A tetraploid thinopyrum ponticum salt-tolerant 3el chromosome molecular marker and application thereof
The primer pair combination developed using long-read sequencing technology has solved the problem of distinguishing between homozygous and heterozygous genotypes of chromosome 3E in tetraploid long-spike wheatgrass, achieving accurate chromosome identification and improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN AGRI UNIV
- Filing Date
- 2026-04-21
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies make it difficult to accurately distinguish between homozygous and heterozygous genotypes of chromosome 3E in tetraploid long-spike wheat in the context of wheat genetics, resulting in a large workload for screening target materials and difficulty in ensuring the accuracy and efficiency of breeding results.
We developed primer pair combinations based on long-read sequencing technology and designed LTTE3EM-2, LTTAE6A-2, LTTE3EZ-1 and LTTAE6A-2 molecular markers to identify the homozygous or heterozygous status of the salt-tolerant 3EL chromosome of tetraploid Wheatgrass long-spike. Accurate identification was achieved by PCR amplification and gel electrophoresis detection.
The accurate identification of the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass was achieved, improving the efficiency and accuracy of wheat breeding selection and providing important technical support for wheat genetic breeding.
Smart Images

Figure CN122104996A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop genetics and breeding technology, and in particular to a salt-tolerant 3EL chromosome molecular marker for tetraploid long-eared wheatgrass and its application. Background Technology
[0002] wheat( Triticum aestivum Wheat (L.) is one of the world's three major food crops. Breeding high-quality, high-yield wheat is crucial to meeting the growing global population and increasing food demand. However, current production faces various challenges, such as poor growth under adverse conditions, weak disease resistance, and a narrow genetic base, all of which pose significant challenges to wheat production and food security. Furthermore, changes in farming systems and the repeated use of a few parent lines in breeding have led to a decrease in wheat genetic diversity in recent years. Wheat's closely related species contain a wealth of superior genes, and currently, the main method for enriching wheat's genetic diversity is through distant hybridization to introduce these superior genes into common wheat.
[0003] Tetraploid long-spiked wheatgrass (tetraploid) Thinopyrum elongatum ,2 n = 2 x = 14, EEEE or E e E e E b E b *Triticum longipedum*, belonging to the genus *Triticum* of the tribe Triticum in the family Poaceae, is an invaluable and excellent exogenous gene donor for wheat genetic improvement. It exhibits strong adaptability, such as drought resistance, salt tolerance, and resistance to various wheat diseases. The resistance genes carried by tetraploid *Triticum longipedum* are mainly introduced into common wheat in the form of double diploids and substitution lines.
[0004] Han Fangpu et al. (1993) first obtained intergeneric hybrids of tetraploid *Thymus chinensis* with durum wheat and *Timofibrilla*, including wheat-tetraploid *Thymus chinensis* partially didiploid hybrids 8801, 8802, and 8803, which are highly resistant to Fusarium head blight. Our research group previously crossed 8801 with wheat varieties from the Sichuan wheat-growing region (Shumai 51, Shumai 482, Chuannong 16, etc.) to obtain a set of chromosome 1-7E substitution lines. Among them, the 3E (3D) substitution line improves wheat photosynthesis, water use efficiency, reactive oxygen species scavenging capacity, osmotic regulation, and reduces Na+ in the underground parts. + / K + Compared to other methods, this helps maintain ion homeostasis and enhances the tolerance potential to salt stress (Zeng et al., 2023).
[0005] Developing molecular markers for the 3EL chromosome of tetraploid *Thinopyrum elongatum* can rapidly and accurately detect the 3EL chromosome in wheat-tetraploid *Thinopyrum elongatum*-derived progeny. Currently, various molecular marker technologies have been used to develop chromosome-specific markers for the 3E chromosome of tetraploid *Thinopyrum elongatum*. However, the development of these markers is mainly used to detect the 3E chromosome of tetraploid *Thinopyrum elongatum* and cannot identify the genotype (homozygous or heterozygous) of the 3E chromosome in tetraploid *Thinopyrum elongatum* in a wheat background. With the iterative upgrades of chromosome engineering (such as translocation line construction and distant hybridization introgression) and efficient seed propagation technologies, the wheat breeding process has significantly accelerated. In the wheat genetic background, translocations and introgression of exogenous small chromosome fragments from distant relatives are key pathways for broadening the genetic base. However, due to chromosome imbalance and low proportion of exogenous genetic material, traditional molecular markers such as SSR and STS are insufficient to accurately distinguish between homozygous and heterozygous genotypes in these fragments (especially non-compensatory translocations). This results in a large workload for target material screening, which also requires consideration of normal plant growth and development phenotypes (to avoid misscreening superior genetic backgrounds). Therefore, developing codominant molecular markers based on exogenous specific sequences (such as species-specific genes and repetitive sequences) to achieve specific and precise identification of homozygous / heterozygous genotypes of exogenous fragments in the wheat background is a key technological requirement for improving breeding selection efficiency and ensuring the implementation of distant hybridization breeding results. It is of great significance for promoting the targeted and large-scale development of crop genetic breeding.
[0006] Long-read sequencing is a type of nucleic acid sequencing that produces individual reads, each derived from a single DNA molecule thousands of nucleotides or longer, generating genomic data. Long-read sequencing can detect DNA (or RNA) fragments ranging from 1,000 to 20,000 bases or longer. These fragments typically originate from "native" molecules extracted directly from biological samples for analysis. In contrast, most short-read sequencing technologies can only detect fragments of 50-300 bases. Unlike most long-read methods, short-read sequencing solutions are not efficient at sequencing native molecules and require amplification of the extracted DNA before analysis. Summary of the Invention
[0007] The purpose of this invention is to provide a molecular marker for the salt-tolerant 3EL chromosome of tetraploid Wheatgrass and its application, in order to solve the problems existing in the prior art. The primer pair designed in this invention can be used to identify the genotype of salt-tolerant wheat-tetraploid Wheatgrass 3EL translocation lines, that is, to identify whether the salt-tolerant 3EL chromosome of tetraploid Wheatgrass is homozygous, providing an important approach for the systematic evolution of wheat, germplasm resource identification and molecular marker-assisted selection breeding.
[0008] To achieve the above objectives, the present invention provides the following solution: This invention provides a primer pair combination for detecting the salt tolerance 3EL chromosome molecular marker in tetraploid *Thinopyrum elongatum*, wherein the primer pair combination is used to detect... LTTE3EM-2 Primer pairs and detection of molecular markers LTTAE6A-2 The primer pairs consist of molecular markers, or the primer pair combinations are determined by the detection... LTTE3EZ-1 Primer pairs and detection of molecular markers LTTAE6A-2 Composition of primer pairs for molecular markers; The detection LTTE3EM-2 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO.4-SEQ ID NO.5; The detection LTTAE6A-2 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO. 8-SEQ ID NO. 9; The detection LTTE3EZ-1 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO.6-SEQ ID NO.7; The LTTE3EM-2 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; The LTTAE6A-2 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; The LTTE3EZ-1 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.2.
[0009] The present invention also provides the application of the primer pair combination in the preparation of reagents or kits for identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous.
[0010] The present invention also provides a reagent or kit for identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous, containing the primer pair combination described above.
[0011] The present invention also provides the application of the primer pair combination or the reagent or kit described herein in identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous.
[0012] This invention also provides a method for identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous, comprising the following steps: Using the wheat DNA to be tested as a template, PCR amplification was performed using the primer pair combination described above. The amplification products were then detected by gel electrophoresis, and the results were used to make a judgment. If only detection LTTE3EM-2 Primer pairs for molecular markers or detection LTTE3EZ-1 The primer pair of the molecular marker showed amplification results, indicating that the wheat to be tested contained the homozygous tetraploid salt-tolerant 3EL chromosome of *Thinopyrum elongatum*. If detection LTTE3EM-2 Primer pairs for molecular markers or detection LTTE3EZ-1 Primer pairs for molecular markers and detection LTTAE6A-2 The primer pairs of molecular markers showed amplification results simultaneously, indicating that the wheat to be tested contained the heterozygous tetraploid long-spike wheatgrass salt-tolerant 3EL chromosome; If only detection LTTAE6A-2 The primer pair of the molecular marker showed amplification results, indicating that the wheat to be tested did not contain the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass.
[0013] Optionally, the PCR amplification reaction system is as follows: 1 μL DNA template, 1 μL each of upstream and downstream primers, 12.5 μL 2 × Taq Master Mix and 9.5 μL ddH2O.
[0014] Optionally, the PCR amplification reaction program is as follows: 94℃ for 5 min; 94℃ for 30 s, 50-60℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 10 min; 12℃ to terminate the reaction.
[0015] The present invention discloses the following technical effects: This invention utilizes long-read sequencing technology to sequence a partial didiploid 8801 of durum wheat-tetraploid *Wheatgrass longicornis*. By comparing the sequence with the 3EL sequence of diploid *Wheatgrass longicornis*, a salt-tolerant 3EL-specific sequence for tetraploid *Wheatgrass longicornis* was obtained. Based on these sequences, specific molecular markers for salt-tolerant 3EL in tetraploid *Wheatgrass longicornis* were developed. Simultaneously, based on the sequence of the KAT-2A gene on chromosome 6AL of common wheat, specific molecular markers for the long arm (6AL) of chromosome 6A of common wheat were developed, combining these into two sets of molecular markers. LTTE3EM-2 and LTTAE6A-2, LTTE3EZ-1 and LTTAE6A-2 Two sets of primer pairs for molecular markers were designed and validated in the salt-tolerant wheat-tetraploid *Wheatgrass long-spike* 6AS·3EL translocation line. The designed primer pairs were found to be effective in identifying the genotype of the salt-tolerant wheat-tetraploid *Wheatgrass long-spike* 3EL translocation line, specifically in determining whether the *Wheatgrass long-spike* salt-tolerant 3EL chromosome is homozygous. This invention provides an important pathway for wheat phylogenetics, germplasm resource identification, and marker-assisted selection breeding. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 3EL-specific molecular marker for tetraploid long-spike wheatgrass LTTE3EM-2 Amplification results in common wheat, long-spike wheatgrass, wheat-tetraploid long-spike wheatgrass 3E chromosome substitution line, and wheat-tetraploid long-spike wheatgrass 3EL heterozygous and homozygous translocation lines; Figure 2 A chromosome-6AL specific molecular marker for common wheat LTAE6A-2 Amplification results in common wheat, long-spike wheatgrass, wheat-tetraploid long-spike wheatgrass 3E chromosome substitution line, and wheat-tetraploid long-spike wheatgrass 3EL heterozygous and homozygous translocation lines; Figure 3 A chromosome-specific molecular marker for tetraploid long-spike wheatgrass 3E. LTTE3EZ-1 Amplification results in common wheat, long-spike wheatgrass, wheat-tetraploid long-spike wheatgrass 3E chromosome substitution line, and wheat-tetraploid long-spike wheatgrass 3EL heterozygous and homozygous translocation lines; Figure 4 A chromosome-6AL specific molecular marker for common wheat LTAE6A-2 Amplification results in common wheat, long-spike wheatgrass, wheat-tetraploid long-spike wheatgrass 3E chromosome substitution line, and wheat-tetraploid long-spike wheatgrass 3EL heterozygous and homozygous translocation lines; In each figure, M: Marker (500 bp); 1: Common wheat Chinese Spring; 2: Chuannong 16; 3: Zhengmai 9023; 4: Shumai 580; 5: Common wheat line Y16-2756; 6: Tetraploid long-spike wheatgrass Th. elongatum 7: 8801; 8: 3E / 3D substitution system; 9: 6AS·3EL heterozygous translocation system; 10: 6AS·3EL homozygous translocation system. Detailed Implementation
[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0023] Experimental materials: Common wheat, Chinese Spring (CS, 2) n = 6 x = 42), common wheat varieties Chuannong 16, Zhengmai 9023, Shumai 580, common wheat variety Y16-2756, tetraploid long-spike wheatgrass ( Th. elongatum ,2 n = 4 x = 28), Langdon-tetraploid long-spike wheat double diploid 8801 (2 n = 6 x = 42, AABBEE), common wheat-tetraploid long-spike wheatgrass 3E (3D) chromosome substitution line (created by hybridization and backcrossing of 8801 and wheat varieties Chuanong 16, Zhengmai 9023, etc.), heterozygous 3E chromosome long arm translocation line 6AS·3EL and homozygous 3E chromosome long arm translocation line 6AS·3EL (3E (3D) / Shumai 580F4), all provided by the Wheat Research Institute of Sichuan Agricultural University.
[0024] Example 1 1. Obtaining chromosome-specific fragments of 3EL from tetraploid *Thinopyrum elongatum* using long-read sequencing technology. When the durum wheat Langdon-tetraploid long-spike wheat double diploid 8801 reached the seedling stage, its leaves were taken and sent to Beijing Novogene Technology Co., Ltd. for long-read sequencing. The effective sequence of the sample was obtained through long-read sequencing.
[0025] The obtained sequences were first compared with known sequences from *Leymus chinensis* (Chinese spring wheat). Sequences with a similarity of more than 22.85% (23%) to wheat were removed. The remaining sequences were then compared with the 3EL chromosome sequence of diploid *Leymus chinensis*, obtaining sequences with a similarity greater than 22.85% (23%), which are specific sequences of the tetraploid *Leymus chinensis* 3EL chromosome. A total of 14 chromosome 3E-specific sequences were finally obtained. The KAT-2A gene sequence of the 6AL chromosome of common wheat was obtained from the WheatOmics website.
[0026] 2. Development of codominant molecular markers linked to salt tolerance of tetraploid long-spike wheatgrass 3EL Primers were designed for the 14 3EL chromosome-specific sequences and one common wheat 6AL chromosome KAT-2A gene sequence obtained above. The PCR primers were designed using the online software Primer3 Plus, and all primers were synthesized at Chengdu Qingke Weiye Biotechnology Co., Ltd.
[0027] PCR reaction system (25 μL): 1 μL DNA template (100 ng / μL), 1 μL each of forward and reverse primers (10 μM), 12.5 μL 2× Taq Master Mix (P114) and 9.5 μL ddH2O.
[0028] PCR reaction program: 94℃ for 5 min; 94℃ for 30 s, 50-60℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 10 min; terminate reaction at 12℃.
[0029] 3. Agarose gel electrophoresis detection PCR products were detected by 3% agarose gel electrophoresis. Primers designed using the tetraploid *Wheatgrass longicornis* 3EL chromosome-specific molecular marker "2. Development of codominant molecular markers linked to salt tolerance of tetraploid *Wheatgrass longicornis* 3EL" amplified specific bands in tetraploid *Wheatgrass longicornis*, parental line 8801, and 3E / 3D substitution lines. However, no bands were amplified in wheat varieties such as Chinese Spring, Chuannong 16, Zhengmai 9023, Shumai 580, and common wheat line Y16-2756. These primers are chromosome-specific primers for tetraploid *Wheatgrass longicornis* 3EL, i.e., chromosome-specific molecular markers for tetraploid *Wheatgrass longicornis* 3EL.
[0030] Ultimately, this invention successfully designed and verified two tetraploid 3EL chromosome-specific markers: LTTE3EM-2 (The nucleotide sequence is shown in SEQ ID NO.1) and LTTE3EZ-1 (The nucleotide sequence is shown in SEQ ID NO.2), and its primers are listed in Table 1. The chromosome-specific marker for 6AL is... LTTAE6A-2The nucleotide sequence is shown in SEQ ID NO.3, and its primers are shown in Table 2.
[0031] Figure 1 and Figure 3 Molecular markers LTTE3EM-2 and LTTE3EZ-1 The amplification results in different wheat materials showed that specific bands were amplified only in the tetraploid *Thinopyrum elongatum*, parental line 8801, and the 3E / 3D substitution line. No bands were amplified in wheat varieties such as *Chinese Spring*, *Sichuan Agricultural University* 16, *Zhengmai* 9023, *Shumai* 580, and the common wheat line Y16-2756, indicating that... LTTE3EM-2 and LTTE3EZ-1 The two pairs of molecular markers are chromosome-specific markers of tetraploid long-spike wheatgrass 3EL.
[0032] SEQ ID NO.1: ; SEQ ID NO.2: GTGTAGCCTCCATCCAGACGCGAGGCGGCCCCATCCATGCACGGGCGACGGATGCGTATGGTGGCTGGCATCAGCCGGCTGCATGAACGCGTGGCTGATAGATTCTTGTGTGTCGCACGATGCTACAGGCTTCTGAGTGGGTGAAGCTTCTCAAGAAATTCAGGCAATTCGACCCTGAATTTGAGAAGGTTACACAGCTGCTGCAAGTAAGGTATGGAAATTAGAG CAGTTGGGAACAAAAGTACTACACTGGAAGCTGATTTTCTCATCGATCGAACCCATCAGCATCACCAATTCTCCAAGGCCAACAAATCGCGTGGGGATGGGATCTTCCTCACATGTACGTCTCGTAGTCGGCGTCGTATGGCTCCGTCTCCGGCGCAGGGGGCGGCCCTCCCTGTCGCAGATGCCGCCGCCCCATCCGTCTGCCCTCTAGAACGGATTCCC; SEQ ID NO.3: TGATCATAGAATGGATGCCGTGTTTGTTCTGATTATTACTTTCTTCTTCTTTGCTGTGTCACCCGCAGTGCCTACCGGACGCCGATATGCAAGGCCAAGCGAGGGGGCTTCAAGGACACCTACCCGGA GGACCTTTCTTACCCCAGTTCTCAAGGTTTGCACTTAGCATGTACTCCGTACCTCTTTGTACAAATATATACTGGCACATTCAAACCGAGAGGACAGCATTCTCAGATTGTTGCTCACTGCACATTCCC.
[0033] Table 1. Primers for two pairs of tetraploid *Thinopyrum elongatum* 3EL chromosomes. Table 2. One pair of chromosome-specific primers for common wheat 6AL. 4. Validation of 3EL chromosome codominant molecular markers in common wheat and salt-tolerant 3EL translocation lines Using two sets of 3EL chromosome codominant molecular markers ( LTTE3EM-2 and LTTAE6A-2 , LTTE3EZ-1 andLTTAE6A-2 ), in common wheat varieties such as China Spring, Chuannong 16, Zhengmai 9023, Shumai 580, and common wheat line Y16-2756, Th. elongatum Genotyping was performed on the 8801, 3E / 3D substitution lines, 6AS·3EL heterozygous translocation lines, and 6AS·3EL homozygous translocation lines.
[0034] If only the DNA band of the long arm of chromosome 3EL is amplified after testing, the wheat to be tested is determined to be a homozygous translocation of the long arm of chromosome 3EL; if DNA bands of both the long arms of chromosomes 3EL and 6AL are amplified at the same time, the wheat to be tested is determined to be a heterozygous salt-tolerant 3EL translocation line; if only the DNA band of the long arm of chromosome 6AL is amplified, the wheat to be tested is determined to be a salt-intolerant wheat material that does not contain 3EL.
[0035] Figure 1 and Figure 2 Molecular markers were displayed. LTTE3EM-2 and LTTAE6A-2 Amplification in different wheat materials, Figure 3 and Figure 4 Molecular markers were displayed. LTTE3EZ-1 and LTAE6A-2 The amplification of primers in different wheat materials was observed. The results show that molecular markers… LTTE3EM-2 and LTTAE6A-2 and molecular markers LTTE3EZ-1 and LTAE6A-2 In tetraploid *Thinopyrum elongatum* and the 6AS·3EL homozygous translocation line, the amplification results showed that only the DNA band of the 3EL chromosome was amplified. The amplification results in the 3E (3D) chromosome substitution line, 8801 and 6AS·3EL heterozygous translocation line all showed that DNA bands of both 3EL and 6A chromosomes were amplified simultaneously. In common wheat varieties such as China Spring, Chuannong 16, Zhengmai 9023, Shumai 580, and common wheat line Y16-2756, the amplification results all showed DNA bands containing only chromosome 6AL.
[0036] The above results demonstrate that the two sets of molecular markers provided by this invention ( LTTE3EM-2 and LTAE6A-2 , LTTE3EZ-1 and LTAE6A-2 The primers can differentiate the wheat-tetraploid long-spike wheatgrass 3EL translocation line from other materials, and the two sets of molecular markers LTTE3EM-2 , LTTE3EZ-1 and LTAE6A-2 It is a chromosome-specific codominant molecular marker for the salt tolerance 3EL chromosome of tetraploid long-spike wheatgrass, and it is stable.
[0037] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A primer pair combination for detecting the salt tolerance 3EL chromosome molecular marker of tetraploid *Thinopyrum elongatum*, characterized in that, The primer pair combination is used for detection. LTTE3EM-2 Primer pairs and detection of molecular markers LTTAE6A-2 The primer pairs consist of molecular markers, or the primer pair combinations are determined by the detection... LTTE3EZ-1 Primer pairs and detection of molecular markers LTTAE6A-2 Composition of primer pairs for molecular markers; The detection LTTE3EM-2 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO.4-SEQ ID NO.5; The detection LTTAE6A-2 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO. 8-SEQ ID NO. 9; The detection LTTE3EZ-1 The nucleotide sequences of the primer pairs for the molecular markers are shown in SEQ ID NO.6-SEQ ID NO.7; The LTTE3EM-2 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; The LTTAE6A-2 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; The LTTE3EZ-1 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
2.
2. The application of the primer pair combination according to claim 1 in the preparation of reagents or kits for identifying whether the salt-tolerant 3EL chromosome of tetraploid wheatgrass is homozygous.
3. A reagent or kit for identifying whether the salt-tolerant 3EL chromosome of tetraploid *Thinopyrum elongatum* is homozygous, characterized in that, Contains the primer pair combination as described in claim 1.
4. The application of the primer pair combination of claim 1 or the reagent or kit of claim 3 in identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous.
5. A method for identifying whether the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass is homozygous, characterized in that, Includes the following steps: Using wheat DNA as a template, PCR amplification was performed using the primer pair combination described in claim 1. The amplification products were then detected by gel electrophoresis, and the results were used to make a judgment. If only detection LTTE3EM-2 Primer pairs for molecular markers or detection LTTE3EZ-1 The primer pair of the molecular marker showed amplification results, indicating that the wheat to be tested contained the homozygous tetraploid salt-tolerant 3EL chromosome of *Thinopyrum elongatum*. If detection LTTE3EM-2 Primer pairs for molecular markers or detection LTTE3EZ-1 Primer pairs for molecular markers and detection LTTAE6A-2 The primer pairs of molecular markers showed amplification results simultaneously, indicating that the wheat to be tested contained the heterozygous tetraploid long-spike wheatgrass salt-tolerant 3EL chromosome; If only detection LTTAE6A-2 The primer pair of the molecular marker showed amplification results, indicating that the wheat to be tested did not contain the salt-tolerant 3EL chromosome of tetraploid long-spike wheatgrass.
6. The method as described in claim 5, characterized in that, The PCR amplification reaction system consisted of: 1 μL DNA template, 1 μL each of upstream and downstream primers, 12.5 μL 2 × Taq Master Mix, and 9.5 μL ddH2O.
7. The method as described in claim 5, characterized in that, The PCR amplification reaction procedure was as follows: 94℃ for 5 min; 94℃ for 30 s, 50-60℃ for 30 s, 72℃ for 2 min, 35 cycles; 72℃ for 10 min; 12℃ to terminate the reaction.