A dCAPS molecular marker for detecting residual amount of propamocarb in cucumber fruits and application thereof
By developing a dCAPS molecular marker for the SNP at -158 of the CsABCI19 gene promoter, and utilizing PCR and Nco I enzyme digestion technology, the complexity and cost issues of detecting downy mildew residues in cucumber fruits were resolved. This enabled a rapid and low-cost detection method, supporting stricter breeding standards and reducing health risks to consumers.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHEAST AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-23
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, the detection of downy mildew residues in cucumber fruits is complex and costly, making it difficult to apply on a large scale. Furthermore, there is a lack of effective downy mildew-resistant varieties, which increases the health risks to consumers.
A dCAPS molecular marker based on the SNP at -158 of the CsABCI19 gene promoter was developed. By PCR and Nco I enzyme digestion, specific primers were used to identify and distinguish the amount of procymidone residue in cucumber fruits, enabling rapid identification of germplasm with low procymidone residue in the fruits.
This technology enables rapid and low-cost detection of procymidone residues in cucumber fruits, allowing for the identification of germplasm with low procymidone residues at the seedling stage. This supports stricter breeding standards and reduces health risks to consumers.
Smart Images

Figure CN122104998A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, specifically to a dCAPS molecular marker related to the amount of cymoxanil residue in cucumber fruit and its application. Background Technology
[0002] Cucumber is an annual herbaceous plant widely cultivated in my country and is one of the important vegetables consumed daily by consumers. Downy mildew is a common disease affecting cucumber growth, restricting plant growth and impacting fruit yield and quality. Currently, downy mildew-resistant varieties are still lacking, and the pesticide propamocarb is commonly used for control in production. However, excessive application of propamocarb results in high pesticide residue levels in commercial cucumber fruits, posing a potential threat to consumer health. Propamocarb residue detection typically uses liquid chromatography or gas chromatography, which are complex and costly, hindering large-scale application. CsABCI19 is a key gene regulating low propamocarb residue levels in cucumber fruits. Its promoter region exhibits natural variation and is significantly correlated with propamocarb residue levels in fruits. Therefore, developing molecular markers holds promise for rapidly identifying germplasm with low propamocarb residue levels in fruits during the seedling stage, thereby accelerating the breeding process.
[0003] my country's national food safety standard GB2763-2021, "Maximum Residue Limits for Pesticides in Food," stipulates that the maximum residue limit for cymoxanil in cucurbit vegetables is 5 mg / kg, but its maximum residue limit in eggplant and potatoes is only 0.3 mg / kg. To achieve stricter screening, the original standard has been reduced by one order of magnitude, using 0.5 mg / kg as the standard for distinguishing between high / low cymoxanil residue levels in cucumber fruits, aiming to achieve more stringent breeding applications and minimize consumer risk. (Invention Content)
[0004] This invention provides a dCAPS molecular marker for detecting promethazine residues in cucumber fruits and its application.
[0005] The dCAPS molecular marker used in this invention to detect the residual amount of cymoxanil in cucumber fruits is derived from the SNP at -158 of the CsABCI19 gene promoter.
[0006] Furthermore, the dCAPS molecular marker for detecting procymidone residues in cucumber fruits contains the upstream primer CsABCI19-dCAPS-F and the downstream primer CsABCI19-dCAPS-R. The sequence of the upstream primer CsABCI19-dCAPS-F is: 5'-AAGCAGGGAAGATGGTGGTTGGAGGATTGTAAAGGGTAGAAGAAGACCCCATG-3'; the sequence of the downstream primer CsABCI19-dCAPS-R is: 5'-ACTTCCCTCTATTGCTTAACTTCGTCGATCATAGCACATTTGGTCATT-3'.
[0007] The application of the dCAPS molecular marker in the detection of procymidone residues in cucumber fruits.
[0008] The method for detecting procymidone residues in cucumber fruits using dCAPS molecular markers according to the present invention is carried out according to the following steps:
[0009] 1. Extract DNA from the cucumber germplasm to be tested;
[0010] 2. DNA was subjected to PCR reaction using the upstream primer CsABCI19-dCAPS-F and the downstream primer CsABCI19-dCAPS-R as described in claim 2;
[0011] 3. The PCR product was digested with Nco I enzyme and two types of bands appeared. One was 491 bp, corresponding to SNP A, which is the low-downycarboxylic acid residue germplasm of the fruit; the other contained 444 bp and 48 bp, corresponding to SNP G, which was identified as the high-downycarboxylic acid residue germplasm of the fruit.
[0012] Furthermore, the PCR reaction system in step two is as follows: 1 μL DNA template, 1 μL each of upstream and downstream primers (10 pmol / L), 10 μL Taq enzyme premixed mix, and 7 μL ddH2O; the PCR program is: 95℃ for 5 min, 95℃ for 30 s, 69.5℃ for 30 s, and 72℃ for 30 s, repeated for 33 cycles, and 72℃ for 5 min.
[0013] Furthermore, the enzyme digestion reaction system in step three is as follows: 5 μL of the PCR product obtained in step two, 1 μL of Nco I, 5 μL of 10×rCutSmart buffer, and 39 μL of ddH2O; the enzyme digestion program is: 37℃ for 1 h, 65℃ for 30 min; the enzyme digestion product is mixed with 10 μL of 6×Loading buffer, and the bands are detected by 1% agarose gel electrophoresis (100V, 80A, 40 min).
[0014] In Example 2, the primer pair amplified a PCR product with a total length of 491 bp. The SNP (G) and two mismatched bases (C and G) formed an Nco I restriction site in D9320. When the Nco I restriction enzyme was used, the PCR product showed two band types after digestion: one was 491 bp, corresponding to SNP A; the other contained 444 bp and 48 bp, corresponding to SNP G.
[0015] The enzyme digestion products were mixed with 10 μL of 6× Loading buffer and analyzed by 1% agarose gel electrophoresis (100V, 80A, 40 min). It was found that the PCR product from D0351 could not be cleaved (band length 491 bp), while the PCR product from D9320 could be cleaved, with the 444 bp band being more prominent and the 48 bp band being weak and difficult to observe. Figure 4 (Validation of the dCAPS molecular marker and its application in germplasm resource identification). The banding results of this molecular marker in two inbred lines were consistent with expectations and could be clearly distinguished, indicating that the marker was successfully developed.
[0016] The verification results of the dCAPS molecular marker described in this invention in germplasm resources show that, in the band type, A represents 491 bp and B represents 444+48 bp. Among the 32 germplasm accessions, 6 accessions were below 0.5 mg / kg and were identified as low-propane-carbide residue germplasm in the fruit, while 26 accessions were above 0.5 mg / kg and were identified as high-propane-carbide residue germplasm in the fruit.
[0017] The molecular marker identification results of this invention are consistent with the phenotype. The dCAPS molecular marker described in this invention can rapidly identify cucumber germplasm resources with low downy mildew residues in the fruit, and is a good breeding-aided selection marker. Attached Figure Description
[0018] Figure 1 This is due to the SNP mutation effect of the CsABCI19 promoter;
[0019] Figure 2 Comparison of the CsABCI19 promoter SNP with the difference in fruit procymidone residue;
[0020] Figure 3 A diagram showing the Nco I restriction site;
[0021] Figure 4 To validate dCAPS molecular markers and their application in germplasm resource identification. Detailed Implementation
[0022] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0023] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.
[0024] Example 1: Source of dCAPS molecular markers
[0025] The high-generation cucumber inbred lines D0351 and D9320 were provided by the Cucumber Molecular Genetics and Breeding Laboratory of Northeast Agricultural University. Leaves of D0351 and D9320 were used to extract DNA as templates. The promoter sequence of the CsABCI19 gene (2000 bp upstream of the transcription start site, corresponding to the chromosomal physical location chr7:16324559-16326558 in the Chinese long v3 reference genome) was cloned using primers CsABCI19Prom-F (5'-TGGTGTTTAATAATTAATAT-3') and CsABCI19Prom-R (5'-TTGTGAAGAGAAAAACTGAG-3'). PCR system: 1 μL cDNA template, 1 μL each of upstream and downstream primers (10 pmol / L), 10 μL Taq enzyme premix, and 7 μL ddH2O. PCR program: 95℃ for 5 min, 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated for 36 cycles, 72℃ for 5 min. PCR products were ligated into the pMD-18T vector and sequenced multiple times. Four single-base substitutions (SNPs) were found in the promoter of the CsABCI19 gene in both inbred lines, located at positions -85, -158, -556, and -665.
[0026] The specific sequence is as follows: (direction from -1 to -2000, bold and underlined bases are SNPs, and the bases before and after ' / ' represent bases in inbred lines D0351 and D9320, respectively)
[0027] TTGTGAAGAGAAAAACTGAGGAAGATGGAGAATTGGGCAGAGAATTTAAAAACCCTTGTGGGGAATTAGCAGGGAATGAAGAAA T / G TTGGTGGGTGATTGTTCAAAAGCAGGGAAGATGGTGGTTGGAGGATTGTAAAGGGTAGAAGAAGACCACATT A / G GTTGGTTGTGAAGTTGAGGCTAGGATTTGATGCGCCATTGGAACACAACGTGGCAGTTGTTGAGATCAAAGAAACTGGAATTTCATCGCATTGAAAATGATAGATGTCGTGGAAGTTCGCGGGAAATTGGCGCACCGTCTTCTTGTTGGGGAAAGTTCGTACGGGAAGTATTTCTCGCATTCTCATTAGTTTGCTTTTAAGAATGGTGGAGATCTATTCAAATTAATGAACTCAATTTATTGGAAAATGGCAATGTGTAAGAATTTGAATTGGTATCTACTGATTGTGTCATACATATCTGATATTTTACAAATATGGATTTTAACTCTTTTTTACTCCACATTTTCCCTAAAAACTCACAATTGGTTGAGAAAGAAAAGCGGTAATCAATGACCAAA T / C GTGCTATGATCGACGAAGTTAAGCAATAGAGGGAAGTATAATGTCGATTGTAGATGGTACGAAACAATGCTAGTCGGTGAAAGAGAGATGTTAGAGGAAAGAAAGATC G / A
[0028] DNA was extracted from 32 core cucumber germplasms (Table 1) using the CTAB method. The CsABCI19 gene promoters of various germplasms were cloned using primers CsABCI19Prom-F and CsABCI19Prom-R. The products were ligated into the pMD18-T vector and sequenced multiple times to obtain complete and accurate promoter sequences. The data on downy mildew residues in the fruits of the 32 core germplasms are shown in Table 1 (Table 1 shows the downy mildew residues and band types in the fruits of the 32 cucumber germplasms). The effect of CsABCI19 gene promoter variation sites was analyzed using geneHapR. The highest effect value was found at the SNP at -158, with a variation effect value of -log... 10 The pValue is also the highest, and the mutation effect of the SNP at -665, -556, and -85 decreases sequentially. Figure 1 This is due to the SNP variation effect of the CsABCI19 promoter. Further site-by-site comparison revealed that only the SNP at site -158 (chr7:22924516) showed a highly significant difference in fruit procymidone residue (p<0.001), while there were no significant differences in fruit procymidone residue among the other three SNP sites. Figure 2 (Comparison of SNPs in the CsABCI19 promoter and the difference in procymidone residue levels in fruits). The results showed that the SNP at position -158 of the CsABCI19 promoter was a key variation site affecting procymidone residue levels in fruits.
[0029] Table 1. Residual amount and banding type of downy mildew in the fruits of 32 cucumber germplasms
[0030]
[0031] Example 2: Development of dCAPS molecular markers
[0032] The upstream and downstream 28bp sequences of the CsABCI19 gene promoter-158 SNP were introduced into dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html) to design mutant primers, considering only commonly used commercial endonucleases with recognition sequences of 6bp. Another primer was designed using Primer5 to ensure the product length was approximately 500bp; simultaneously, the mutant primers were appropriately extended to ensure the short fragment length after enzyme digestion was approximately 50bp, enabling clear differentiation in gel electrophoresis. Based on the analysis results, the dCAPS molecular marker primers were obtained, which include the upstream primer CsABCI19-dCAPS-F with the sequence 5'-AAGCAGGGAAGATGGTGGTTGGAGGATTGTAAAGGGTAGAAGAAGACCCCATG-3'; and the downstream primer CsABCI19-dCAPS-R with the sequence 5'-ACTTCCCTCTATTGCTTAACTTCGTCGATCATAGCACATTTGGTCATT-3'.
[0033] DNA was extracted from leaves of varieties D0351 and D9320 as templates. PCR was performed using the upstream primer CsABCI19-dCAPS-F and the downstream primer CsABCI19-dCAPS-R. The PCR reaction mixture consisted of 1 μL DNA template, 1 μL each of the upstream and downstream primers (10 pmol / L), 10 μL Taq polymerase premix, and 7 μL ddH2O. The PCR program was: 95℃ for 5 min, 95℃ for 30 s, 69.5℃ for 30 s, and 72℃ for 30 s, repeated 33 times, followed by 72℃ for 5 min. The PCR product was digested with NcoI. The digestion mixture consisted of 5 μL PCR product, 1 μL NcoI, 5 μL 10×rCutSmart buffer, and 39 μL ddH2O. The digestion program was: 37℃ for 1 h, followed by 65℃ for 30 min. The enzyme digestion products were mixed with 10 μL of 6× Loading buffer and analyzed by 1% agarose gel electrophoresis (100V, 80A, 40min). It was found that the PCR product from D0351 could not be cleaved (band length 491 bp), while the PCR product from D9320 could be cleaved, with the 444 bp band being more prominent and the 48 bp band being weak and difficult to observe. Figure 4 (Validation of the dCAPS molecular marker and its application in germplasm resource identification). The banding results of this molecular marker in two inbred lines were consistent with expectations and could be clearly distinguished, indicating that the marker was successfully developed.
[0034] Example 3: Validation of dCAPS molecular markers in germplasm resources
[0035] This molecular marker was validated in 32 core cucumber germplasm accessions, and the banding patterns were as follows: Figure 4 As shown ( Figure 4 This study validated the dCAPS molecular marker and its application in germplasm resource identification. The results showed that the molecular marker identification was consistent with the phenotype. Table 1 shows the specific identification and validation results of this marker, where band type A represents 491 bp and B represents 444+48 bp. Of the 32 germplasm accessions, 6 had a concentration below 0.5 mg / kg and were identified as low-permethrin residue germplasm in the fruit, while 26 had a concentration above 0.5 mg / kg and were identified as high-permethrin residue germplasm in the fruit. The molecular marker identification results were consistent with the phenotype. The dCAPS molecular marker described in this invention can rapidly identify cucumber germplasm resources with low permethrin residue in the fruit and is a good breeding-aided selection marker.
Claims
1. A dCAPS molecular marker for detecting procymidone residues in cucumber fruits, characterized in that, The dCAPS molecular marker is derived from the SNP at -158 of the CsABCI19 gene promoter.
2. The dCAPS molecular marker for detecting downy mildew residues in cucumber fruits according to claim 1, characterized in that, The dCAPS molecular marker contains an upstream primer CsABCI19-dCAPS-F and a downstream primer CsABCI19-dCAPS-R. The sequence of the upstream primer CsABCI19-dCAPS-F is: 5'-AAGCAGGGAAGATGGTGGTTGGAGGATTGTAAAGGGTAGAAGAAGACCCCATG-3'; the sequence of the downstream primer CsABCI19-dCAPS-R is: 5'-ACTTCCCTCTATTGCTTAACTTCGTCGATCATAGCACATTTGGTCATT-3'.
3. The application of the dCAPS molecular marker as described in claim 1 in the detection of procymidone residues in cucumber fruits.
4. The method for detecting the residue of cymoxanil in cucumber fruits using the dCAPS molecular marker as described in claim 1, characterized in that, The method for detecting procymidone residues in cucumber fruits using dCAPS molecular markers is performed according to the following steps:
1. Extract DNA from the cucumber germplasm to be tested; 2. DNA was subjected to PCR reaction using the upstream primer CsABCI19-dCAPS-F and the downstream primer CsABCI19-dCAPS-R as described in claim 2; 3. The PCR product was digested with Nco I enzyme and two types of bands appeared. One was 491 bp, corresponding to SNP A, which is the low-downycarboxylic acid residue germplasm of the fruit; the other contained 444 bp and 48 bp, corresponding to SNP G, which was identified as the high-downycarboxylic acid residue germplasm of the fruit.
5. The method for detecting procymidone residues in cucumber fruits using dCAPS molecular markers according to claim 4, characterized in that, The PCR reaction system in step two is as follows: 1 μL DNA template, 1 μL each of upstream and downstream primers (10 pmol / L), 10 μL Taq enzyme premixed mix, and 7 μL ddH2O; the PCR program is as follows: 95℃ for 5 min, 95℃ for 30 s, 69.5℃ for 30 s, 72℃ for 30 s, repeated for 33 cycles, and 72℃ for 5 min.
6. The method for detecting procymidone residues in cucumber fruits using dCAPS molecular markers according to claim 4, characterized in that, The enzyme digestion reaction system in step three is as follows: 5 μL of the PCR product obtained in step two, 1 μL of Nco I, 5 μL of 10×rCutSmart buffer, and 39 μL of ddH2O; the enzyme digestion program is: 37℃ for 1 h, 65℃ for 30 min; the enzyme digestion product is mixed with 10 μL of 6×Loading buffer and the bands are detected by 1% agarose gel electrophoresis (100V, 80A, 40 min).