Bacillus licheniformis cotjb protein-mediated bacillus subtilis and construction method and application thereof

By using the heterologous anchoring protein CotJB and flexible linker peptide from Bacillus licheniformis, the problems of unstable expression and low display efficiency of influenza virus hemagglutinin HA protein on the surface of Bacillus subtilis were solved, achieving efficient and stable recombinant protein display and immunization effects, which is suitable for industrial production.

CN122104758APending Publication Date: 2026-05-29TIANJIN UNIV OF SCI & TECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN UNIV OF SCI & TECH
Filing Date
2026-03-12
Publication Date
2026-05-29

Smart Images

  • Figure CN122104758A_ABST
    Figure CN122104758A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetically engineered bacteria, and specifically discloses Bacillus subtilis mediated by CotJB protein from Bacillus licheniformis, a construction method thereof and an application thereof. By changing the anchoring protein from Bacillus subtilis into a heterologous anchoring protein CotJB from Bacillus licheniformis, the amino acid characteristics on the heterologous anchoring protein CotJB can be combined with the specific binding sites on Bacillus subtilis, effectively avoiding the competition of the endogenous protein in the host bacteria of Bacillus subtilis, so that the target protein is highly expressed on the host bacteria. A flexible connecting peptide is introduced between CotJB and HA protein, effectively relieving the steric hindrance of the anchoring protein to the HA protein, and giving the HA protein sufficient freedom to fold correctly. The hemagglutination test proves that the HA protein displayed on the spore surface has good biological activity and can effectively agglutinate red blood cells, solving the problem of inactivation of antigens in traditional construction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetically engineered bacteria technology, and in particular to a Bacillus subtilis strain mediated by Bacillus licheniformis CotJB protein, its construction method, and its application. Background Technology

[0002] Bacillus subtilis ( Bacillus subtilis The spores produced by Bacillus subtilis possess strong stress resistance, making them ideal oral vaccine vectors. Currently, research has been conducted on expressing influenza virus hemagglutinin (HA) proteins using Bacillus subtilis surface display technology. Conventional methods often use endogenous proteins from Bacillus subtilis (such as CotB, CotC, and CotG) as anchoring vectors. When homologous genes are reintroduced into the host genome or overexpressed via plasmids, homologous recombination easily occurs due to high sequence homology, resulting in poor transmission stability. This leads to plasmid loss and unstable expression in engineered bacteria during passage, severely affecting the stability of industrial fermentation. Furthermore, using the host's own anchoring protein, which is required for normal spore coat assembly during spore formation, results in recombinantly expressed fusion proteins competing with naturally expressed host proteins for binding sites on the spore surface, limiting display efficiency and restricting the loading and display density of exogenous antigens. HA protein is a complex viral surface glycoprotein. Direct fusion with anchoring proteins can easily lead to misfolding or steric hindrance, causing it to adhere tightly to the spore surface, thus blocking its key antigenic epitopes and losing its hemagglutination activity or immunogenicity. Summary of the Invention

[0003] The purpose of this invention is to address the aforementioned shortcomings of the prior art by providing a Bacillus subtilis strain mediated by the CotJB protein of Bacillus licheniformis, its construction method, and its application. By replacing the endogenous anchoring protein from Bacillus subtilis with the heterologous anchoring protein CotJB from Bacillus licheniformis, species differences between the strains are generated. This effectively avoids the homologous recombination mechanism of the host cell, resulting in a stronger integrity of the target gene carried by the recombinant bacteria, more stable genetics, and greater suitability for industrial production.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention is to provide a method for constructing Bacillus subtilis based on the CotJB protein of Bacillus licheniformis, comprising the following steps: Obtain the nucleotide sequence of the heterologous anchoring protein CotJB of Bacillus licheniformis, as shown in SEQ ID NO:1; the nucleotide sequence of the flexible linker peptide, as shown in SEQ ID NO:2; and the nucleotide sequence of the HA hemagglutinin protein, as shown in SEQ ID NO:3. A linearized vector with HA protein and CotJB protein as its backbone was constructed. The linearized vector was introduced into the first host bacterium, and the integration plasmid was extracted to obtain the recombinant expression vector; The recombinant expression vector was transformed into a second host bacterium carrying a methyltransferase plasmid, and the methylated plasmid was extracted. The methylated plasmid was introduced into competent Bacillus subtilis cells, and the recombinant Bacillus subtilis was obtained by screening.

[0005] Furthermore, the construction process of the recombinant expression vector is as follows: using linker peptides and... psld-1 Using the genome as a template, PCR amplification was performed using specific primer pairs. After purification and recovery, fragments A and B were obtained. Fragment HA is the vector homologous arm-Cot protein-linker peptide homologous arm, and fragment B is the linker peptide homologous arm-HA protein-vector homologous arm. The psld-1 plasmid was double-digested with restriction endonucleases to obtain the linearized vector fragment. Under the action of a seamless cloning enzyme, fragments A, the linker peptide fragment, and fragment B were ligated to the linearized vector to construct the recombinant expression vector.

[0006] Further, the primer pair used for amplifying fragment A is PCL-F and PCL-R, and the primer pair used for amplifying fragment B is LHP-F and LHP-R. The nucleotide sequence of PCL-F is shown in SEQ ID NO:5, the nucleotide sequence of PCL-R is shown in SEQ ID NO:6, the nucleotide sequence of LHP-F is shown in SEQ ID NO:7, and the nucleotide sequence of LHP-R is shown in SEQ ID NO:8.

[0007] Furthermore, the first host bacterium is Escherichia coli competent cells JM109.

[0008] Furthermore, the second host bacterium is Escherichia coli competent cells EC135.

[0009] A second aspect of the present invention is to provide recombinant Bacillus subtilis obtained by using the method described.

[0010] A third aspect of the present invention is to provide a spore surface display system, comprising: The system utilizes the endogenous anchoring protein CotJB derived from Bacillus licheniformis as a carrier to fuse and express the exogenous target protein and anchor it to the spore surface; the amino acid sequence of the CotJB protein is shown in SEQ ID NO: 4, or a derived sequence that has more than 90% homology with SEQ ID NO: 4 and retains the anchoring function, and the exogenous target protein is HA hemagglutinin protein.

[0011] A fourth aspect of the present invention is to provide the use of the recombinant Bacillus subtilis or the spore surface display system in the preparation of recombinant hemagglutinin protein.

[0012] Furthermore, the recombinant hemagglutinin protein is used to prepare a reagent for a hemagglutination inhibition test.

[0013] Furthermore, the recombinant hemagglutinin protein is used to prepare antigen preparations for animal immune evaluation.

[0014] Compared with the prior art, the beneficial effects of the technical solution provided by the present invention are as follows: (1) In this invention, the endogenous anchoring protein from Bacillus subtilis is replaced with a heterologous anchoring protein CotJB from Bacillus licheniformis. This creates species differences between the strains, effectively circumventing the homologous recombination mechanism of the host cell, resulting in a stronger integrity of the target gene carried by the recombinant bacteria, more stable genetics, and better suitability for industrial production. Simultaneously, the amino acid characteristics of the heterologous anchoring protein CotJB can bind to specific binding sites on Bacillus subtilis, effectively avoiding competition from the endogenous protein of the Bacillus subtilis host bacteria. Experiments have demonstrated that using the heterologous anchoring protein can achieve high expression of the target protein in the host bacteria. Finally, to avoid folding or spatial orientation errors in the expressed target protein, a flexible linker peptide (GGGGS) is introduced between the anchoring protein and the target HA protein. Microscopic observation and experiments have confirmed that the engineered bacteria in this experiment have good biological activity and high immunogenicity.

[0015] (2) Experiments have shown that the heterologous system provided by the present invention can achieve high-density display of HA protein on the surface of spores.

[0016] (3) This invention introduces a (GGGGS) flexible linker peptide between CotJB and the HA protein. This design effectively alleviates the steric hindrance caused by the anchoring protein to the HA protein, giving the HA protein sufficient degrees of freedom to fold correctly. Hemagglutination assays confirmed that the HA protein displayed on the spore surface has good biological activity and can effectively agglutinate red blood cells, solving the problem of antigen inactivation in traditional constructions.

[0017] (4) The recombinant Bacillus subtilis provided by the present invention inherits the heat and acid resistance of spores, can resist gastric digestion, and release antigens upon reaching the intestine, providing a new technical platform for the development of oral influenza vaccines that do not require cold chain transportation and can be stored at room temperature.

[0018] (5) The spore surface display system provided by the present invention can efficiently display hemagglutinin protein with natural activity on the spore surface to prepare an oral heat-resistant vaccine. Attached Figure Description

[0019] Figure 1 For the construction of recombinant strains; Figure 2 These are the results of a fluorescence immunoassay. Figure 3 Comparison of WB results from proteinase K elution assay; Figure 4 Comparison of bacterial cell morphology under a microscope when observing the morphology of bacteria loaded with macromolecular proteins; Figure 5 This is a comparison chart of activity in the anchoring stability test; Figure 6 A comparison of spore formation rates for different expression systems; Figure 7 This is the result of a coagulation test; Figure 8 This is the result of the blood coagulation inhibition test. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments and accompanying drawings are described in further detail below. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in this field or according to the product manual.

[0021] 1. Screening and optimization of target genes: The HA gene coding sequences of the H5 subtype AIV derived from chickens, ducks, and geese were downloaded from the NCBI database. Multiple sequence alignment was performed using MEGA software to analyze conserved regions and variant sites. A phylogenetic tree was constructed based on the alignment results to determine the phylogenetic relationships between different strains. Genes located at major branch nodes of the phylogenetic tree, with complete sequences and correct coding frames, were selected as representative gene sequences. These sequences underwent codon optimization to better suit the Bacillus expression system and were then synthesized by a gene synthesis company.

[0022] 2. Selection of carrier and surface display elements: First, a free expression plasmid vector containing appropriate resistance markers and multiple cloning sites should be selected. Second, based on literature, a heterologous anchoring protein belonging to the same Bacillus species should be selected, such as the CotJB anchoring protein found in Bacillus licheniformis. Simultaneously, according to literature, a flexible linker peptide (GGGGS) that better maintains the protein's spatial conformation should be selected from the mainstream rigid linker peptides and flexible linker peptides to link the N-terminal anchoring protein and the C-terminal target protein.

[0023] Nucleotide sequence of CotJB anchoring protein (SEQ ID NO:1): gtgacgaactctttaccgcaagactattataaaaggcttcatgaaattcaggctgttgattttgtcatcgttgagctgatgctataccttgacacacatcccgatgataccgatgccatcaaacaatacaa ccagtatgccggattttccagaaaactgaaagcgaagtttgaatcaaaatacggccctttgattcaaggaagcccggatcagacggaatcctattggagctggaaaagaagtccttggccatggcaagtt.

[0024] The nucleotide sequence of the Linker flexible linker peptide (as shown in SEQ ID NO:2): ggcggcggcggcagcggcggcggcggcagcggcggcggcggcagc.

[0025] The nucleotide sequence of HA hemagglutinin protein (as shown in SEQ ID NO:3):

[0026] 3. Construction of recombinant expression vectors: The integrative vector was constructed using HA and CotJB proteins as a backbone. Two pairs of specific primers, PCL-F and LHP-F, were used to amplify upstream and downstream homologous arms (psld-1 is a shuttle plasmid, commercially available) using the linker peptide and psld-1 genome as templates, respectively. The PCR products were purified and recovered. Figure 1 As shown, two products were obtained: a vector homologous arm-Cot-linker homologous arm (fragment A) and a linker homologous arm-HA-vector homologous arm (fragment B). The psld-1 plasmid was digested for 40 min using BamHI and SmaI restriction enzymes in a 10× QuickCut Green Buffer system at 37°C to obtain a linearized vector. The product was recovered by gel extraction. Using a seamless cloning enzyme, fragments A, the linker peptide, and B were ligated to the double-digested linear plasmid at 50°C. The ligation product was transformed into E. coli JM109 competent cells. Positive clones were screened, and colony PCR was performed using primers CLHj-F and CLHj-R for verification. The PCR products were then sequenced.

[0027] PCL-F (SEQ ID NO:5): gaatgagcttacaggatccgtgacgaactctttaccgcaagact.

[0028] PCL-R (SEQ ID NO:6): gcatggtaaccaatgcaaatctgatcgctgccgccgcc.

[0029] LHP-F (SEQ ID NO:7): gcggcggcagcgatcagatttgcattggttaccatgc.

[0030] LHP-R (SEQ ID NO:8): taattaccctcccccgggttagtggtggtggtggtggtga.

[0031] CLHj-F (SEQ ID NO:9): cggcgaacaaatcgaatgagcttacaggatcc.

[0032] CLHj-R (SEQ ID NO:10): tgctcttctaattaccctcccccggg.

[0033] 4. Preparation of competent Escherichia coli cells Streak the bacterial culture on a solid LB agar plate in three zones, then invert the plate and incubate overnight at 37°C for 12 h. Isolate individual colonies from the plate and transfer them to a test tube containing 5 mL of LB liquid. Incubate overnight at 37°C with shaking for 12 h. Transfer 1 mL of the bacterial culture from the test tube to an Erlenmeyer flask containing 50 mL of LB medium. Incubate at 37°C and 220 rpm until the bacterial concentration reaches 0.2-0.4%. Transfer the bacterial culture from the flask to a 50 mL centrifuge tube, balance the liquid, and centrifuge at 4000 rpm for 15 min at 4°C to collect the bacteria. Discard the supernatant from the centrifuge tube, and pipette as much liquid as possible from the tube. Add 2 mL of CaCl2 washing buffer to fully resuspend the bacteria, then add CaCl2 washing buffer to 2 / 3 of the tube volume. Balance the liquid and centrifuge at 4000 rpm for 10 min at 4°C. Finally, discard the liquid from the tube and pipette 1 mL of the supernatant from the centrifuge tube. E. coli Gently mix the bacterial cells in the competent cell preservation solution (pre-cooled to -20°C) using a pipette. Aliquot 100 μL into each 1.5 mL centrifuge tube and freeze at -80°C.

[0034] 5. Chemical transformation and verification of plasmids: Add all the seamless clones obtained in step 3 to JM109 competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. After the ice bath, transfer to a 42°C water bath and heat shock for 45 s, then quickly transfer the tube to an ice bath for 2 min. After the ice bath again, add 900 μL of LB liquid, mix well, and incubate at 37°C with shaking at 220 rpm for 40-60 min. Take the recovered competent cells and centrifuge at 4000 rpm for 5 min. Discard most of the supernatant in the EP tube, resuspend the cells with a small amount of liquid, spread them on the corresponding antibiotic plates for the plasmid, and incubate upside down at 37°C for 12 h. On the transformed plates, multiple single colonies were picked and mixed with 10 μL of sterile water by pipetting and then spotted into 8-tube PCR systems. The PCR amplification program was set, and the mixture was heated at 95°C for 20 min to obtain the template. 1 μL of the mixture was added to a 30 μL PCR system, and positive clones were verified using universal vector primers. A small amount of PCR product was spotted onto a nucleic acid gel and subjected to nucleic acid gel electrophoresis at 170 V. After electrophoresis, the remaining PCR products of single clones with band sizes matching the expectations were sequenced. Sequencing was performed by Genewiz. Transformants with correct sequencing results were picked using a pipette in a clean bench and placed into LB broth containing kanamycin resistance. The mixture was incubated overnight at 37°C and 220 rpm in a shaker. Plasmid extraction was performed the next day, and the extracted plasmids were stored at -20°C for later use.

[0035] 6. In vitro methylation of plasmids: The integrative plasmid was transformed into EC135 competent cells carrying a methyltransferase plasmid. After transformation, the bacterial culture was plated on a double-antibiotic selection plate containing both the strain and the antibiotic carried by the integrative plasmid, and incubated overnight at 37°C for 12 h. Multiple single colonies were picked from the plate and inoculated into LB tubes containing the double-antibiotic mixture, and cultured on a shaker at 37°C until the OD value reached 0.2-0.3. In a clean bench, 80 μL of arabinose solution was added to the bacterial culture to induce methyltransferase expression, and the culture was incubated overnight at 30°C for 12-16 h. After incubation, the methylated plasmid was extracted using standard methods.

[0036] 7. Preparation of electrocompetent cells: The host bacteria were streaked from a glycerol tube to activate them onto LB agar plates and incubated upside down at 37°C for 12 h. Single colonies were isolated from the plates and transferred to test tubes containing 5 mL of LBS, and incubated overnight at 37°C and 220 rpm for 12 h. 1 mL of the bacterial culture was then transferred to an Erlenmeyer flask containing 50 mL of liquid LBS and incubated with shaking at 37°C and 220 rpm until OD (dose retardation) was reached. 600Remove the cells when the concentration reaches 0.6-0.8. Incubate on ice for 30 min, transfer to 50 mL centrifuge tubes, balance, and centrifuge at 6500 rpm for 10 min at 4°C to collect the bacteria. Discard the supernatant, add 2 mL of washing buffer to resuspend the bacteria, then add more washing buffer to 2 / 3 of the tube volume. Incubate on ice for 10 min, centrifuge at 6500 rpm for 15 min at low temperature, and repeat twice. Gently mix the bacteria with 1 mL of Bacillus subtilis competent cell preservation solution, aliquot into 80 μL tubes, and store at -80°C. Bacillus subtilis was obtained from the Institute of Microbiology, Chinese Academy of Sciences.

[0037] 8. Electrocution Conversion: Clean the electroporation cuvette using ultrapure water and ethanol as solvents. After cleaning three times each, place the cuvette upright on ice to air dry. Take 35 μL of the methylated plasmid (obtained in step 6) and gently mix it with the competent host cells. Add the entire mixture to the cuvette and incubate on ice for 5 min. After the ice bath, gently tap the cuvette to allow the mixture to settle at the bottom. Wipe the surface of the cuvette dry. After electroporation at 2500 V, quickly add 900 μL of electroporation recovery medium. Gently mix with a pipette and transfer the entire mixture to a 1.5 mL centrifuge tube. Incubate at 37°C with shaking for 3 h. After recovery, centrifuge and retain a portion of the supernatant. Resuspend the bacterial cells and plate them onto LB agar plates containing the corresponding antibiotics from the plasmid. Incubate upside down at 37°C for 14–16 h.

[0038] 9. Transformant screening and validation: The revived bacterial culture was spread onto a selective plate containing the appropriate antibiotic for Bacillus subtilis and incubated for 12 hours under suitable conditions. Single colonies were picked and subjected to colony PCR verification. Colonies of the correct length and size were sequenced. Samples with correct sequencing and no frameshift mutations were considered the completed recombinant vectors and were stored at -80°C.

[0039] 10. Fermentation Culture medium formulation LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, pH 7.0.

[0040] LB solid medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, agar powder 2 g / L, pH 7.0.

[0041] Seed culture medium: dextrin 0.1%, tryptone 0.5%, yeast extract 0.5%, Na2HPO4 0.4%, KH2PO4 0.03%, pH 7.5.

[0042] Fermentation medium: dextrin 3.0%, soybean peptone 2%, Na2HPO4 0.4%, KH2PO4 0.03%, pH 7.5.

[0043] Dispense the prepared culture medium into Erlenmeyer flasks, generally filling them no more than 20% full to ensure adequate oxygen transfer. Use 25-50 mL of medium for a 250 mL flask and 50-100 mL for a 500 mL flask. Adjust the pH of the medium to 7.0-7.4 using NaOH or HCl solution. Seal the dispensed flasks with eight layers of gauze or a breathable silicone stopper, then wrap the mouth with kraft paper or aluminum foil. Place them in an autoclave at 121°C for 20-30 minutes. After sterilization, remove the flasks and allow them to cool to room temperature in a clean bench to prevent scalding and killing of the inoculum during inoculation. Add appropriate antibiotics to LB medium and seed culture medium; do not add antibiotics to fermentation medium.

[0044] Pick a single colony from a glycerol preservation tube or streak plate and inoculate it into a test tube containing 3-5 mL of LB medium. Incubate at 37°C and 220 rpm for 12 hours. Then, inoculate the bacterial culture from the LB tube into a seed bottle at a 2% inoculation rate. Incubate on a shaker at 37°C and 220 rpm for 12-16 hours to obtain a concentrated seed culture in a stable growth phase. Finally, inoculate the seed culture again at a 2% inoculation rate into sterilized and cooled fermentation medium. Incubate at 37°C and 220 rpm for 36 hours.

[0045] 11. Fluorescent Immunoassay Obtain cell culture and centrifuge at 4,000 rpm for 5 min at 4°C. Discard the supernatant, wash three times with 500 μL sterile 1×PBS at 4°C, resuspend the cells, and centrifuge at 4,000 rpm for 5 min. Discard the supernatant and resuspend the cell pellet in 250 μL of 1×PBS, 1 mg / ml BSA, and 1 μg antibody (primary antibody). Dilute at a ratio of 500:1, use a pipette to aspirate the primary antibody, mix thoroughly, seal with sealing film, wrap with foil, and occasionally mix. Incubate on ice for 30 min, occasionally mixing. Recover the primary antibody, discard the supernatant, wash three times with 500 μL sterile 1×PBS, resuspend the cells, and centrifuge at 4,000 rpm for 5 min at 4°C. Resuspend the cells in 1×PBS, 1 mg / ml BSA, and FITC-labeled anti-mouse IgG secondary antibody, and incubate on ice in the dark for 30 min, occasionally inverting the tube. The secondary antibody was diluted to a final ratio of 1:1,000. Using a pipette, the precipitate was aspirated and thoroughly mixed. The mixture was sealed with sealing film, wrapped in aluminum foil, and incubated at 4°C for 40 min, occasionally inverting to mix. The secondary antibody was recovered, the supernatant was discarded, and the cells were washed three times with 500 μL of sterile 1×PBS. The cells were resuspended and centrifuged at 4,000 rpm for 5 min at 4°C. The cells were resuspended in 40 μL of 1×PBS, and 5–10 μL was spotted onto a glass slide and covered with a coverslip for microscopic observation under UV light.

[0046] Fluorescent immunoassays can be used to determine the anchoring proteins of Bacillus subtilis itself, such as... Figure 2 As shown, recombinant Bacillus subtilis using heterologous anchoring proteins exhibits higher expression levels of HA protein.

[0047] 12. Western Blot experiment and proteinase K digestion experiment Transfer the cell culture to a 1.5 mL centrifuge tube, add 500-600 μL of lysis buffer containing SDS and EDTA and 10-20 μL of proteinase K stock solution (usually 20 mg / mL), and vortex thoroughly to mix. Then incubate the reaction tube at 50-60°C (water bath or metal bath) for 1-3 hours or overnight, depending on the density of the tissue. During incubation, shake intermittently to promote enzyme-substrate contact, until the solution becomes clear and transparent.

[0048] Mix 20 μL of sample with 5 μL of 5×Loading Buffer in a 1.5 mL centrifuge tube until homogeneous. Seal the tube and place it in a boiling water bath for denaturation for 5 min. Then place the gel in the electrophoresis tank. To prevent air bubbles, slowly add electrophoresis buffer along the tank wall until the gel is submerged. Carefully and vertically remove the comb and accurately add 5-10 μL of sample solution using a pipette. Set the electrophoresis apparatus according to the instructions, selecting 80 V as the initial voltage. Once all samples have migrated into a single, neat line (the boundary between the stacking and separating gels), set the voltage to 120 V for electrophoresis. Stop electrophoresis when the bromophenol blue from the loading gel reaches 5 mm from the bottom of the gel plate. This indicates that all samples have migrated. After electrophoresis, the gel was slowly separated from the gel casting plate under running water, and the gel was flushed into the gel container. Ultrapure water was poured in to cover the gel, and the mixture was microwaved until boiling for 15-30 seconds. The ultrapure water was then removed, and Coomassie Brilliant Blue rapid staining solution was applied. The mixture was microwaved until boiling for 15-30 seconds and then incubated for 30 minutes. After staining, the staining solution was discarded, and then excess ultrapure water was added to cover the gel. Destaining was promoted by shaking on a shaker. The ultrapure water was changed every 2 hours during the destaining process. Finally, the gel was stored in ultrapure water.

[0049] After starting SDS-PAGE electrophoresis, pre-chill 1× transfer buffer at -20°C. After electrophoresis, transfer the gel to the transfer electrophoresis tank and incubate at a constant current of 200 mA for 50 min to transfer proteins onto the NC membrane. Place the NC membrane in an incubation chamber, pour in 1×TBST to cover the membrane, and wash on a destaining shaker. Wash for 5 min initially, then repeat three times, increasing the washing time by 5 min each time. Use 5% skim milk powder as blocking buffer and treat the NC membrane at 22-25°C for 60 min. After blocking, wash the NC membrane with 1×TBST. Incubate the NC membrane overnight at 4°C using a mouse anti-HIS tag primary antibody conjugated with HRP (pre-diluted to a specific ratio according to the instructions). Wash the NC membrane with 1×TBST after incubation. Dilute the ECL luminescence detection working solution according to the instructions, and evenly drop the diluted solution onto the band positions. Observe the results using a chemiluminescence imaging system.

[0050] like Figure 3 As shown, after treatment with proteinase K, the fluorescence of exogenous spores decreased, indicating that the protein was anchored on the outside and well displayed on the surface; while the fluorescence of endogenous spores did not decrease significantly. This suggests that heterologous anchoring significantly increases the surface exposure rate of exogenous proteins and reduces steric hindrance.

[0051] 13. Load test like Figure 4As shown, traditional Cot proteins can only attach proteins of small to medium molecular weight (<50 kDa). Once large proteins are attached, the spores cannot complete mitosis due to excessive load, resulting in poor spore growth and entanglement of the spore structure. This invention effectively alleviates the damage to the spores caused by displaying large molecules on the spore surface.

[0052] Example 2 Anchoring stability test.

[0053] Intrinsic and exogenous spores were suspended in high ionic strength buffer (1 M NaCl) and surfactant solution (1% Triton X-100), respectively, and incubated at 37°C with vigorous shaking at 200 rpm for 60 minutes to simulate the mechanical shearing and chemical cleaning environment in industrial processes. After treatment, the spore precipitate was recovered by centrifugation at 12,000 rpm and resuspended in PBS buffer. The residual enzyme activity was measured and compared with the initial enzyme activity of untreated spores. The experimental results showed that after treatment with 1 M NaCl and 1% Triton X-100, the residual activity of the control group spores decreased significantly to 45% and 32% due to severe detachment of surface proteins through weak electrostatic interactions. In contrast, the heterologous Cot display system of this invention showed significantly superior stability under the same harsh conditions, with residual activities maintained at 62% and 56%, respectively. Figure 5 As shown.

[0054] The antigen is immobilized on the spores, which act as adjuvant carriers and are completely phagocytosed by the antigen-presenting cells, triggering a strong immune response. The better the residual activity, the better the resulting immune response. This result confirms that although vigorous washing leads to the loss of some target proteins, the heterologous Cot protein described in this invention still significantly improves the loss problem and delivery stability in industrial applications.

[0055] Example 3 Spore counting experiment.

[0056] Wild-type Bacillus subtilis, engineered bacteria with endogenous protein, and engineered bacteria expressing the heterologous protein of this invention were inoculated into 2×SG sporulation medium and cultured at 37°C and 200 rpm for 48 hours to induce sporulation. After fermentation, the fermentation broth was treated in an 80°C water bath for 20 minutes to completely kill vegetative cells, leaving only heat-resistant mature sporulations. The broth was then serially diluted and spread on LB agar plates. After overnight incubation at 37°C, colony counts (CFU / mL) were performed.

[0057] like Figure 6 As shown, the data for this product are significantly higher than the control, which proves that your heterologous Cot protein is less toxic to host cells or has less conflict with the assembly process of the spore coat.

[0058] Example 4 Blood coagulation test.

[0059] Healthy, non-immunized adult roosters (SPF grade) were selected, and blood was collected via the subpterygoid vein. The blood was mixed with Alderman's solution at a 1:4 ratio for anticoagulation. The anticoagulated blood was transferred to centrifuge tubes, and sterile PBS buffer (0.01 M, pH 7.2) was added and gently mixed. The mixture was centrifuged at 2000 rpm for 5 min. The supernatant and the thin layer of white blood cells on the surface of the precipitate were aspirated, retaining the lower layer of red blood cells. This washing step was repeated 3-4 times until the supernatant after centrifugation was clear and transparent, with no hemolysis observed. The compressed red blood cells obtained from the last centrifugation were collected and resuspended in sterile PBS buffer at a 1:99 (v / v) ratio to prepare a 1% chicken red blood cell suspension. The suspension was stored at 4°C and used within 3 days.

[0060] The assay was performed using a 96-well V-type microplate. 25 μL of PBS buffer was added to each well from well 1 to well 12. 25 μL of purified recombinant spore suspension was added to well 1, mixed by pipetting, and then transferred to the next well. This process was repeated serially up to well 11, with 25 μL discarded from well 11. Well 12 served as a negative control for red blood cells (containing only PBS). Subsequently, 25 μL of 1% chicken red blood cell suspension was added to each well, and the mixture was stirred using a microplate shaker for 1 min. The plate was incubated at room temperature (25°C) for 30–45 min until the red blood cells in the control wells had completely settled. The plate was tilted at 45° for observation. If the red blood cells covered the bottom of the well and formed a uniform thin layer without any surface flow, it was considered complete agglutination. If the red blood cells settled to the bottom of the well in a dense, round dot pattern and flowed like teardrops when tilted, it was considered non-agglutination. The hemagglutination titer of the recombinant sample is defined as the highest dilution that causes 100% complete agglutination of red blood cells.

[0061] like Figure 7 As shown, the results exhibited high consistency across all dilution gradients, with smooth edges on the agglutination patterns at the bottom of the wells, demonstrating the stability of the detection system and the uniformity of purified protein quality. Red blood cells completely settled in wells 7 and beyond, with clear boundaries from preceding agglutination wells, effectively eliminating interference from non-specific agglutination. In summary, these hemagglutination assay data not only confirm the successful preparation of highly active recombinant hemagglutinin protein in this study, but also indicate that its high hemagglutination titer suggests that the antigen can effectively expose neutralizing epitopes, providing a reliable material basis and dosage reference for subsequent hemagglutination inhibition assays and animal immune evaluation.

[0062] Example 5 Coagulation inhibition test.

[0063] Standardization of hemagglutinin working solution: Serially dilute the hemagglutinin working solution twofold with PBS. Add an equal volume of PBS to the serum volume used in the inhibition test, followed by 1% chicken erythrocyte suspension. Mix the 96-well disposable reaction plate on a shaker and incubate at 25°C for 20 minutes. The result is determined when the erythrocytes in the control wells show a distinct button-like appearance. The highest dilution that causes complete erythrocyte agglutination is used as the endpoint. The immune serum to be tested was pretreated by inactivating it in a 56°C water bath for 30 min to remove complement interference. Based on the antigen titer determined by the HA assay, the recombinant spore antigen was diluted with PBS to a working concentration of 4 hemagglutination units. In a 96-well V-type microplate, 25 μL of PBS was added to wells 1-11, and 25 μL of pretreated serum was added to well 1 and serially diluted to well 10. 25 μL of the prepared 4 HAU recombinant spore antigen solution was added to wells 1-10 (serum dilution wells) and well 11 (positive control well), and 25 μL of PBS was added to well 12 as a red blood cell control. After vortexing and mixing, the mixture was incubated at room temperature for 30 min to allow for sufficient antigen-antibody binding. Then, 25 μL of 1% chicken red blood cell suspension was added to all wells, mixed, and incubated at room temperature for 30-40 min. When determining the results, the highest serum dilution factor in which dense, round precipitates of red blood cells appear, indicating complete inhibition of red blood cell agglutination, is used to determine the hemagglutination inhibition titer of the serum. If sheet-like agglutination appears at the bottom of the well, it indicates that the serum antibody level is insufficient to inhibit the viral coagulation activity.

[0064] like Figure 8 As shown, the inhibition endpoints of homologous samples were distributed in wells 7 and 8. If calculated using serial dilutions at an initial dilution of 1:2, the hemagglutination inhibition titer of the samples was between 2. 7 (1:128) and 2 8 The inhibition endpoint for heterologous samples was between 1:256, while the inhibition endpoint for heterologous samples was located in wells 9 and 10, with titers between 2. 9 (1:512) and 2 10 Between 1 and 1024, the titer of heterologous samples was significantly higher than that of homologous samples, which also proves that the amount of protein expressed by heterologous expression samples is higher than that expressed by homologous expression, showing a clear advantage.

[0065] Where there is no conflict, the above embodiments and features described herein can be combined with each other.

[0066] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing Bacillus subtilis based on the CotJB protein of Bacillus licheniformis, characterized in that, Includes the following steps: Obtain the nucleotide sequence of the heterologous anchoring protein CotJB of Bacillus licheniformis, as shown in SEQ ID NO:1; the nucleotide sequence of the flexible linker peptide, as shown in SEQ ID NO:2; and the nucleotide sequence of the HA hemagglutinin protein, as shown in SEQ ID NO:

3. A linearized vector with HA protein and CotJB protein as its backbone was constructed. The linearized vector was introduced into the first host bacterium, and the integration plasmid was extracted to obtain the recombinant expression vector; The recombinant expression vector was transformed into a second host bacterium carrying a methyltransferase plasmid, and the methylated plasmid was extracted. The methylated plasmid was introduced into competent Bacillus subtilis cells, and Bacillus subtilis mediated by Bacillus licheniformis CotJB protein was screened to obtain Bacillus subtilis.

2. The construction method according to claim 1, characterized in that, The construction process of the recombinant expression vector is as follows: using linker peptides and psld-1 Using the genome as a template, PCR amplification was performed using specific primer pairs. After purification and recovery, fragments A and B were obtained. Fragment HA is the vector homologous arm-Cot protein-linker peptide homologous arm, and fragment B is the linker peptide homologous arm-HA protein-vector homologous arm. The psld-1 plasmid was double-digested with restriction endonucleases to obtain the linearized vector fragment. Under the action of a seamless cloning enzyme, fragments A, the linker peptide fragment, and fragment B were ligated to the linearized vector to construct the recombinant expression vector.

3. The construction method according to claim 2, characterized in that, The primer pair used for amplifying fragment A is PCL-F and PCL-R, and the primer pair used for amplifying fragment B is LHP-F and LHP-R. The nucleotide sequence of PCL-F is shown in SEQ ID NO:5, the nucleotide sequence of PCL-R is shown in SEQ ID NO:6, the nucleotide sequence of LHP-F is shown in SEQ ID NO:7, and the nucleotide sequence of LHP-R is shown in SEQ ID NO:

8.

4. The construction method according to claim 2, characterized in that, The first host bacterium was Escherichia coli competent cells JM109.

5. The construction method according to claim 2, characterized in that, The second host bacterium was Escherichia coli competent cells EC135.

6. A recombinant Bacillus subtilis obtained by the method of any one of claims 1-5.

7. A spore surface display system, characterized in that, include: The system utilizes the endogenous anchoring protein CotJB derived from Bacillus licheniformis as a carrier to fuse and express the exogenous target protein and anchor it to the spore surface; the amino acid sequence of the CotJB protein is shown in SEQ ID NO: 4, or a derived sequence that has more than 90% homology with SEQ ID NO: 4 and retains the anchoring function, and the exogenous target protein is HA hemagglutinin protein.

8. The use of the recombinant Bacillus subtilis as described in claim 6 or the spore surface display system as described in claim 7 in the preparation of recombinant hemagglutinin protein.

9. The application according to claim 8, characterized in that, The recombinant hemagglutinin protein is used to prepare reagents for the hemagglutination inhibition test.

10. The application according to claim 8, characterized in that, The recombinant hemagglutinin protein is used to prepare antigen preparations for animal immune evaluation.