Different concentrations (0.5, 1, 2, 4, 6, 8 mg / mL) of natural rubber standard (Sigma-Aldrich, Cat# 431257-100G) were prepared using toluene. 150 μL of each concentration of natural rubber standard solution was mixed with 15 μL of a 10 mg / mL narrow-distribution polystyrene standard (National Institute of Metrology, NIM-RM2068). 70 μL of the mixture was then pipetted evenly onto potassium bromide wafers pre-pressed using a tablet press and dried in an oven. The wafers were then scanned 32 times using a Fourier transform infrared spectrometer (BRUKER, TENSOR 27). After simple atmosphere compensation and baseline correction, the infrared spectra were calculated to be at 835 cm⁻¹. -1 (Natural rubber absorption peak) and 699 cm⁻¹ -1 The peak area ratio of the polystyrene absorption peak. A standard curve was obtained by plotting the peak area ratio and natural rubber concentration as coordinates: X = (Y - 0.0698) / 0.2596, R... 2= 0.9961, where X represents the concentration of natural rubber (mg / mL) and Y represents 835 cm⁻¹. -1 and 699 cm -1 The peak area ratio.
[0074] The extracted natural rubber solution was tested using the same method, and 835 cm⁻¹ was used. -1 and 699 cm -1 Substituting the peak area ratio into the standard curve above, the concentration of natural rubber was calculated. Then, the relative content of natural rubber in the roots of wild-type and 35S::ABC110 transgenic rubber grass was calculated. Relative content of natural rubber (%) = Natural rubber concentration (mg / mL) × Volume of toluene used to dissolve the rubber (mL) / Mass of dried root powder used for rubber extraction (mg) × 100%.
[0075] The results showed that the relative content of natural rubber in the roots of the ABC110 overexpression lines (#1 and #2) was significantly increased compared with that of wild-type rubber grass (WT). Figure 6 A). The natural rubber yield per plant was calculated based on the dry root weight test results (natural rubber yield per plant = relative natural rubber content in roots × dry root weight). The results showed that the natural rubber yield of the ABC110 overexpression lines (#1 and #2) was significantly higher than that of the wild-type rubber grass (WT). Figure 6 B).
Claims
1. A nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:
2.
2. An expression cassette, vector, or host bacterium containing the nucleic acid molecule of claim 1.
3. The application of the nucleic acid molecule described in claim 1 in cultivating rubber grass plants with increased root biomass and natural rubber content.
4. A method for increasing the root biomass and natural rubber content of rubber grass, comprising increasing the content or activity of ABC110 protein in rubber grass; the amino acid sequence of said ABC110 protein is shown in SEQ ID NO:
3.
5. The method according to claim 4, characterized in that, The content or activity of ABC110 protein in rubber grass is increased by overexpressing the nucleic acid molecule of claim 1 in rubber grass.
6. A method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: An overexpression vector for overexpressing the nucleic acid molecule of claim 1 was introduced into the rubber grass recipient material, and transgenic rubber grass plants with increased root biomass and natural rubber content were obtained by culturing.
7. The method according to claim 6, characterized in that, The overexpression vector was introduced into the rubber grass receptor material via Agrobacterium-mediated transformation.
8. A transgenic rubber grass plant with increased root biomass and natural rubber content obtained by the method of claim 6 or 7.
9. A method for producing natural rubber, comprising: Transgenic rubber grass plants with increased root biomass and natural rubber content as described in claim 8 were cultivated, and natural rubber was extracted from the roots.
10. A protein having the amino acid sequence shown in SEQ ID NO:3.