Cotton seed vigor trait associated gene ghfla2 and application thereof

Abstract

The application discloses a kind of similar bundle-like arabino-galactoside protein coding gene GhFLA2 In the application of regulating cotton seed vigor, the application obtains several overexpression materials, RNA interference materials and gene knockout materials by transgenic technology GhFLA2 It is found that overexpression GhFLA2 Can promote radicle elongation during seed germination and cotyledon unfolding after germination, GhFLA2 After the expression amount of the application is reduced or knocked out, radicle elongation and cotyledon development are inhibited.The application provides a new gene target for cotton seed vigor improvement.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology applications, specifically relating to plant genetic engineering breeding technology, and particularly to a cotton-like bundle-like arabinogalactosamine protein encoding gene. GhFLA2 Its application in regulating seed vigor and its breeding methods. Background Technology

[0002] Cotton is an important economic crop in my country, and its seed vigor directly affects seedling uniformity, emergence rate, seedling robustness, and stress resistance. In production, highly vigorous seeds can germinate quickly and uniformly, forming robust seedlings. This not only directly ensures the basic number of seedlings and the uniformity of the crop population in the field, laying the foundation for subsequent high yields, but also significantly enhances the crop's ability to resist adverse stresses such as low temperatures and drought in the early stages of sowing, improving production stability. At the same time, highly vigorous seeds can reduce the amount of seed used per unit area, reducing the manpower and material consumption caused by reseeding and replanting, and helping to achieve the goal of simplified green production that saves costs and improves resource utilization efficiency. Therefore, analyzing and improving the genetic basis of seed vigor is a key agronomic strategy to enhance crop production potential from the source and address the challenges of climate change. However, the mechanism of seed vigor regulation is still unclear, especially in cotton where a systematic theoretical framework is lacking.

[0003] FLA2 belongs to the Fasciclin-Like Arabinogalactan protein (FLA) family, a subclass of the Arabinogalactan-proteins (AGPs) superfamily. This subclass, in addition to possessing the glycosylated regions of AGPs, typically includes a Fasciclin1 (FAS1) domain that promotes cell adhesion. Genes encoding FLA-like Arabinogalactan proteins are widely found in plants, animals, and bacteria. Currently, FLA proteins are found to play important roles in plant stress responses, hormone regulation, sexual reproduction, and cell growth and development. In Arabidopsis thaliana, AtFLA8 , AtFLA10 It plays a regulatory role in seed development. AtFLA16 Stem thickness can be regulated by influencing cell wall synthesis. In cotton, GhFLA1 Genes may play a role in the initiation and elongation of cotton fibers by participating in the regulation of cell wall polysaccharide synthesis and influencing the integrity of the primary cell wall matrix. GbFLA5 Proteins may enhance fiber strength by influencing cellulose synthesis and altering the orientation of microfiber deposition. However, the function of FLA proteins in regulating cotton seed germination has been rarely studied. Summary of the Invention

[0004] This invention provides a gene associated with cotton seed vigor traits. GhFLA2 And its applications, this invention regulates GhFLA2 Gene expression promotes rapid radicle elongation and timely cotyledon unfolding, providing molecular breeding targets for cultivating new high-vitality cotton varieties.

[0005] One of the objectives of this invention is to provide overexpression GhFLA2 Application of genes in improving cotton seed vigor GhFLA2 CDS sequences in tetraploid upland cotton ( G. hirsutum As shown in SEQ ID NO.3 in TM-1.

[0006] The second objective of this invention is to provide a method for improving the vigor of cotton seeds.

[0007] The method is specifically as follows: Overexpression in cotton GhFLA2 Genes that enhance the vigor of cotton seeds. The overexpression of [a specific gene] in cotton seeds... GhFLA2 The specific method of gene generation is as follows: constructing a gene containing GhFLA2 Gene recombinant vectors or recombinant bacteria are used to transform these genes into cotton, resulting in... GhFLA2 Overexpression cotton lines, wherein the seeds of the overexpression cotton lines contain overexpression of... GhFLA2 Gene.

[0008] Furthermore, the construction contains GhFLA2 The primers used for the recombinant vector or recombinant bacteria are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0009] The third objective of this invention is to provide a method for detecting cotton seed vigor, by detecting the vigor of cotton seeds. GhFLA2 Gene expression levels; the detection method used was qPCR; The qPCR detection of cotton GhFLA2 The primers used to measure gene expression are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. Revealed for the first time GhFLA2 The function of the gene in regulating cotton seed vigor fills a technological gap in this field; through overexpression GhFLA2 The radicle length increases 36 hours after seed germination, and the uniformity of germination is significantly improved, which is beneficial for mechanized precision sowing. It provides complete gene cloning, vector construction, genetic transformation and detection methods, which can be directly used for molecular breeding practices. This gene modification does not introduce exogenous proteins, but only regulates the expression of endogenous genes, and has high biosafety.

[0011] 2. This invention obtains [the product / technology] through transgenic technology. GhFLA2 Several overexpression materials were found. Overexpression was observed in cotton. GhFLA2 It can improve seed vigor, thereby reducing the amount of seed used per unit area and minimizing the manpower and material consumption caused by replanting and reseeding. Attached Figure Description

[0012] Figure 1 This is an embodiment of the present invention. GhFLA2 Analysis diagram of expression in various tissues of cotton; Figure 2 This is an embodiment of the present invention. GhFLA2 Structure diagram of the overexpression transgenic cotton vector; Figure 3 This is an embodiment of the present invention. GhFLA2 The relative expression levels of genes overexpressed in transgenic cotton are shown in the figure. Figure 4 This is an embodiment of the present invention. GhFLA2 Figures showing the germination results of overexpression transgenic cotton seeds at 36 and 86 hours; at 36 hours of germination, the radicle elongation rate of the overexpression line was significantly higher than that of the wild type; at 86 hours of germination, the cotyledon flattening rate of the overexpression line was significantly higher than that of the wild type. Figure 5 This is an embodiment of the present invention. GhFLA2 Quantitative comparison of root length at 36 hours after germination and cotyledon spread at 144 hours after germination between overexpression transgenic cotton and wild-type TM-1 seeds; the radicle length of OE-GhFLA2-1 was significantly longer than that of TM-1 at 36 hours after germination, and the cotyledon size and green area were significantly larger than those of TM-1. The scale bar is 1 cm. Detailed Implementation

[0013] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0014] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0015] Example 1: GhFLA2 Analysis of gene expression levels in different tissues and developmental stages of cotton.

[0016] Seeds (0 hours, 5 hours, 10 hours germination), cotyledons and radicles (24 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours germination), roots, stems, leaves, seeds at different developmental stages (-3 DPA ovules, -1 DPA ovules, 0 DPA ovules, 1 DPA ovules, 3 DPA ovules, 5 DPA ovules, 10 DPA ovules, 20 DPA ovules, 25 DPA ovules, 35 DPA ovules), and fibers at different developmental stages (5 DPA fibers, 10 DPA fibers, 20 DPA fibers, 25 DPA fibers) were collected from the upland cotton genetic standard line TM-1 at the germination period. RNA was extracted from different cotton tissue samples using the SteadyPure Universal RNA Extraction Kit (product code: AG21017), reverse transcription was performed using the Evo M-MLV Reverse Transcription Premixed Tracer Kit (product code: AG1734), and qPCR was performed using the SYBR Green SupTaq HS Premixed qPCR Kit (product code: AG11762). GhFLA2 Gene quantification analysis. After RNA extraction, the concentration and purity were detected using NanoDrop. The required OD260 / 280 ratio was between 1.8 and 2.1, and the OD260 / 230 ratio was greater than 2.0.

[0017] RNA extraction, reverse transcription, and gene quantification were performed according to the product instructions. The primer pair used for quantification was QFLA2-2F:CAGATTTGCTGATCGCTTCA (SEQ ID NO.1). QFLA2-2R:TCCATCAGTTGCCAATGTGT (SEQ ID NO. 2).

[0018] The reaction system was 20 μL, containing 10 μL 2× SYBR Green Mix, 0.4 μL upstream and downstream primers (10 μmol / L), 1 μL cDNA template (approximately 50–100 ng), and the remainder was made up with nuclease-free water.

[0019] The reaction procedure was as follows: 95℃ pre-denaturation for 2–5 min, 40 cycles of 95℃ denaturation for 10–15 s, annealing / extension at 60℃ for 30–60 s (fluorescence acquisition), and finally, melting curve analysis to verify amplification specificity. Normalization was performed using a stably expressed internal control gene, and 2... -△△Ct The relative expression level is calculated using this method.

[0020] Quantitative results such as Figure 1 As shown, GhFLA2 The gene was relatively highly expressed in the radicle 24 to 120 hours after germination, further indicating that... GhFLA2Genes are closely related to the elongation of the radicle during seed germination.

[0021] Example 2: GhFLA2 Construction of transgenic cotton overexpression vector GhFLA2 The CDS sequence of the gene in tetraploid upland cotton ( G. hirsutum As shown in SEQ ID NO.3 in TM-1. According to GhFLA2 The CDS sequence of the gene is modified by removing the stop codon to fuse the Flag tag.

[0022] The design was overexpressed in the WMV062 vector. GhFLA2 The recombinant primers for the gene were WMV-FLA2-F: GAGAACACGGGGGACTCTAGAATGTCACCTGCAACCACCGC (SEQ ID NO.4) and WMV-FLA2-R: GTCCTTGTAGTCCATGTCGACAATCAGCAATACCCCAATGCA (SEQ ID NO.5). PCR amplification was performed using cotton seed radicle cDNA during germination as a template. The PCR reaction system (25 μL) was as follows: 50–100 ng DNA template, 1 μL each of primers WMV-FLA2-F (10 μM) and WMV-FLA2-R (10 μM), and 12.5 μL of DNA polymerase mixture. The volume was adjusted to 25 μL with ddH2O.

[0023] The PCR amplification program was as follows: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 58℃ annealing for 5 s, 68℃ extension for 10 s, 35 cycles; 68℃ final extension for 5 min. The amplified... GhFLA2 The fragment was recombinated with the enzyme-digested WMV062 vector, and the restriction enzyme site of WMV062 was selected as follows. Xbal I and Sal I. The WMV062 vector is a plant binary expression vector containing a CaMV35S promoter to drive exogenous gene expression, a NOS terminator, and a kanamycin resistance selection marker. The recombinant product was transformed into *E. coli* DH5α competent cells, screened, and sequenced. The sequencing results were compared to confirm the yield. GhFLA2 The overexpression vector's spectrum is as follows: Figure 2 As shown. The correctly verified overexpression vector was extracted and transformed into Agrobacterium GV3101 via heat shock, and then the Agrobacterium was transformed into upland cotton (Gnaphalium affine) via genetic transformation. G. hirsutum TM-1 was used to obtain transgenic materials with TM-1 as the background. GhFLA2 Overexpression of cotton lines.

[0024] Example 3: GhFLA2 Identification of gene expression levels in transgenic cotton Two were obtained through genetic transformation. GhFLA2 Overexpression cotton lines (OE- GhFLA2 -1, OE- GhFLA2 -2). Design in TM-1 and GhFLA2 Detection of overexpression cotton lines GhFLA2 Primers for relative expression levels: QFLA2-2F: CAGATTTGCTGATCGCTTCA (SEQ ID NO.1) and QFLA2-2R: TCCATCAGTTGCCAATGTGT (SEQ ID NO.2), with TM-1 and GhFLA2 Real-time quantitative reverse transcription PCR (RT-qPCR) was performed using RNA overexpressing cotton lines as templates. cDNA obtained after RNA reverse transcription was used as a template, and qPCR was performed using the SYBR Green method. The template cDNA was mixed with specific primers (SEQ ID NO.1 and SEQ ID NO.2) and a fluorescent dye premix (20 μL) to prepare a reaction system, which was then reacted on a real-time quantitative PCR instrument: 95℃ pre-denaturation for 2–5 min, 40 cycles of 95℃ denaturation for 10–15 s, and 60℃ annealing / extension for 30–60 s (fluorescence acquisition), with fluorescence signals acquired at the end of each cycle. Melting curves were analyzed after the reaction. The Ct values ​​obtained from the samples were corrected using internal reference genes and then analyzed using a 2-1... -ΔΔCt The relative expression level was calculated using this method. The calculated relative expression level results are as follows: Figure 3 The results showed that, compared to TM-1, the two overexpression lines... GhFLA2 The relative levels of mRNA were all significantly upregulated (three biological replicates per group, using student data). t The test compares different groups; **** indicates... P <0.0001). This result proves that it has been successfully obtained. GhFLA2 Overexpression genetic material: OE- GhFLA2 -1, OE- GhFLA2 -2.

[0025] Example 4: GhFLA2 Germination morphology identification of genetically modified cotton By analyzing the genetic background TM-1 and GhFLA2 Genetically modified cotton (OE-) GhFLA2 -1) Seeds were tested for germination under normal conditions (28℃, 16 hours light / 8 hours darkness). Seeds were placed on germination paper with ample water. Photos were taken at 36 and 86 hours after germination for comparison. Figure 4 As shown. From Figure 4 It can be seen that 36 hours after germination, GhFLA2The overexpression lines had a higher radicle elongation rate than TM-1; 86 hours after germination, GhFLA2 The overexpression lines also exhibited a higher cotyledon unfolding rate than TM-1. Furthermore, under the same germination temperature and light conditions as described above, the radicle elongation and cotyledon unfolding of TM-1 and OE-GhFLA2-1 were observed using the paper roll method, with photographs taken and recorded at 36 and 144 hours post-germination. Figure 5 As shown. From Figure 5 As can be seen from this, OE- GhFLA2 The radicle length of OE-1 was significantly longer than that of TM-1 36 hours after germination; 144 hours after germination, the radicle length of OE-1 was significantly longer than that of TM-1. GhFLA2 The size of the cotyledons and the green area of ​​TM-1 are also significantly higher than those of TM-1.

[0026] Therefore, overexpression in cotton GhFLA2 It can increase the length of the radicle, the elongation rate, and the cotyledon unfolding rate, which is beneficial for improving the germination rate and uniformity of seeds in the field, and is more suitable for mechanized cotton sowing.

[0027] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Overexpression GhFLA2 The application of genes in improving cotton seed vigor is characterized by, The GhFLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. A method for improving cotton seed vigor, characterized in that, Overexpression in cotton seeds using genetic transformation technology GhFLA2 Genes that promote radicle elongation, improved germination uniformity, and cotyledon flattening during seed germination, thereby enhancing seed vigor, are described. GhFLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

3. The method for improving cotton seed vigor according to claim 2, characterized in that, The overexpression in cotton seeds GhFLA2 The specific method of gene generation is as follows: constructing a gene containing GhFLA2 Gene recombinant vectors or recombinant bacteria are used to transform these genes into cotton, resulting in... GhFLA2 Overexpression cotton lines, wherein the seeds of the overexpression cotton lines contain overexpression of... GhFLA2 Gene.

4. The method for improving cotton seed vigor according to claim 3, characterized in that, The construction includes GhFLA2 The primers used for the gene recombinant vector or recombinant bacteria are shown in SEQ ID NO.4 and SEQ ID NO.

5.

5. A method for detecting cotton seed vigor, characterized in that, By detecting cotton GhFLA2 The expression level of the gene was detected using qPCR, and the qPCR detection was performed on cotton. GhFLA2 The primers used to measure gene expression are shown in SEQ ID NO.1 and SEQ ID NO.

2. GhFLA2 The nucleotide sequence of the gene is shown in SEQ ID NO.3.

Images