A method for transforming cinnamon transgenic hairy root mediated by agrobacterium rhizogenes

Abstract

This invention discloses a method for transforming cinnamon into transgenic hairy roots mediated by Agrobacterium rhizogenes, belonging to the field of plant genetic engineering technology. The method includes the following steps: (1) using sterile cinnamon seedlings as explants, preparing an Agrobacterium rhizogenes inoculum for infection, and immersing the explants in the inoculum for infection treatment; (2) co-culturing the infected explants, then transferring them to an antibacterial culture medium for further culture to induce hairy roots; (3) screening and identifying the induced hairy roots to obtain transgenic hairy roots. This invention utilizes rootless sterile cinnamon seedlings as explants, which is convenient to obtain. Using these explants as hairy root induction materials can shorten the induction period and increase the induction rate. The transgenic hairy root system established by this invention lays the foundation for future analysis of cinnamon gene function; at the same time, it also provides stable materials for subsequent induction of complete transgenic regenerated plants using hairy roots.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a method for transforming cinnamon transgenic hairy roots mediated by Agrobacterium rhizogenes. Background Technology

[0002] Cinnamon( Cinnamomum cassia Cinnamon (Cinnamomum cassia) is an evergreen tree belonging to the Lauraceae family. It thrives in warm, humid environments with no frost or snow, frequent fog, and ample sunshine, at altitudes of 500-3000 m and annual rainfall exceeding 1500 mm. It prefers acidic, fertile sand dunes or slopes rich in phosphorus and potassium, formed from weathered rocks. As an important tree species with both medicinal and economic value, cinnamon is native to the Malay Archipelago, parts of Vietnam, and Guangdong and Guangxi provinces in my country. It is now widely cultivated in tropical and subtropical regions of Asia, including Sri Lanka, southern India, and my country, and has a long history of use.

[0003] Cinnamon has diverse and prominent uses. It is a common seasoning in the daily chemical and food industries, and also a traditional Chinese medicine. The use of its original plant in my country dates back over 2000 years. Classic medical texts such as the *Shennong Bencao Jing*, *Bencao Gangmu*, *Tang Bencao*, and *Han Shi Yi Tong* record its pungent and sweet taste, its extremely hot nature, and its connection to the kidney, spleen, heart, and liver meridians. It is believed to have the effects of guiding fire back to its source, dispelling cold and relieving pain, tonifying fire and assisting yang, and promoting blood circulation and menstruation. It is renowned as "Ginseng in the North and Cinnamon in the South." As a major producer and exporter of cinnamon, my country ranks first in the world in the export of cinnamon oil and cinnamon bark, accounting for over 80% of global production, and occupies an important position in the international medicinal materials trade.

[0004] In recent years, global demand for natural active ingredients has continued to rise, and the market demand for cinnamon has increased year by year. However, at the same time, the problem of cinnamon strain degradation has become increasingly prominent. Cultivating high-quality and high-yield cinnamon varieties / strains has become the key to breaking through industry bottlenecks and promoting industry upgrading. Efficient genetic transformation technology is the core support for realizing the analysis of cinnamon gene function and genetic improvement. Establishing a stable cinnamon genetic transformation system has strong practical necessity and industrial value.

[0005] Agrobacterium rhizogenes-mediated hairy root transformation technology can efficiently induce transgenic roots in plants. The exogenous gene is stably integrated into the host plant genome via the T-DNA of the Ri plasmid. The induced hairy roots retain both the morphological characteristics of plant roots and possess good genetic stability, making it a convenient approach for studying root-specific gene expression and elucidating the biosynthetic mechanisms of secondary metabolites. Due to its ease of operation, high transformation efficiency, and excellent genetic stability, this technology has been successfully applied to various herbaceous and semi-woody plants. However, its applicability exhibits significant species specificity, especially in woody plants, where transformation efficiency generally decreases drastically, becoming a significant factor restricting gene function research and genetic improvement in woody plants.

[0006] The inherent biological characteristics of cinnamon make it an extremely challenging plant material for genetic transformation, further complicating technological breakthroughs. On one hand, cinnamon is rich in phenolic compounds and essential oil secondary metabolites, which readily undergo browning reactions during mechanical damage or in vitro culture. These browning products significantly inhibit the infection efficiency of Agrobacterium and the stable integration of exogenous genes. On the other hand, cinnamon stem segments have a high degree of lignification and strong cell differentiation capacity, resulting in extremely low sensitivity to Agrobacterium rhizogenes, rendering existing transformation methods ineffective for efficient transformation.

[0007] The core parameters of existing plant hairy root induction technologies are mostly established based on herbaceous plants or easily transformable materials, exhibiting extremely high adaptability. However, directly applying these technologies to cinnamon fails to yield stable transgenic hairy roots, resulting in extremely low transformation efficiency. To date, there are no publicly available reports, either domestically or internationally, on achieving stable genetic transformation of cinnamon plants through Agrobacterium rhizogenes-mediated transformation. Research related to cinnamon hairy root induction is also lacking, severely hindering the progress of cinnamon gene function analysis, secondary metabolic engineering development, and variety genetic improvement. A breakthrough in these technological bottlenecks is urgently needed.

[0008] In summary, developing an efficient and stable system for inducing and genetically transforming cinnamon stem hairy roots is not only an urgent need to solve the transformation problems caused by the inherent characteristics of cinnamon and fill related technological gaps, but also a key measure to support cinnamon gene function research, promote the cultivation of high-quality and high-yield varieties, and help the industry achieve high-quality development. It can provide a solid technical foundation for cinnamon secondary metabolism engineering and genetic improvement. Summary of the Invention

[0009] The purpose of this invention is to provide a method for transforming cinnamon hairy roots mediated by Agrobacterium rhizogenes, in order to solve the problems existing in the prior art.

[0010] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is a method for Agrobacterium rhizogenes-mediated transformation of cinnamon transgenic hairy roots, comprising the following steps: (1) Using sterile cinnamon seedlings as explants, prepare a bacterial solution of Agrobacterium rhizogenes for infection, and immerse the explants in the bacterial solution of Agrobacterium rhizogenes for infection treatment; (2) The infected explants were co-cultured and then transferred to an antibacterial culture medium to induce the production of hairy roots; (3) Screen and identify the induced hairy roots to obtain transgenic hairy roots.

[0011] Based on the above technical solution, the present invention has the following technical effects: (1) The present invention uses cinnamon rootless sterile seedlings as explants, which are easy to obtain. Using these explants as hairy root induction materials can shorten the induction period and increase the induction rate. (2) The transgenic hairy root system established by this invention lays the foundation for future analysis of cinnamon gene function; at the same time, it also provides stable material for subsequent use of hairy roots to induce complete transgenic regeneration plants. Attached Figure Description

[0012] Figure 1 This invention relates to a method for obtaining sterile seedlings through Agrobacterium rhizogenes-mediated transformation of cinnamon transgenic hairy roots.

[0013] Figure 2 This invention relates to a method for transforming cinnamon into hairy roots mediated by Agrobacterium rhizogenes, resulting in hairy roots.

[0014] Figure 3 This invention relates to a method for Agrobacterium rhizogenes-mediated transformation of cinnamon transgenic hairy roots. GFP Expression status. Among them, A represents GFP expression under 488nm excitation light flashlight illumination; B represents GFP expression in hairy roots under an upright fluorescence microscope.

[0015] Figure 4 This invention relates to a method for Agrobacterium rhizogenes-mediated transformation of cinnamon hairy roots, and PCR detection of transgenic hairy roots. Wherein, CK is the wild-type negative control, - represents ultrapure water with no target band; + represents... GFP Plasmids 1-6 are transgenic hairy roots with target bands, indicating they are transgenic positive.

[0016] Figure 5 A schematic diagram of the Agrobacterium infection process for rootless aseptic cinnamon seedlings. After removing the roots of the rootless aseptic cinnamon seedlings, the stem base was pierced and the material was immersed in bacterial solution; then vacuum infection was performed to ensure that the bacterial solution fully entered the tissue; after vacuuming, shaker counterstaining was performed, and then the seedlings were transferred to co-culture medium and antibacterial culture medium for culture, finally obtaining GFP-positive hairy roots. Detailed Implementation

[0017] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0018] This invention provides a method for Agrobacterium rhizogenes-mediated transformation of cinnamon transgenic hairy roots, comprising the following steps: (1) Using sterile cinnamon seedlings as explants, prepare a bacterial solution of Agrobacterium rhizogenes for infection, and immerse the explants in the bacterial solution of Agrobacterium rhizogenes for infection treatment; (2) The infected explants were co-cultured and then transferred to an antibacterial culture medium to induce the production of hairy roots; (3) Screen and identify the induced hairy roots to obtain transgenic hairy roots.

[0019] In some specific implementations, the Agrobacterium rhizogenes mentioned in step (1) is strain MSU440.

[0020] In some specific implementation schemes, the infection treatment method described in step (2) is: to perform trauma treatment and vacuum infiltration treatment on the explant.

[0021] In some specific implementations, the method of wound treatment is as follows: puncturing the wound at the base of the explant stem using a sterile needle; The vacuum permeation treatment method is as follows: immerse the explant in the bacterial solution, apply vacuum for 40-60 minutes, and let it stand for 3-10 minutes after the vacuum is released.

[0022] In some specific implementations, the OD of the Agrobacterium rhizogenes bacterial solution used for infection... 600 The value is 0.6-1.0; the resuspension of the Agrobacterium rhizogenes culture used for infection contains acetylsuccinone.

[0023] In some specific implementations, the co-culture temperature is 20-25℃, the co-culture time is 2-4 days in the dark and 3-5 days in normal light; the co-culture medium contains acetylsuccinone.

[0024] In some specific embodiments, the antibacterial culture medium contains termethin; the culture in the antibacterial culture medium is a dark culture.

[0025] In some specific implementation schemes, the germination medium for explants consists of 4.4 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, and pH 5.8.

[0026] In some specific implementation schemes, the components for preparing the resuspension of Agrobacterium rhizogenes for infection are 2.2 g / L MS dry powder, 30 g / L sucrose, 100 μM / L acetylsylgenone, and pH=5.8.

[0027] In some specific implementations, the co-culture medium consists of 2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 100 μM / L acetylsylgenone, and pH 5.8.

[0028] In some specific embodiments, the antibacterial culture medium consists of 2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 200 mg / L termethin, and pH 5.8.

[0029] Example 1 Step 1: Wash the cinnamon fruits, peel off the pericarp and pulp, wash the seeds with detergent, rinse under running water for 24 hours, dehydrate the seeds with 95% ethanol for 30 seconds, transfer them to a clean bench, and disinfect the seed surface with 75% alcohol for 3 minutes. Then, immerse the seeds in a 20% sodium hypochlorite solution for 20 minutes for disinfection. Rinse the seeds 4-5 times with sterile ultrapure water. After disinfection, sow the seeds in tissue culture bottles containing germination medium. After incubating the tissue culture bottles in the dark for 10 days, place them in an environment of 25℃ with a light / dark cycle of 16 / 8 hours for 30 days to obtain sterile cinnamon seedlings.

[0030] The germination medium consisted of 4.4 g / L MS dry powder, 30 g / L sucrose, and 7 g / L agar, with a pH of 5.8.

[0031] Step 2: Select those containing pC1305: 35S GFP The plasmid-derived Agrobacterium rhizogenes strain MSU440 was inoculated into TY liquid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and cultured at 28°C for 16 h. The culture was then incubated with shaking at 200 rpm until OD... 600 =0.8 ~ 1.0, centrifuge at 6000 rpm for 10 min at room temperature, collect the supernatant under aseptic conditions, resuspend the bacterial cells in fresh resuspension, and adjust the bacterial concentration to OD0.8. 600 =0.8, and let stand in the dark at 4℃ for 30 min to obtain the MSU440 infection solution for infecting explants, which is ready for use.

[0032] The resuspension consisted of 2.2 g / L MS dry powder, 30 g / L sucrose, and 100 μM / L acetylsylgenone, with a pH of 5.8.

[0033] The method for constructing the recombinant expression vector pCAMBIA1305-SLGFP in this invention is as follows: Using the pCAMBIA1305 vector as a backbone, it was double-digested with restriction endonucleases Sal I and Kpn I to remove... GUS Gene expression cassettes, recovering large linearized fragments. SLGFPUsing the gene as a template, its sequence is shown in SEQ ID NO.1. PCR amplification was performed using specific primers SLGFP-F and SLGFP-R to obtain the SLGFP gene fragment with homologous arms. The amplified fragment was ligated to a linearized vector using homologous recombinase to construct a recombinant plasmid. The ligation product was transformed into *E. coli* DH5α competent cells. After antibiotic selection and colony PCR identification, positive clones were obtained, and the plasmid was extracted and sequenced to verify the correct recombinant expression vector pCAMBIA1305-SLGFP. This plasmid was transformed into *Agrobacterium rhizogenes* MSU440 competent cells. After antibiotic selection and colony PCR identification, positive *Agrobacterium* strains were obtained and stored at -80℃ for later use.

[0034] SEQ ID NO.1:

[0035] Step 3: Immerse the obtained cinnamon rootless sterile seedlings in Agrobacterium rhizogenes solution used for infecting explants, place them in a vacuum instrument to vacuum for 60 min, let them stand for 5 min, and then infect them in a shaker at 220 rpm for 10 min.

[0036] Step 4: In a clean bench, use sterile filter paper to remove excess bacterial solution from the explants from Step 3, transfer them to a co-culture medium, co-culture at 22°C in the dark for 3 days, then transfer them to normal light for 4 days to obtain infected explants.

[0037] The co-culture medium consisted of 2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, and 100 μM / L acetylsalicylic acid, with a pH of 5.8.

[0038] Step 5: After infection, the explants are transferred to an antibacterial culture medium and cultured at 25°C in the dark until roots develop. Figure 2 As shown.

[0039] The antibacterial culture medium consisted of 2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 200 mg / L termethin, and pH 5.8.

[0040] Step Six: Observe the fluorescence excited by the fluorescent protein using a 488nm fluorescent flashlight and an upright fluorescence microscope. Based on the control, confirm that the hair roots are transgenic positive. (Specific details are as follows...) Figure 3 As shown, the transformed hairy roots exhibited GFP fluorescence expression; while the untransformed natural roots, serving as a negative control, did not show green GFP fluorescence.

[0041] Step 7: Extract RNA using the Novizan FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics-rich). RNA reverse transcription experiment.

[0042] Primer sequences used in PCR testing: GFP-F (SEQ ID NO.2):ATTAGATGGTGATGTTAATGGGCAC; GFP-R (SEQ ID NO. 3): AGCTGTTACAAACTCAAGAAGGACCATGTG.

[0043] The PCR reaction conditions are as follows: Pre-denaturation at 95℃ for 3 min; 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 15 s, 34 cycles; final extension at 72℃ for 5 min.

[0044] After the PCR reaction was completed, the PCR products were detected by agarose gel electrophoresis. The results are as follows: Figure 4 As shown: CK is the wild-type negative control; - represents ultrapure water with no target band; + represents... GFP Plasmids 1-6 are transgenic hairy roots, showing the target band, indicating transgenic positivity, further proving that the exogenous gene was successfully integrated into the genome of the transformed hairy roots.

[0045] This invention employs the above-mentioned Agrobacterium rhizogenes-mediated transformation method for transgenic hairy roots of cinnamon, directly using sterile cinnamon seedlings as explants. This method is convenient for obtaining materials, reduces the cost of equipment, and makes experimental procedures easy to perform in ordinary laboratories. Furthermore, it is characterized by a short cycle and high efficiency. The established transgenic hairy root system lays the foundation for the future discovery of superior genes in cinnamon and provides a large amount of raw materials for the extraction of medicinal active ingredients from cinnamon using hairy root technology.

[0046] Example 2 Step 1: Preparation of sterile vaccine, same as Step 1 in Example 1.

[0047] Step 2: Pick out the items containing... pC1305:35S GFP Different Agrobacterium rhizogenes strains (K599, C58C1, MSU440, and Ar.Qual) containing plasmids were inoculated into TY liquid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, respectively, and cultured at 28°C with shaking at 200 rpm until OD. 600 ≈ 0.8 - 1.0. Take the bacterial culture, centrifuge at 6000 rpm for 10 min at room temperature, discard the supernatant, resuspend the bacterial cells in resuspending buffer (2.2 g / L MS dry powder, 30 g / L sucrose, 100 μM / L acetylsylgenone, pH=5.8), and adjust the bacterial concentration to OD. 600 = 0.8, and incubated in the dark at 4℃ for 30 min to obtain infection solutions of different strains.

[0048] Step 3: Take 15 rootless sterile cinnamon seedlings from each group and immerse them in 100 mL of the corresponding bacterial strain's infection solution. After vacuum treatment for 50 min, let stand for 5 min, and then infect in a shaker at 220 rpm for 10 min. Blot dry the bacterial solution with sterile filter paper and transfer to co-culture medium (2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 100 μM / L acetylsylgenone, pH=5.8). Incubate in the dark at 22℃ for 3 days, followed by incubation under normal light for 4 days.

[0049] Step 4: Transfer the co-cultured explants to antibacterial medium (2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 200 mg / L termethin, pH=5.8) and incubate in the dark at 25°C until hairy roots emerge.

[0050] Step 5: Observe GFP expression using a 488 nm excitation fluorescent flashlight and an upright fluorescence microscope, and calculate the transgene positivity rate for each strain group. Extract RNA from hairy roots, reverse transcribe it, and then perform PCR verification (primers are the same as in Example 1).

[0051] The results showed that MSU440 had a better positive expression level, reaching 53.33%, which was superior to other strains.

[0052] In this embodiment, MSU440 is the most suitable Agrobacterium rhizogenes strain for the transformation of cinnamon hairy roots, and its transformation efficiency is significantly higher than that of other tested strains.

[0053] Example 3 Step 1: Preparation of sterile vaccine, same as Step 1 in Example 1.

[0054] Step 2: Prepare Agrobacterium rhizogenes bacterial suspension for infection, as in Step 2 of Example 2, and use the MSU440 strain. Adjust the bacterial suspension concentration to OD. 600 = 0.8.

[0055] Step 3: Treat cinnamon rootless aseptic seedlings using four different infection methods, with 15 seedlings treated in each group: (1) Method A (injection method): Use a 1 mL sterile syringe needle to randomly prick 5-8 wounds at the base of the plant stem, then use the same syringe to draw up the bacterial solution and inject about 100 μL from the wound.

[0056] (2) Method B (soaking for 20 hours after puncture): Use a sterile needle to randomly puncture 3-5 wounds at the base of the plant stem, and then completely immerse the base of the stem in 100 mL of the infecting bacterial solution and soak in a dark incubator at 22℃ for 20 hours.

[0057] (3) Method C (immersion in 100 mL of bacterial solution after vacuuming): Immerse the base of the plant stem in 100 mL of bacterial solution, vacuum for 50 min, and after the vacuum is released, continue to immerse the explant in bacterial solution and immerse in a dark incubator at 22℃ for 20 h.

[0058] (4) Method D (control method, same as Example 2): Use a sterile needle to randomly prick 5-8 wounds at the base of the plant stem, then completely immerse the base of the stem in 100 mL of infection solution, vacuum process for 50 minutes, and let stand for 5 minutes. Infect in a shaker at 220 rpm for 10 minutes.

[0059] Step 4: After infection treatment, use sterile filter paper to absorb excess bacterial solution from the surface of explants in each treatment group, and transfer them to co-culture medium (2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 100 μM / L acetylsylgenone, pH=5.8). Incubate in the dark at 22℃ for 3 days, then switch to normal light (light / dark cycle 16 / 8 h) for 4 days.

[0060] Step 5: Transfer the explants from each treatment group after co-culture to antibacterial medium (2.2 g / L MS dry powder, 30 g / L sucrose, 7 g / L agar, 200 mg / L termethin, pH=5.8), and incubate in the dark at 25℃ until hairy roots emerge. Record the survival and rooting status of the explants regularly.

[0061] Step 6: Observe the expression of GFP in the grown adventitious roots using a 488 nm excitation fluorescent flashlight and an upright fluorescence microscope, and count the transgene positivity rate of each infection method group. Extract RNA from positive hairy root samples, reverse transcribe, and then perform PCR verification (primers are the same as in Example 1).

[0062] The results show that: Method D (vacuuming for 50 min + standing for 5 min) resulted in high plant survival rate, good hairy root induction, and transgenic positivity rate consistent with the results of Example 2.

[0063] Method A (injection method) has extremely low exogenous gene transformation efficiency, with almost no GFP fluorescence signal detected and a positive rate close to 0%.

[0064] Method B (soaking for 20 hours after puncture) and Method C (soaking for 20 hours after vacuuming) both resulted in the proliferation of Agrobacterium in the explants during the later stages of co-culture. The subsequent inhibition phase could not completely suppress the bacteria, leading to severe browning and death of the plants, with a survival rate significantly lower than other methods.

[0065] Conclusion: In this experimental system, the optimal infection method (Method D) is to puncture the stem base with a needle, immerse the wound in bacterial solution, and then perform a short-term vacuum treatment (50 minutes) followed by static incubation (5 minutes). This method ensures sufficient contact between Agrobacterium and the explant while avoiding the problems of excessive bacterial proliferation or low transformation efficiency caused by prolonged immersion or injection methods. It is a key technical step in achieving efficient and stable transgenic hairy root induction in cinnamon.

[0066] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for Agrobacterium rhizogenes-mediated transformation of cinnamon transgenic hairy roots, characterized in that, Includes the following steps: (1) Using sterile cinnamon seedlings as explants, prepare a bacterial solution of Agrobacterium rhizogenes for infection, and immerse the explants in the bacterial solution of Agrobacterium rhizogenes for infection treatment; (2) The infected explants were co-cultured and then transferred to an antibacterial culture medium to induce the production of hairy roots; (3) Screen and identify the induced hairy roots to obtain transgenic hairy roots.

2. The method according to claim 1, characterized in that, The Agrobacterium rhizogenes mentioned in step (1) is strain MSU440.

3. The method according to claim 1 or 2, characterized in that, The infection treatment method described in step (2) is to perform wound treatment and vacuum infiltration treatment on the explant.

4. The method according to claim 3, characterized in that, The method for treating the wound is as follows: puncture the wound at the base of the explant stem using a sterile needle; The vacuum permeation treatment method is as follows: immerse the explant in the bacterial solution, apply vacuum for 40-60 minutes, and let it stand for 3-10 minutes after the vacuum is released.

5. The method according to claim 1, characterized in that, The OD of the Agrobacterium rhizogenes bacterial solution used for infection 600 The value is 0.6-1.0; the resuspension of the Agrobacterium rhizogenes culture used for infection contains acetylsuccinone.

6. The method according to claim 1, characterized in that, The co-culture temperature is 20-25℃, and the co-culture time is 2-4 days in the dark and 3-5 days under normal light. The co-culture medium contains acetylsuccinone.

7. The method according to claim 1, characterized in that, The antibacterial culture medium contains termethin; the culture in the antibacterial culture medium is a dark culture.

Images