SNP molecular marker for regulating tiller number of rice and application of KASP detection primer set thereof

Abstract

The application discloses a SNP molecular marker for regulating rice tiller number and application of a KASP detection primer set thereof, relates to the technical field of molecular biology, and the SNP molecular marker is located at 0107248534 of chromosome 1 of a rice reference genome MSU6.1, is A / G in base, and the nucleotide sequence of the KASP detection primer set developed based on the SNP is shown as SEQ ID NO. 1-SEQ ID NO. 3. The SNP molecular marker and / or the KASP detection primer can be used for screening of the rice tiller number and / or screening, so that the purpose of molecular marker assisted breeding is achieved. In production, the molecular marker and / or the KASP detection primer set can also be used for detecting the rice at a seedling stage, screening of plants with high tiller number, and then improving the yield per unit area of the rice.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to the application of an SNP molecular marker for regulating the number of rice tillers and its KASP detection primer set. Background Technology

[0002] Rice is an important food crop. Its final yield is determined by three key factors: thousand-grain weight, effective panicle number, and number of grains per panicle. The number of tillers directly affects the number of panicles, making it a crucial factor influencing yield per rice plant. Appropriately increasing the number of tillers can increase the number of effective panicles per unit area, thereby increasing the yield per rice plant per unit area. Therefore, cultivating rice varieties with a higher tiller count is of great significance for improving yield per rice plant and ensuring food security.

[0003] However, traditional rice breeding methods are time-consuming and inefficient, making it difficult to meet current breeding needs. With the development of molecular biology and genetic engineering technologies, improving rice growth traits through genetic engineering has become an effective breeding strategy. However, the number of functional genes related to secondary growth in poplar trees is currently limited.

[0004] Therefore, cultivating rice germplasm with increased tiller number through molecular biology and genetic engineering techniques is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides an SNP molecular marker for regulating the number of rice tillers and its application in a KASP detection primer set.

[0006] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0007] The application of a SNP molecular marker that regulates the number of rice tillers in identifying the number of rice tillers and / or yield, wherein the SNP molecular marker is located at position 0107248534 on chromosome 1 of the rice reference genome MSU6.1, and the bases are A / G.

[0008] Another object of the present invention is to provide a set of KASP detection primers for detecting the above-mentioned SNP molecular markers, wherein the nucleotide sequences of the detection primers are shown in SEQ ID NO.1-SEQ ID NO.3.

[0009] Another object of the present invention is to provide a detection kit comprising the above-described detection primer set.

[0010] Another object of the present invention is to provide the application of the above-described detection primer set or the above-described detection kit in detecting and / or predicting the number of rice tillers.

[0011] Another objective of this invention is to provide a method for detecting and / or predicting the number of tillers in rice, which involves amplifying and genotyping the genomic DNA of the rice to be tested using the aforementioned detection primer set or the aforementioned detection kit. When the genotype is homozygous AA, it is a high-tillering-number material, and when the genotype is homozygous GG, it is a low-tillering-number material.

[0012] Preferably, the PCR system used to amplify the genomic DNA of the rice to be tested includes: ddH2O, 2×PARMS mix, R primer, F1 primer and F2 primer, and their volume ratio is 4.3:5:0.4:0.15:0.15.

[0013] Preferably, the PCR program used to amplify the genomic DNA of the rice to be tested includes: (1) pre-denaturation at 94℃ for 20 min; (2) denaturation at 94℃ for 20 s, followed by 10 cycles at 65-57℃ for 1 min; (3) denaturation at 94℃ for 20 s, followed by 10 cycles at 57℃ for 1 min; (4) 25℃ for 1 min; wherein, the 65-57℃ for 1 min in step (2) specifically refers to the temperature of the first cycle being 65℃, and the temperature decreasing by 0.8℃ for each subsequent cycle.

[0014] Another object of the present invention is to provide the application of the above-described detection primer set or the above-described detection kit in detecting and / or predicting rice yield.

[0015] Another object of the present invention is to provide the application of the above-mentioned detection primer set or the above-mentioned detection kit in rice molecular-assisted breeding, wherein the rice molecular-assisted breeding is for regulating the number of rice tillers and / or yield.

[0016] Another objective of this invention is to provide a method for molecular-assisted breeding of rice, which uses the above-mentioned detection primer set or the above-mentioned detection kit to amplify and genotype the genomic DNA of the rice to be tested, retains materials with homozygous AA genotype, and cultivates germplasm with high tiller number and / or high yield.

[0017] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: Using rice varieties Zhenshan 97B and IRAT109, and their recombinant inbred lines with significant differences in tiller number, the present invention identifies a SNP molecular marker closely linked to rice tiller number and develops a set of KASP detection primers. Using this SNP molecular marker and / or KASP detection primers, rice tiller number and / or selection can be performed to achieve the purpose of marker-assisted breeding. In production, this molecular marker and / or KASP detection primer set can also be used to detect rice at the seedling stage, screen plants with high tiller numbers, and thus increase rice yield per unit area. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 This is the KASP molecular marker gene typing map and phenotypic association results of the test materials in Example 1 of the present invention; Figure 2 This is the result of the association verification between the KASP molecular marker gene typing map and phenotype of the test material in Example 2 of the present invention. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0022] Example 1 Test materials: The recombinant inbred line population constructed from Zhenshan 97B (with a high number of tillers and high yield per plant), IRAT109 (with a low number of tillers and low yield per plant) and 194 accessions of “Zhenshan 97B / IRAT109” was used as the test materials in this embodiment.

[0023] Tiller number counting method: After rice matures, the number of rice tillers is counted, with 8 plants counted for each replicate, and 3 biological replicates are counted.

[0024] SNPs in the chromosome 1 region of the tested materials were extracted and analyzed, and genotyping was performed using the KASP technique.

[0025] Specifically: (1) Extraction of genomic DNA In a mortar, take 10 mg of rice leaves, add an appropriate amount of liquid nitrogen, and grind the rice leaves into powder. Add 400 μL of 1.5 × CTAB (1.5% CTAB, 75 mmol / L Tris-HCl, 15 mmol / L EDTA, 1.05 mol / L NaCl, pH = 8.0) and grind into a homogenate. Add another 400 μL of 1.5 × CTAB, transfer the homogenate to a 1.5 ml centrifuge tube, add 550 μL of chloroform, mix well, centrifuge at 12000 r / min for 10 min, transfer the supernatant to another centrifuge tube, add an equal volume of pre-cooled isopropanol, centrifuge at 12000 r / min for 5 min, discard the supernatant, dry the precipitate, and finally add 200 μL of ddH2O to dissolve.

[0026] (2) PCR amplification PCR amplification system (10 μL): ddH2O 3.3μL 2×PARMS mix 5μL 1 μL DNA (50 ng / μL) 0.4 μL (10 μmol / L) of R primer 0.15 μL (10 μmol / L) of F1 primer 0.15 μL (10 μmol / L) of F2 primer The PCR reaction program was as follows: ① 94℃ pre-denaturation for 20 min; ② 94℃ denaturation for 20 s, 65-57℃ (-0.8℃ / Cycle) for 1 min, for 10 cycles; ③ 94℃ denaturation for 20 s, 57℃ for 1 min, for 32 cycles; ④ 25℃ for 1 min.

[0027] (3) Genotyping: After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the fluorescence signal was analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping diagram. The genotype results were output according to the different colors.

[0028] KASP detection primers are pre-selected with fluorescent linkers F1-FAM and F2-HEX, which are displayed in different colors on the genotyping map (e.g., green for AA genotype, blue for GG genotype, and red for AG genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous AA or GG. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0029] (4) Test results In this embodiment, by screening molecular markers, a SNP molecular marker closely linked to the tiller number trait in rice was finally obtained. This SNP molecular marker is located at 0107248534 bp on chromosome 1 of the rice reference genome (Nipponbare reference genome MSU6.1), and is divided into genotype A and genotype G.

[0030] For this SNP, the following KASP detection primer set was developed: F1:FAM-GAAGGTGACCAAGTTCATGCTCGTTAGATTAGGTCATAGGAAAAACA, SEQ ID NO.1; F2:HEX-GAAGGTCGGAGTCAACGGATTCGTTAGATTAGGTCATAGGAAAAACAT, SEQ ID NO.2; R: AATGGTTCATTGCATGTAGGAGAG, SEQ ID NO. 3.

[0031] The genotyping results are attached. Figure 1 As shown, in the 'Zhenshan 97 / IRAT 109' recombinant inbred line population, the number of tillers in the lines carrying the Zhenshan 97 allele (SNP0107248534-A type, 107 lines) was significantly higher than that in the lines carrying the IRAT 109 allele (SNP0107248534-G type, 87 lines), with a P value of 2.82E-03.

[0032] Example 2 This embodiment is a verification experiment, and the materials used are the 245 natural population materials shown in Table 1.

[0033] Table 1

[0034] The number of tillers in 245 materials was counted according to the method in Example 1; and the yield per plant was measured after the rice matured.

[0035] Genomic DNA was extracted from 245 rice samples using the method described in Example 1, and amplified using the KASP detection primer set (SEQ ID NO.1-SEQ ID NO.3) developed in Example 1. After amplification, fluorescence signals were detected and genotyping was analyzed.

[0036] The genotyping results are attached. Figure 2 As shown, in the natural population, the number of tillers of the SNP0107248534-A germplasm resource (95 accessions) was significantly higher than that of the SNP0107248534-G germplasm resource (146 accessions), with a P value of 7.78E-10; at the same time, the yield per plant of the SNP0107248534-A germplasm resource (95 accessions) was also significantly higher than that of the SNP0107248534-G germplasm resource (146 accessions), with a P value of 1.90E-26.

[0037] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0038] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of an SNP molecular marker regulating the number of rice tillers in identifying the number of rice tillers and / or yield, characterized in that, The SNP molecular marker is located at position 0107248534 on chromosome 1 of the rice reference genome MSU6.1, with bases A / G.

2. A KASP detection primer set for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences of the detection primer set are shown in SEQ ID NO.1-SEQ ID NO.

3.

3. A test kit, characterized in that, The detection kit includes the detection primer set as described in claim 2.

4. The application of the detection primer set of claim 2 or the detection kit of claim 3 in detecting and / or predicting the number of rice tillers.

5. A method for detecting and / or predicting the number of tillers in rice, characterized in that, Using the detection primer set described in claim 2 or the detection kit described in claim 3, the genomic DNA of the rice to be tested is amplified and genotyped. When the genotype is homozygous AA, it is a high tillering material; when the genotype is homozygous GG, it is a low tillering material.

6. The method for detecting and / or predicting the number of rice tillers according to claim 5, characterized in that, The PCR system used to amplify the genomic DNA of the rice to be tested includes: ddH2O, 2×PARMS mix, R primer, F1 primer and F2 primer, and their volume ratio is 4.3:5:0.4:0.15:0.

15.

7. The method for detecting and / or predicting the number of rice tillers according to claim 5, characterized in that, The PCR program used to amplify the genomic DNA of the rice to be tested includes: (1) pre-denaturation at 94℃ for 20 min; (2) denaturation at 94℃ for 20 s, followed by 65-57℃ for 1 min, for 10 cycles; (3) denaturation at 94℃ for 20 s, followed by 57℃ for 1 min, for 32 cycles; (4) 25℃ for 1 min; wherein, the 65-57℃ for 1 min in step (2) specifically refers to the temperature of the first cycle being 65℃, and the temperature decreasing by 0.8℃ for each subsequent cycle.

8. The application of the detection primer set of claim 2 or the detection kit of claim 3 in detecting and / or predicting rice yield.

9. The application of the detection primer set of claim 2 or the detection kit of claim 3 in molecular-assisted breeding of rice, characterized in that, The purpose of the aforementioned molecular-assisted breeding of rice is to regulate the number of rice tillers and / or yield.

10. A method for molecular-assisted breeding of rice, characterized in that, Using the detection primer set described in claim 2 or the detection kit described in claim 3, the genomic DNA of the rice to be tested is amplified and genotyped, and materials with homozygous AA genotype are retained to cultivate germplasm with high tiller number and / or high yield.

Images