Gossypium hirsutum drought-resistant gene ghpi4ky7 and application thereof
By regulating the GhPI4Kγ7 gene in cotton and utilizing gene silencing technology and multi-signal pathway regulation, the problem of unclear localization of drought resistance traits in cotton was solved, and the physiological adaptability of cotton under drought conditions was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GANSU AGRI UNIV
- Filing Date
- 2025-11-29
- Publication Date
- 2026-05-29
AI Technical Summary
Cotton production faces the challenge of drought stress, and traditional research methods are insufficient to effectively locate and utilize genetic loci for drought-resistant traits, thus affecting breeding practices.
Using the GhPI4Kγ7 gene as a negative regulator, we regulated the drought stress tolerance of cotton through gene silencing technology. Combining RNA-seq transcriptome data and phosphorylated proteomics analysis, we integrated multiple signaling pathways to regulate the plant stress response network.
It enhances cotton's resistance to drought, maintains cell membrane stability and redox balance, and improves the plant's physiological adaptability under drought conditions.
Smart Images

Figure CN122104746A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of cotton technology, and more specifically, to a GhPI4Kγ7 gene that regulates drought resistance in upland cotton and its applications. Background Technology
[0002] Cotton, as one of the world's most important economic crops, holds an irreplaceable strategic position in ensuring national fiber security and stabilizing agricultural product supply. However, against the backdrop of intensifying global climate change, cotton production is facing increasingly severe challenges. With the growing prominence of environmental problems, cotton production is constrained by multiple stressors. The combined effects of soil degradation and environmental pollution further exacerbate the pressure on cotton production. In the face of these challenges, a deep analysis of cotton's response mechanisms to abiotic stresses is particularly important.
[0003] In recent years, the development of molecular biology techniques has provided new perspectives for elucidating the mechanisms of cotton stress resistance. The application of quantitative trait locus mapping (CT) technology has enabled researchers to analyze the genetic loci controlling stress resistance traits at the genome level. However, traditional research has many limitations, including heterogeneity among different research results and low mapping accuracy. These limitations, to some extent, restrict the application of research findings in breeding practices. Therefore, developing new research strategies and methodologies has become crucial for advancing cotton stress resistance research. Summary of the Invention
[0004] To address the problem of unclear genetic loci controlling drought resistance traits in cotton, this application provides a GhPI4Kγ7 gene that regulates drought resistance in upland cotton and its application.
[0005] This application provides a GhPI4Kγ7 gene that regulates drought resistance in upland cotton, using the following technical solution: A GhPI4Kγ7 gene that regulates drought resistance in upland cotton. The sequence of the GhPI4Kγ7 gene fragment is shown below: TGGGGGAGACTGGTTTCAGAGAAGTTGTTGCCTACCTTCTGGACCATGATTATTTTGCCAATGTGCCACCGACCGCGCTGGTGAAGATTACTCACTCAGTCTTCAACATTAATGGTGGTGTGAACAGAAATAGGCCTCACAAGAATCTGGTTAGCAAGATTGCATCGTGCCAACAGTTTATTCGGCATGATTTTGATGCTAGTGATCATGGAA CTTCAAGCTTCCCTGTTACTTCTGTGCACCGCATAGGAATACTTGATATACGTATATTCAACACGGACAGGCATGCAGGAAATCTTTTAGTTAGGAAGCTTGATGGTATTGGAAGGTTTGGTCAGATGGAACTCATTCCTATTGATCACGGCCTTTGCTTGCCAGAAACTTTGGAGGATCCATACTTTGAGTGGATTCATTGGCCTCAGGCT.
[0006] By employing the aforementioned technical approach, GhPI4Kγ7, acting as a negative regulator, influences cotton's tolerance to drought stress. When this gene is silenced, cotton plants exhibit stronger drought resistance, which is related to its involvement in regulating reactive oxygen species metabolism and signal transduction pathways within the plant. Furthermore, by integrating RNA-seq transcriptome data and phosphoproteomics analysis, this gene coordinates cotton's response to adversity by participating in the regulation of multiple pathways, including plant hormone signal transduction, the MAPK cascade signaling pathway, and the phosphatidylinositol signaling system. Potential downstream target genes regulated by GhPI4Kγ7 involve multiple biological processes such as transcriptional regulation, protein modification, and metabolic reprogramming, collectively forming a multi-level, multi-pathway stress response network. From a molecular mechanism perspective, GhPI4Kγ7 regulates the activity of downstream signaling pathways by affecting the phosphorylation state of phosphatidylinositol. Simultaneously, this gene also participates in maintaining cell membrane stability and influences plant redox homeostasis by regulating the activity of antioxidant enzyme systems.
[0007] Preferably, the application of the GhPI4Kγ7 gene regulating drought resistance in upland cotton in the tolerance of cotton to drought stress includes primer pairs for amplifying the GhPI4Kγ7 gene, which include primer pairs for cloning silent fragments and primer pairs for silent fragments with restriction enzyme sites.
[0008] By adopting the above technical solution, the primer fragments are shown in Table 7.
[0009] Preferably, a GhPI4Kγ7 gene that regulates drought resistance in upland cotton includes the following steps: S1. Cloning of gene silencing fragments: Using cDNA obtained by reverse transcription of RNA extracted from leaves of the upland cotton variety “Zhongmian 113” as a template, polymerase chain reaction (PCR) amplification was performed using specific silencing primers designed for the GhPI4Kγ7 gene to obtain the gene silencing fragment. The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 65℃ extension for 1 min, for a total of 30 cycles, and finally a final extension at 65℃ for 5 min. By adopting the above technical solutions, high-purity and high-yield gene silencing fragments are obtained by using specific silencing primers designed based on the Primer-BLAST tool to ensure primer targeting and avoid off-target effects, optimizing DNA amplification efficiency through precise control of denaturation, annealing and extension temperatures and times in the polymerase chain reaction amplification program, and faithfully reflecting gene expression information through reverse transcription of the cDNA template. This provides a reliable foundation for subsequent vector construction.
[0010] S2. Vector Construction and Transformation: The gene silencing fragment obtained in S1 was ligated into the pCloneEZ-TOPO cloning vector and transformed into DH5α competent E. coli cells. Positive clones were screened, and plasmids were extracted for sequencing verification. The correctly sequenced plasmids were used as templates for transduction. Xba I and Kpn Primers for the I restriction site were used for polymerase chain reaction amplification. The amplification product was ligated with the pTRV2 vector after double digestion to construct the TRV:GhPI4Kγ7 recombinant vector, which was then transformed into Agrobacterium GV3101 competent cells. By adopting the above technical solutions, the pCloneEZ-TOPO cloning vector provides an efficient topoisomerase-mediated ligation mechanism to ensure directional insertion of fragments. DH5α Escherichia coli competent cells utilize chemical transformation to improve plasmid uptake efficiency. The double enzyme digestion strategy precisely cuts the vector and fragments through restriction endonucleases to promote recombinant vector assembly. Therefore, a high-fidelity recombinant vector is obtained, laying the foundation for virus-induced gene silencing.
[0011] S3. Virus-induced gene silencing treatment: Agrobacterium cells carrying the TRV:GhPI4Kγ7 recombinant vector were resuspended in MMA resuspension to OD600=1.8, and after standing in the dark for 3-5 h, they were mixed with Agrobacterium cells carrying pYL192 resuspension at a 1:1 ratio; 7-day-old "Zhongmian 113" plants with fully expanded cotyledons were selected, and the mixed resuspension was injected after scratching the back of the cotyledons. After culturing in the dark for 24 h, they were transferred to a light incubator at 25℃; when the TRV:GhCLAI plants showed an albino phenotype, new leaves were sampled, RNA was extracted and reverse transcribed into cDNA, and the expression level of the GhPI4Kγ7 gene was detected by real-time quantitative polymerase chain reaction; By adopting the above technical solution, stable gene-silenced plants are obtained by using MMA resuspension to enhance the infection efficiency of Agrobacterium tumefaciens through acetylsyringone, dark static incubation to promote bacterial adsorption of plant cells, and light incubator to control photoperiod and temperature to simulate natural growth conditions. The gene expression downregulation effect can be accurately quantified by real-time fluorescence quantitative polymerase chain reaction.
[0012] S4. Silencing effect verification and stress resistance phenotype identification: When the cotton seedlings reach the third true leaf stage, select uniformly growing seedlings from the successfully silenced plants and subject them to drought treatment. Analyze their physiological and biochemical indicators and phenotypic characteristics to complete the identification of the GhPI4Kγ7 gene.
[0013] By adopting the above technical solution, since drought stress treatment is used to simulate natural environmental stress by controlling soil moisture, physiological and biochemical index analysis including conductivity meter measurement of cell membrane stability, and phenotypic observation combined with statistical verification to ensure the reliability of the results, a comprehensive gene function evaluation is obtained, revealing the key role of GhPI4Kγ7 in drought stress response.
[0014] Preferably, in step S1, before polymerase chain reaction amplification, specific silencing primers are designed using the Primer-BLAST tool, while controlling the size range of the silenced fragments generated by the primers to be 300~500 bp.
[0015] By adopting the above technical solutions, primers with high specificity and suitable fragments are obtained by using the Primer-BLAST tool to optimize primer specificity based on sequence alignment and secondary structure prediction, controlling the size of the silenced fragment to balance amplification efficiency and silencing effect by limiting the amplification length, and selecting the fragment size range to avoid excessively long or short fragments affecting the stability of vector ligation. This enhances the targeting and operability of gene silencing.
[0016] Preferably, in step S1, the reaction system for polymerase chain reaction amplification comprises: Taq2x polymerase chain reaction MixwithDyeV2 premix, specific silencing primers, and cDNA template.
[0017] By adopting the above technical solution, the use of Taq2x premixed solution to provide thermostable DNA polymerase and optimized buffer ensures amplification consistency and dye visualization. Specific silencing primers achieve selective amplification of target sequences through precise annealing temperature, and cDNA template concentration control avoids amplification inhibition or background noise. Therefore, highly sensitive and reproducible amplification results are obtained, providing high-quality raw materials for gene silencing fragment cloning.
[0018] Preferably, in step S1, the polymerase chain reaction amplification products are detected by agarose gel electrophoresis, and then the gene silencing fragments are purified by using a DNA purification and recovery kit.
[0019] By adopting the above technical solution, high-purity gene silencing fragments are obtained by using agarose gel electrophoresis to separate DNA fragments through an electric field and visually verifying the amplification specificity. The DNA purification and recovery kit uses silica membrane adsorption to remove impurities and enzyme residues, and the purification step improves fragment purity and avoids subsequent ligation interference. This reduces erroneous ligation and background cloning in vector construction.
[0020] Preferably, in step S2, the ligation reaction of the gene silencing fragment with the pCloneEZ-TOPO cloning vector is carried out at room temperature for 5 min.
[0021] By adopting the above technical solutions, high-efficiency ligation products are obtained, which improve the transformation success rate and the accuracy of E. coli screening. This is due to the use of room temperature ligation conditions to promote rapid annealing of the vector and fragments by topoisomerase activity, the optimization of ligation time to balance reaction efficiency and avoid over-ligation leading to multimer formation, and the pCloneEZ-TOPO vector design to provide zero background cloning and reduce false positives.
[0022] Preferably, in step S2, the transformation method of Agrobacterium GV3101 is as follows: The TRV:GhPI4Kγ7 recombinant plasmid is placed in competent Agrobacterium GV3101 cells, gently mixed, and then placed on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then, 700 μL of antibiotic-free LB liquid medium is added, and the cells are incubated at 28°C and 200 rpm for 2 h for recovery. The recovered bacterial culture is then plated onto a substrate containing 50 ng / μL Kan... + In solid medium containing 25 ng / μL Rif, the culture was incubated at 28°C for 2 days. Single colonies were picked and incubated overnight at 28°C. Positive strains were identified by polymerase chain reaction of the bacterial culture. The bacterial culture was then mixed with 50% glycerol at a 1:1 ratio and stored at -80°C.
[0023] By adopting the above technical solutions, the heat shock transformation method increases cell membrane permeability through sudden temperature changes to promote plasmid entry, ice bath and liquid nitrogen treatment stabilize the cell state to avoid damage, antibiotic screening ensures selective retention of recombinant plasmids, and glycerol preservation maintains the long-term activity of the strain. Therefore, a highly efficient Agrobacterium engineered strain is obtained, providing a reliable source of bacteria for virus-induced gene silencing.
[0024] Preferably, in step S3, the extraction of Agrobacterium cells is as follows: the transformed Agrobacterium GV3101 is revived on a solid medium containing 50 ng / μL Kan+ and 25 ng / μL Rif. After revival, the bacterial solution is expanded and cultured. After the bacterial solution becomes turbid, the cells are collected by centrifugation at 6000 rpm for 10 min, and the supernatant is discarded.
[0025] By adopting the above technical solution, high-concentration nutrients are provided by solid culture medium resuscitation to promote bacterial growth, centrifugation step efficiently separates bacterial cells and removes impurities from the culture medium through gravity sedimentation, and antibiotics maintain selective pressure to avoid contamination. Therefore, high-purity and active Agrobacterium cells are obtained, ensuring the uniformity and infection efficiency of subsequent resuspension preparation.
[0026] Preferably, in step S3, the MMA resuspension is prepared by mixing 2 mL of 0.5 MMES solution, 1 mL of 20 mg / mL acetylsuccinone solution and 1 mL of 1 MMgCl2 solution, and bringing the volume to 100 mL; the light conditions of the light incubator are a 16 h light / 8 h dark cycle, a light intensity of 7000 lux, a temperature of 25 °C, and a relative humidity of 60-80%.
[0027] By employing the above technical solutions, a highly efficient infection resuspension is obtained, promoting the stable expression of virus-induced gene silencing. This is achieved by using MES buffer to maintain a suitable pH value for a stable bacterial environment, using acetylsuccinone as a phenolic compound to enhance the attachment of Agrobacterium to plant cells and gene transfer, using MgCl2 to provide divalent ions to optimize membrane stability, and using volume adjustment to ensure consistent solution concentration. Furthermore, by using photoperiod to simulate the natural diurnal rhythm to promote normal photosynthesis and growth in plants, controlling light intensity to avoid photoinhibition or excessive growth, and optimizing temperature and humidity by using a thermostat and humidifier to maintain tissue hydration and metabolic balance. This ensures healthy plant growth conditions and guarantees the consistency and comparability of gene silencing phenotypes before stress treatment.
[0028] Preferably, in step S4, the drought treatment is as follows: the treatment group is not watered, the control group is watered once every 7 days, the sampling time is the 5th, 8th and 10th day after treatment, the soil moisture is controlled to gradually decrease from saturation to drought conditions, and the treatment temperature is maintained at 25℃.
[0029] By adopting the above technical solution, and by using a gradual drought treatment to simulate the physiological response induced by natural drought stress through changes in soil moisture, and by selecting sampling time points that cover the early and late dynamics of stress, comprehensive drought resistance phenotypic data can be obtained, revealing the functional network and regulatory pathways of the GhPI4Kγ7 gene under drought stress.
[0030] Preferred application of the drought-critical gene GhPI4Kγ7 in upland cotton's tolerance to drought stress.
[0031] By employing the aforementioned technical approach, virus-induced gene silencing technology downregulated the expression of the GhPI4Kγ7 gene and assessed its physiological response under drought stress. Based on obtaining stably silenced plants, controlled drought stress treatments were used to simulate actual field stress conditions. The progressive drought treatment, by controlling the linear decrease in soil moisture content from saturation, forced the plants to undergo a continuous stress process from normal water levels to moderate and then to severe drought, thus accurately revealing the function of GhPI4Kγ7 in maintaining cellular water balance and membrane stability, and examining its regulatory role in protective protein expression and metabolic network stability. Finally, by integrating and analyzing the changing trends of physiological and biochemical indicators of silenced plants under various stresses and comparing them with wild-type controls, the study confirmed that GhPI4Kγ7, as a key component of the phosphatidylinositol signaling pathway, plays a role in integrating multiple stress signals, activating downstream defense gene expression networks, and maintaining cell membrane integrity and energy metabolism balance.
[0032] In summary, this application has the following beneficial effects: 1. The method of this application combines drought stress treatment with physiological and biochemical index analysis. Since the indexes cover cell membrane stability, oxidative stress response and signaling pathway regulation, and differentially expressed genes are screened by RNA-seq, the results show that silent plants under drought stress have less leaf wilting, lower MDA content, lower relative conductivity, and higher antioxidant enzyme activity. This provides comprehensive stress resistance phenotypic data, revealing that the GhPI4Kγ7 gene enhances cotton's tolerance to drought stress by negatively regulating ROS accumulation, enhancing antioxidant enzyme activity and maintaining membrane integrity. Finally, the role of this gene in hormone signal transduction and the MAPK pathway is clarified.
[0033] 2. In this application, the Primer-BLAST tool is preferably used to design specific silencing primers and control the size of the silenced fragment to be 300-500 bp. Since this design is based on sequence alignment to improve primer specificity and avoid off-target effects, the fragment size range balances amplification efficiency and vector ligation stability. Combined with the use of Taq2xPCRMix premixed solution to ensure amplification consistency and dye visualization, a highly targeted and operable gene silencing effect is obtained, and the accuracy and reproducibility of the identification process are enhanced.
[0034] 3. Because this application employs the steps of gene silencing fragment cloning, vector construction and transformation, virus-induced gene silencing treatment, and verification of silencing effect and identification of stress resistance phenotype, and because specific silencing primers were designed using the Primer-BLAST tool and the PCR amplification procedure was improved to ensure primer targeting and amplification efficiency, the ligation fidelity was improved by using the pCloneEZ-TOPO cloning vector and double enzyme digestion, and the infection efficiency of Agrobacterium tumefaciens was enhanced by using MMA resuspension, and the plant growth conditions were improved by combining dark static culture and light culture, and natural stress was simulated by gradual drought treatment, the GhPI4Kγ7 silenced plants maintained a high relative leaf water content and a low water loss rate under drought stress, thus obtaining comprehensive and reliable gene function identification results. Attached Figure Description
[0035] Figure 1 A flowchart illustrating the GhPI4Kγ7 gene that regulates drought resistance in upland cotton, as proposed in this application; Figure 2 Figure showing the water loss rate and relative water content of detached leaves of a GhPI4Kγ7-silenced plant that regulates drought resistance in upland cotton, as proposed in this application. Figure 3 This is a graph showing the determination of malondialdehyde content and relative conductivity of the GhPI4Kγ7 gene, which regulates drought resistance in upland cotton, as proposed in this application. Figure 4 This is a graph showing the detection level of antioxidant enzymes in the GhPI4Kγ7 gene, which regulates drought resistance in upland cotton, as proposed in this application. Figure 5 This is a diagram of the downstream target genes that GhPI4Kγ7, a key candidate kinase gene for screening kinases that regulate drought resistance in upland cotton, may regulate, based on an RNA-seq screening method proposed in this application. Figure 6 This application proposes a GhPI4Kγ7 gene that regulates drought resistance in upland cotton. Figure 6 PCR images of target fragment amplification and expression vector in bacterial culture; Figure 7 This is a graph showing the silencing efficiency of the GhPI4Kγ7 gene, which regulates drought resistance in upland cotton, as proposed in this application. Figure 8 This is a phenotypic analysis diagram of a GhPI4Kγ7-silenced plant that regulates drought resistance in upland cotton, as proposed in this application, under drought stress. Detailed Implementation
[0036] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.
[0037] Example 1 For the control and treatment groups in S4, quickly cut 3-6 fully expanded leaves from the plants in both groups, keeping them in the same position and with similar leaf areas. Place them in a plastic bag, then in an ice box, and quickly bring them back to the laboratory. Remove the leaves, wipe off the surface moisture, and spread them out on clean filter paper. Each sample was tested in triplicate, and the leaves were weighed and counted using an analytical balance in a specific order. The first weighing was recorded as time 0. Subsequent weighings were taken every half hour or hour until the fresh weight no longer showed significant change. The water loss at each time point was calculated by subtracting the fresh weight at time 0 from the fresh weight at each time point. The water loss rate at each time point was then calculated by dividing the water loss rate at each time point by the fresh weight at time 0. A water loss rate graph was plotted with time points on the x-axis and water loss rate on the y-axis, and statistical analysis was performed on the water loss rate at each time point.
[0038] Relative water content determination: Leaves were cut from plants in the control and treatment groups, keeping them in the same location as much as possible, with similar leaf areas, and weighed (FW). Three replicates were taken from each group. The leaves were completely immersed in deionized water for approximately 4 hours, and the surface moisture was blotted dry with absorbent paper, and the weight was recorded (DW). The leaves were then placed in an 80°C oven for approximately 2 days, and the weight was recorded (TW). The relative water content of the leaves was calculated using the following formula: RWC(%)=(FW-DW) / (TW-DW)×100% We discovered phenotypic differences between TRV:GhPI4Kγ7 plants and control plants under stress. To explore the reasons for the GhPI4Kγ gene's response to drought stress, we first measured the detached leaf water loss rate and relative water content. The results showed that throughout the treatment period, TRV:GhPI4Kγ7 plants had a lower detached leaf water loss rate and a significantly higher relative water content than the control plant TRV:00 (3-4A, 3-4B) compared to TRV:00. This indicates that the GhPI4Kγ7 response to cotton drought is closely related to changes in the physiological and biochemical processes within the leaves.
[0039] Example 2 Preparation of crude enzyme solution: Liquid nitrogen was poured into the mortar for pre-cooling. 0.5 g of leaves from TRV:00 plants, silent plants, and control plants under abiotic stress were taken and rapidly homogenized with 5 ml of phosphate buffer (pH=7.8). The homogenate was then transferred to 10 ml centrifuge tubes and centrifuged for 10 min (5000 rpm). The supernatant was transferred to a new 10 ml centrifuge tube and stored at 4°C for later use. The preparation of phosphate buffer and its buffer type is shown in Table 1. Table 1 Preparation of Phosphate Buffer
[0040] POD activity assay: Preparation of reaction solution: Add 50 mL of phosphate buffer (0.1 mol pH=6.0), 28 µl of guaiacol and 19 µl of H2O2 (30%) to a beaker one at a time, mix thoroughly and set aside.
[0041] Add 3 ml of reaction solution to a cuvette, then take 20 µl of crude enzyme solution, with phosphate buffer (pH=6.0) as the control. Quickly place the cuvette on a UV spectrophotometer and start timing (470 nm). Take a reading every 1 min for a total of 3 readings, and set up three biological replicates.
[0042] The calculation method is shown in Table 2: Table 2
[0043] SOD activity assay: Preparation of reaction solution: Add phosphate buffer (0.5 mol pH=7.8), Met, NBT, EDTA-Na2 and riboflavin to a beaker in a ratio of 15:3:3:3:3:2.5.
[0044] Add 3 ml of reaction solution to identical test tubes. Add 100 µl of crude enzyme solution to the experimental group. Replace the enzyme solution with phosphate buffer (pH=7.8) for both the positive and negative controls. Place the negative control in the dark, and the others under light (4000 Lux). When the color of the reaction solution changes, immediately stop the light exposure and end the reaction. Take readings using a UV-Vis spectrophotometer (560 nm). Set up three biological replicates for each sample.
[0045] The calculation method is shown in Table 3: Table 3
[0046] CAT activity assay: Preparation of the reaction solution: H2O2 (0.1 mol) and phosphate buffer (0.1 mol, pH=7.8) were mixed in a 1:4 ratio.
[0047] Add 100 µL of crude enzyme solution and 2.5 ml of reaction solution to a cuvette. Add phosphate buffer (0.1 mol pH=7.8) instead of enzyme solution for the control. Quickly place the cuvette in a UV spectrophotometer and start timing (240 nm). Read the values once every 1 min for a total of 3 times. Set up three biological replicates.
[0048] The calculation method is shown in Table 4: Table 4
[0049] Determination of MDA content: Preparation of the extract: Pre-cool liquid nitrogen in a mortar. Take 1 g of cotton leaves from both the silent plant and the control plant and grind them rapidly in a mortar containing 3 ml of 10% TCA and a small amount of quartz sand. Transfer the mixture to a 10 ml centrifuge tube. Add 2 ml of 10% TCA to the mortar to rinse away any remaining residue. Centrifuge for 10 min (5000 rpm) and collect the supernatant, which is the extract.
[0050] Preparation of reaction solution: 10% TCA solution and 0.6% TBA solution.
[0051] Add 1 ml of extraction solution and 2 ml of reaction solution to identical test tubes and mix well to form the experimental group. Use 1 ml of distilled water instead of extraction solution for the negative control. Heat in boiling water for 15 min, then cool rapidly. Take the supernatant in a cuvette and read the absorbance at 532 nm, 600 nm and 450 nm using a UV-Vis spectrophotometer. Set up three biological replicates.
[0052] The calculation method is shown in Table 5 below: Table 5
[0053] Plants suffer functional damage under drought conditions. Abiotic stress leads to increased accumulation of intracellular reactive oxygen species (ROS) and elevated levels of malondialdehyde (MDA), a product of membrane lipid peroxidation. This results in increased MDA levels and excessive cell membrane oxidation, causing oxidative damage to plant cells, nucleic acids, tissues, and organs. Compared to untreated plants, plants treated with stress showed a significant increase in MDA content. Under drought stress, the MDA content of TRV:GhPI4Kγ7 plants was significantly lower than that of TRV:00 plants. Figure 3 A). Compared with untreated plants, the relative electrical conductivity of stress-treated plants increased. Under drought stress, the relative electrical conductivity of TRV:GhPI4Kγ7 plants was significantly lower than that of TRV:00 plants. Figure 3 B). To assess the antioxidant capacity of plants, we measured hydrogen peroxide (H2O2) and superoxide anion (O3). 2- The accumulation of reactive oxygen species (ROS) was investigated, and the levels of ROS were analyzed using NBT and DAB staining methods. Under drought stress, NBT staining of TRV:GhPI4Kγ7 plants showed that the staining area at the leaf base gradually increased and the staining intensity deepened with the extension of stress time. On day 10, compared with the control group, the NBT staining degree of TRV:GhPI4Kγ7 plants was lighter, indicating that their oxidative stress response was weaker. Figure 3 C).
[0054] Plants suffer functional damage under drought conditions. Abiotic stress leads to increased accumulation of intracellular reactive oxygen species (ROS) and elevated levels of malondialdehyde (MDA), a product of membrane lipid peroxidation. This results in increased MDA levels and excessive cell membrane oxidation, causing oxidative damage to plant cells, nucleic acids, tissues, and organs. Compared to untreated plants, plants treated with stress showed a significant increase in MDA content. Under drought stress, the MDA content of TRV:GhPI4Kγ7 plants was significantly lower than that of TRV:00 plants. Figure 3 A). Compared with untreated plants, the relative electrical conductivity of stress-treated plants increased. Under drought stress, the relative electrical conductivity of TRV:GhPI4Kγ7 plants was significantly lower than that of TRV:00 plants. Figure 3 B). To assess the antioxidant capacity of plants, we measured hydrogen peroxide (H2O2) and superoxide anion (O3). 2- The accumulation of reactive oxygen species (ROS) was investigated, and the levels of ROS were analyzed using NBT and DAB staining methods. Under drought stress, NBT staining of TRV:GhPI4Kγ7 plants showed that the staining area at the leaf base gradually increased and the staining intensity deepened with the extension of stress time. On day 10, compared with the control group, the NBT staining degree of TRV:GhPI4Kγ7 plants was lighter, indicating that their oxidative stress response was weaker. Figure 3 C).
[0055] Example 3 Cotton leaves from the same part of different individual plants were soaked in 50 mL test tubes containing 40 mL of distilled water. The test tubes were placed in a vacuum desiccator (model DZF-6020, Wuhan, China) for 20 min of vacuum treatment. After that, the test tubes were shaken at 100 rpm for 3 h at room temperature. The initial conductivity (C1) was then measured using a conductivity meter (model DDS-12A, Shanghai, China). All test tubes were then placed in a boiling water bath for 30 min, removed, cooled to room temperature, and their conductivity (C2) was measured. The relative conductivity (REC) of cotton leaves = C1 / C2 * 100.
[0056] Antioxidant enzyme systems are important defense mechanisms in plants, effectively responding to various environmental stresses and physiological pressures. This study investigated the regulatory role of the GhPI4Kγ7 gene in antioxidant responses under drought stress. By detecting the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in silenced plants, the key roles of these two genes in plant stress resistance were revealed. Under drought stress, the activities of SOD, POD, and CAT were significantly increased in GhPI4Kγ7-silenced plants, indicating that silencing GhPI4Kγ7 can effectively reduce oxidative stress and enhance the drought resistance of plants. Figure 4 ).
[0057] Example 4 Completely immerse the leaves of silent and control plants in DAB staining solution and treat in the dark at 25°C for 2 h. Completely remove the DAB and wash the plant four times with distilled water to remove adsorbed staining solution. (If pigment is present, add 70% ethanol and boil in a water bath for 10 min to decolorize.) Observe the staining. The more pronounced the yellow color, the more hydrogen peroxide accumulates, and vice versa.
[0058] Completely immerse the leaves of both silent and control plants in NBT staining solution and treat at 25°C in the dark for 2 hours. Then, completely remove the NBT and wash the plants four times with distilled water to remove any adsorbed staining solution. (If pigment is present, add 70% ethanol and boil in a water bath for 10 minutes to decolorize.) Observe the staining results. The more pronounced the deep blue or bluish-purple color, the greater the accumulation of superoxide anions, and vice versa.
[0059] Example 5 This experiment set up four treatments: TRV:GhPI4Kγ7 and TRV:00 plants under normal and drought conditions, with three biological replicates for each treatment. Based on high-quality sequencing data, gene expression levels were calculated using FPKM (Fragments Per Kilobase Per Million Mapped Reads) and TPM (Transcripts Per Million) normalization methods to eliminate the influence of sequencing depth differences between samples. Differential expression analysis was performed with |log2FoldChange|>2 and... q <0.05 was used as a significance threshold to screen differentially expressed genes (DEGs), and pseudoproteins and non-specific proteins were further removed to improve the reliability of the analysis.
[0060] To further explore the biological functions of differentially expressed genes, we performed GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analyses on the Lianchuan Bio Cloud Platform (https: / / www.omicstudio.cn / home). The enrichment analyses visualized the top 20 enriched pathways from the three major GO pathways and the top 20 enriched pathways from the KEGG database. The differentially expressed genes obtained were functionally annotated using the CottonZJU database.
[0061] To investigate the gene network and pathways that may be involved in regulating drought stress in cotton after GhPI4Kγ7 silencing, this study used GhPI4Kγ7-silenced plants (TRV:GhPI4Kγ7) and empty vector plants (TRV:00) under normal and drought conditions for RNA-seq and differentially expressed gene analysis. Based on log2|FoldChange|>2 and q<0.05, after filtering out unidentified proteins, pseudoproteins, and unidentified genes, GO analysis showed that differentially expressed genes annotated some hormone pathways (plant hormone signal transduction pathway, ethylene-activated signaling pathway, response to salicylic acid, response to abscisic acid, and gibberellin-activated signaling pathway), as well as some abiotic stress pathways (response to water deficiency, response to cold, and response to heat). Figure 5 A) KEGG analysis showed that differentially expressed genes were enriched in endocytosis and peroxisome pathways in cellular processes; plant hormone signal transduction, MAPK signaling pathway and phosphatidylinositol signaling system pathway were enriched in environmental information processing; and plant diurnal rhythm pathway was enriched in organismal systems.
[0062] Thirty-one differentially expressed genes (DEGs) were initially identified between silencing plants and empty vector plants under normal conditions and drought stress. Subsequently, we searched for the phosphorylation sites of PI4K kinase and the 31 differentially expressed genes on the protein website UniProt (https: / / www.uniprot.org / ) and the protein phosphorylation website PhosphoSitePlus (https: / / www.phosphosite.org / homeAction.action), ultimately identifying eight potential downstream target genes regulated by GhPI4Kγ7 silencing. These differentially expressed genes were annotated in the Zhejiang University Cotton Omics Database (http: / / cotton.zju.edu.cn / ). Further investigation is needed to identify these downstream target genes and study their function in regulating upland cotton's resistance to abiotic stresses (Table 6).
[0063] Table 6. Functional annotations of downstream target genes.
[0064] Based on the above examples, the silencing fragment sequence of the GhPI4Kγ7 gene is shown below: TGGGGGAGACTGGTTTCAGAGAAGTTGTTGCCTACCTTCTGGACCATGATTATTTTGCCAATGTGCCACCGACCGCGCTGGTGAAGATTACTCACTCAGTCTTCAACATTAATGGTGGTGTGAACAGAAATAGGCCTCACAAGAATCTGGTTAGCAAGATTGCATCGTGCCAACAGTTTATTCGGCATGATTTTGATGCTAGTGATCATGGAA CTTCAAGCTTCCCTGTTACTTCTGTGCACCGCATAGGAATACTTGATATACGTATATTCAACACGGACAGGCATGCAGGAAATCTTTTAGTTAGGAAGCTTGATGGTATTGGAAGGTTTGGTCAGATGGAACTCATTCCTATTGATCACGGCCTTTGCTTGCCAGAAACTTTGGAGGATCCATACTTTGAGTGGATTCATTGGCCTCAGGCT.
[0065] The primer fragments for GhPI4Kγ7 are shown in Table 7.
[0066] Table 7 Primer pairs for silencing fragment cloning and primer pairs for silencing fragments with restriction enzyme sites.
[0067] Meanwhile, the full-length gene sequence of GhPI4Kγ7 is shown below:
[0068] Performance testing Construction of TRV expression vector recombinant plasmid: To study the function of GhPI4Kγ7, a TRV recombinant plasmid was constructed as a vector for endogenous gene silencing. It was introduced into Zhongmian 113 to silence the endogenous gene. Analysis was performed by amplifying the target gene silencing fragment and double enzyme digestion of the expression vector. Figure 6 The sequencing results of the expression vector were analyzed using DNAMAN 9.0 software, which revealed that the amplified target gene fragment had not undergone mutation. Subsequently, the positive plasmid was transformed into Agrobacterium GV3101, and bacterial culture PCR was performed. Positive strains were selected and preserved.
[0069] Detection of target gene silencing efficiency: To clarify the function of candidate genes in the abiotic stress response of upland cotton, the function of target candidate genes was studied using VIGS technology. Zhongmian 113 was selected as the recipient plant, and the TRV recombinant plasmid containing the target gene silencing fragment was injected into the lower epidermis of its cotyledons. When the true leaves of TRV:GhCLA1 seedlings showed signs of chlorosis (approximately 7 days), RNA was extracted from the second true leaf of the silencing plants for positive plant detection, and the silencing efficiency was determined by qRT-PCR. Compared with control plants, silencing plants with a silencing efficiency lower than 0.5 were transplanted (…). Figure 7 A; Figure 7 B) can be used for subsequent trait observation and analysis.
[0070] Phenotypic analysis of target gene-silenced plants under drought stress: After subjecting TRV:GhPI4Kγ7 and TRV:00 plants grown under normal conditions to drought for 10 days, it was found that under drought stress, the silenced plants showed less leaf wilting and water loss compared to the control plants. Figure 8 Silencing of the GhPI4Kγ7 gene significantly enhanced the drought tolerance of upland cotton, indicating that the GhPI4Kγ7 gene is involved in the response of upland cotton to drought stress.
[0071] Example Conclusion This application demonstrates through systematic functional analysis that GhPI4Kγ7 significantly affects cotton's adaptation to drought stress by participating in the regulation of reactive oxygen species (ROS) metabolism, cell membrane stability, and the phosphatidylinositol signaling pathway. Further analysis at the molecular level reveals that PI4K catalyzes the phosphorylation of phosphatidylinositol (PtdIns) to generate PtdIns(4)P, a process with multiple biological significance in plant stress responses. First, PtdIns(4)P, as an important second messenger, directly participates in regulating cell membrane structural integrity and signal transduction efficiency. Under stress conditions, this process helps maintain the cell membrane's osmotic regulation capacity and regulates the balance between ROS production and scavenging by influencing NADPH oxidase activity. This study observed significantly increased activities of antioxidant enzymes such as SOD, POD, and CAT, while decreased ROS accumulation in GhPI4Kγ7-silenced plants, suggesting that this gene may enhance plant antioxidant capacity by negatively regulating the ROS production pathway. This finding corroborates findings in rice, suggesting that the PI4K family genes may have similar ROS regulatory mechanisms in both monocot and dicot plants.
[0072] The PI4K family, through its diverse enzymatic activities and subcellular localization, constitutes a multi-layered functional network in plants: participating in stress hormone responses at the signal transduction level, regulating stomatal movement at the organelle function level, and maintaining structural stability at the membrane system level. The synergistic effect of these functions enables plants to effectively cope with complex and variable environmental stresses. This application, by integrating transcriptomics and bioinformatics analysis methods, preliminarily explored the complex regulatory network of GhPI4Kγ7 in cotton's abiotic stress response. RNA-seq data analysis showed that silencing GhPI4Kγ7 significantly affected several key biological processes. GO enrichment analysis results indicated that differentially expressed genes were mainly enriched in important pathways such as plant hormone signal transduction, ethylene activation signaling pathway, and responses to salicylic acid and abscisic acid. These findings provide important clues for understanding the molecular basis of GhPI4Kγ7's involvement in plant stress adaptation. Further KEGG pathway analysis revealed that differentially expressed genes were significantly enriched in the phosphatidylinositol signaling system and the MAPK signaling pathway, which is highly consistent with the known biological functions of the PI4K family. Of particular note is the fact that the MAPK signaling pathway, as a core regulatory network for plant stress responses, may form a complex regulatory module through its cross-talk with the PI4K signaling pathway. This multi-pathway synergistic mechanism enables plants to precisely regulate stress response processes and achieve optimal adaptive performance. The PI4K-mediated signaling pathway has extensive cross-talk with plant hormone signaling networks. Our results show that GhPI4Kγ7 may participate in stress responses by influencing hormone signaling pathways such as abscisic acid (ABA), ethylene, and salicylic acid. This multi-level regulatory network allows plants to precisely coordinate different stress response pathways to achieve optimal adaptive responses. Especially under drought stress, PI4K may regulate stomatal opening and closing and water use efficiency through interaction with the ABA signaling pathway. Furthermore, through integrated phosphorylated protein website analysis, we screened 8 downstream target genes from 31 core differentially expressed genes that may be directly or indirectly regulated by GhPI4Kγ7. These target genes are involved in multiple biological processes, including membrane transport, signal transduction, and stress response, and include several known key genes involved in stress responses. For example, one of the genes encoding calcium-dependent protein kinases may be involved in calcium metabolism. 2+In signal transduction, another gene encoding a transcription factor may directly regulate the expression of downstream stress-response genes. These findings provide new research directions for elucidating the molecular function of GhPI4Kγ7. By comparing the functions of PI4K family genes with those in other species, we can better understand the functional specialization and conservation of GhPI4Kγ7 in plant evolution. The function of GhPI4Kγ7 shows significant similarities to that of rice OsPI4Kγ1 and Arabidopsis thaliana AtPI4Kγ3, particularly in ROS metabolism regulation and membrane stability maintenance. This functional conservation suggests that the PI4Kγ subfamily may play a fundamental and important role in plant stress adaptation. In perennial crops such as cotton, PI4K genes may have developed more complex regulatory networks to adapt to their unique growth environment and life cycle.
[0073] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. A GhPI4Kγ7 gene that regulates drought resistance in upland cotton, characterized by, The sequence of the GhPI4Kγ7 gene fragment is shown below: TGGGGGAGACTGGTTTCAGAGAAGTTGTTGCCTACCTTCTGGACCATGATTATTTTGCCAATGTGCCACCGACCGCGCTGGTGAAGATTACTCACTCAGTCTTCAACATTAATGGTGGTGTGAACAGAAATAGGCCTCACAAGAATCTGGTTAGCAAGATTGCATCGTGCCAACAGTTTATTCGGCATGATTTTGATGCTAGTGATCATGGAA CTTCAAGCTTCCCTGTTACTTCTGTGCACCGCATAGGAATACTTGATATACGTATATTCAACACGGACAGGCATGCAGGAAATCTTTTAGTTAGGAAGCTTGATGGTATTGGAAGGTTTGGTCAGATGGAACTCATTCCTATTGATCACGGCCTTTGCTTGCCAGAAACTTTGGAGGATCCATACTTTGAGTGGATTCATTGGCCTCAGGCT.
2. The application of a GhPI4Kγ7 gene regulating drought resistance in upland cotton as described in any one of claims 1 in the tolerance of cotton to drought stress, wherein the primer pair used to amplify the GhPI4Kγ7 gene includes a silent fragment cloning primer pair and a silent fragment primer pair with restriction enzyme sites.
3. A GhPI4Kγ7 gene that regulates drought resistance in upland cotton, characterized by, The GhPI4Kγ7 gene for regulating drought resistance in upland cotton as described in any one of claims 1 comprises the following steps: S1. Cloning of gene silencing fragments: Using cDNA obtained by reverse transcription of RNA extracted from leaves of the upland cotton variety "Zhongmian 113" as a template, PCR amplification was performed using specific silencing primers designed for the GhPI4Kγ7 gene to obtain gene silencing fragments. The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 65℃ extension for 1 min, for a total of 30 cycles, and finally a final extension at 65℃ for 5 min. S2. Vector Construction and Transformation: The gene silencing fragment obtained in S1 was ligated into the pCloneEZ-TOPO cloning vector and transformed into DH5α competent E. coli cells. Positive clones were screened, and plasmids were extracted for sequencing verification. The correctly sequenced plasmids were used as templates for transduction. Xba I and Kpn PCR amplification was performed using primers with restriction site I. The amplification product was then ligated with the pTRV2 vector after double restriction to construct the TRV:GhPI4Kγ7 recombinant vector, which was then transformed into Agrobacterium GV3101 competent cells. S3. Virus-induced gene silencing treatment: Agrobacterium cells carrying the TRV:GhPI4Kγ7 recombinant vector were resuspended in MMA resuspension to OD600=1.8, and after standing in the dark for 3-5 h, they were mixed with Agrobacterium cells carrying pYL192 resuspension at a 1:1 ratio; 7-day-old "Zhongmian 113" plants with fully expanded cotyledons were selected, and the mixed resuspension was injected after scratching the back of the cotyledons. After culturing in the dark for 24 h, they were transferred to a light incubator at 25℃; when the TRV:GhCLAI plants showed an albino phenotype, new leaves were sampled, RNA was extracted and reverse transcribed into cDNA, and the expression level of the GhPI4Kγ7 gene was detected by qRT-PCR; S4. Silencing effect verification and drought resistance phenotype identification: When the cotton seedlings reach the third true leaf stage, the successfully silenced plants are selected and drought-treated with uniform growth. Their physiological and biochemical indicators and phenotypic characteristics are analyzed to identify the GhPI4Kγ7 gene.
4. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S1, before PCR amplification, specific silencing primers are designed using the Primer-BLAST tool, while controlling the size of the silenced fragments generated by the primers to be within the range of 300~500 bp.
5. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S1, the PCR amplification reaction system consists of Taq2xPCRMixwithDyeV2 premix, specific silencing primers, and cDNA template.
6. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S1, the PCR amplification products are detected by agarose gel electrophoresis, and then the gene silencing fragments are purified by using a DNA purification and recovery kit.
7. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S2, the ligation reaction between the gene-silencing fragment and the pCloneEZ-TOPO cloning vector was carried out at room temperature for 5 minutes. The transformation method for Agrobacterium GV3101 was as follows: the TRV:GhPI4Kγ7 recombinant plasmid was placed in Agrobacterium GV3101 competent cells, gently mixed, and then placed on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and on ice for 5 minutes. Then, 700 μL of antibiotic-free LB broth was added, and the cells were incubated at 28°C and 200 rpm for 2 hours to recover. The recovered bacterial culture was then plated onto a medium containing 50 ng / μL Kansas protein. + In solid medium containing 25 ng / μL Rif, the cultures were incubated at 28°C for 2 days. Single colonies were picked and incubated overnight at 28°C. Positive strains were identified by PCR. The cultures were then mixed with 50% glycerol at a 1:1 ratio and stored at -80°C.
8. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S3, the extraction steps for Agrobacterium cells are as follows: Transformed Agrobacterium GV3101 is extracted with 50 ng / μL Kan... + The cells were revived on solid medium containing 25 ng / μL Rif. After revival, the bacterial culture was expanded and cultured. When the bacterial culture became turbid, the cells were collected by centrifugation at 6000 rpm for 10 min, and the supernatant was discarded.
9. The GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S3, the MMA resuspension was prepared by mixing 2 mL of 0.5 MMES solution, 1 mL of 20 mg / mL acetylsuccinone solution and 1 mL of 1 MMgCl2 solution, and then bringing the volume to 100 mL. The light conditions of the light incubator were 16 h light / 8 h dark cycle, light intensity of 7000 lux, temperature of 25℃, and relative humidity of 60-80%.
10. A GhPI4Kγ7 gene regulating drought resistance in upland cotton according to claim 3, characterized in that, In step S4, the drought treatment was as follows: the treatment group was not watered, while the control group was watered once every 7 days. Sampling was conducted on the 5th, 8th, and 10th days after treatment. Soil moisture was gradually reduced from saturation to drought conditions, and the treatment temperature was maintained at 25℃.