A fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, its preparation method, and its application.

Abstract

This invention relates to a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, its preparation method, and its application, belonging to the field of microbial technology. This invention provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, prepared through pretreatment with a compound enzyme agent and fermentation with Lactobacillus. By pretreating mung bean seeds with a compound enzyme agent, this invention can efficiently degrade the fibrous structure of the mung bean seed epidermis, increase the flavonoid content in the Lactobacillus fermentation product, and also increase the available carbon source, thereby improving the biomass and fermentation efficiency of Lactobacillus and endowing the fermented mung bean seed product with superior repair, anti-aging, and anti-inflammatory effects.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, its preparation method, and its application. Background Technology

[0002] Flavonoids possess significant antioxidant, anti-inflammatory, and wrinkle-reducing effects, making them important active ingredients in functional cosmetics and health foods. Mung bean seed epidermis contains relatively high levels of flavonoids (such as flavonols, anthocyanins, and flavanols), but current extraction and fermentation enhancement technologies primarily rely on direct fermentation and single-microbial treatment. Both methods achieve efficient release and activity enhancement of flavonoids through microbial metabolic regulation or structural modification. Related research has developed a relatively mature technical system and received empirical support.

[0003] Fermentation of mung bean seeds using Lactobacillus yields products (lysate and filtrate) that are popular functional ingredients in the cosmetics industry. Metabolites produced during fermentation, such as proteases and glycosidases, can break the bonds between flavonoids and sugars, converting bound flavonoids into free flavonoids and significantly improving extraction efficiency. However, the presence of large amounts of cellulose and hemicellulose in the mung bean seed coat hinders flavonoid release, affecting the flavonoid release rate after Lactobacillus fermentation. Furthermore, traditional techniques for extracting flavonoids from mung bean seeds have limitations. Some methods (such as solvent extraction) are mature but contain many impurities, are costly, or are incompatible with the fermentation conditions (such as pH and temperature) of Lactobacillus, affecting the stability of the final product.

[0004] Therefore, there is an urgent need to develop a preparation method that can effectively improve the release of active ingredients in mung bean seeds in order to prepare mung bean seed extracts with superior biological activity. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, as well as its preparation method and application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a fermented mung bean seed product with enhanced anti-repair, anti-aging, and anti-inflammatory effects, which is prepared by pretreatment with a compound enzyme agent and fermentation with lactobacillus.

[0007] This invention pretreats mung bean seeds with a compound enzyme agent, which can efficiently degrade the fiber structure of the mung bean seed epidermis, increase the flavonoid content in the fermentation products of lactobacillus, and also increase the available carbon source, thereby improving the biomass and fermentation efficiency of lactobacillus and giving the fermented mung bean seed products better repair, anti-aging and anti-inflammatory effects.

[0008] In a preferred embodiment of the mung bean seed fermentation product of the present invention, the compound enzyme agent is an engineered bacterium expressing endoglucanase and xylanase; the lactobacillus expresses glutamate decarboxylase.

[0009] Secondly, the present invention provides a method for preparing a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, comprising the following steps: (1) The fermentation substrate containing mung bean seeds was mixed with a compound enzyme agent and fermented to obtain pretreated mung bean seeds; (2) Inoculate Lactobacillus into a culture medium containing the pretreated mung bean seeds obtained in step (1) and ferment to obtain mung bean seed ferment.

[0010] In a preferred embodiment of the preparation method described in this invention, in step (1), the composite enzyme agent is an engineered bacterium expressing endoglucanase and xylanase. This engineered bacterium can achieve continuous enzyme expression through genetic engineering (such as integrating a constitutive promoter), without the need for an inducer. It can efficiently degrade polysaccharides such as cellulose and xylan in mung bean seeds, releasing small molecule carbon sources such as glucose and xylose, as well as amino acid precursors (such as glutamic acid), providing sufficient substrate for subsequent lactobacillus fermentation.

[0011] In a preferred embodiment of the preparation method of the present invention, in step (1), the EC number of the endoglucanase is EC 3.2.1.4, and the EC number of the xylanase is EC 3.2.1.8.

[0012] In a preferred embodiment of the preparation method of the present invention, in step (1), the nucleotide sequence of the endoglucanase is shown in SEQ ID NO.1, and the nucleotide sequence of the xylanase is shown in SEQ ID NO.2.

[0013] As a preferred embodiment of the preparation method of the present invention, in step (1), the engineered bacteria expressing endoglucanase and xylanase are constructed by inserting the coding sequences of constitutive promoter, endoglucanase and xylanase into the starting strain through genetic engineering technology.

[0014] As a preferred embodiment of the preparation method of the present invention, in step (1), the starting strain includes at least one of Pichia pastoris, Saccharomyces cerevisiae and Escherichia coli.

[0015] As a preferred embodiment of the preparation method of the present invention, in step (1), the fermentation substrate containing mung bean seeds is prepared by mixing mung bean seed powder with water.

[0016] As a preferred embodiment of the preparation method of the present invention, in step (1), the mass ratio of mung bean seed powder to water in the fermentation substrate is mung bean seed powder: water = 1: (10-50).

[0017] As a preferred embodiment of the preparation method of the present invention, in step (1), the mass ratio of mung bean seed powder to water in the fermentation substrate is mung bean seed powder: water = 1: (20-40).

[0018] As a preferred embodiment of the preparation method of the present invention, in step (1), the mass ratio of mung bean seed powder to water in the fermentation substrate is mung bean seed powder: water = 1:30.

[0019] In a preferred embodiment of the preparation method of the present invention, in step (1), the final concentration of the compound enzyme agent after mixing with the fermentation substrate is 1×10⁻⁶ cells / day. 6 -1×10 8 CFU / mL.

[0020] In a preferred embodiment of the preparation method of the present invention, in step (1), the final concentration of the compound enzyme agent after mixing with the fermentation substrate is 1×10⁻⁶ cells / day. 7 CFU / mL As a preferred embodiment of the preparation method of the present invention, in step (1), the fermentation is carried out for 24-72 hours under the conditions of pH=4-6 and 30-37℃.

[0021] As a preferred embodiment of the preparation method of the present invention, in step (1), the fermentation is carried out for 48 hours under the conditions of pH=5 and 30°C.

[0022] As a preferred embodiment of the preparation method of the present invention, in step (1), the compound enzyme agent can be replaced with a compound enzyme preparation, which includes endoglucanase and xylanase.

[0023] As a preferred embodiment of the preparation method of the present invention, in step (1), the enzyme activity ratio of endoglucanase and xylanase in the composite enzyme preparation is endoglucanase: xylanase = 10: (8-10).

[0024] As a preferred embodiment of the preparation method of the present invention, in step (1), the ratio of the compound enzyme preparation to the fermentation substrate containing mung bean seeds is compound enzyme preparation: fermentation substrate containing mung bean seeds = (18-20)U:1g.

[0025] As a preferred embodiment of the preparation method of the present invention, in step (2), the pretreated mung bean seeds obtained in step (1) are sterilized before being inoculated with lactobacillus.

[0026] As a preferred embodiment of the preparation method described in this invention, in step (2), the sterilization treatment is high-temperature steam sterilization.

[0027] In a preferred embodiment of the preparation method of the present invention, in step (2), the lactobacillus is a lactobacillus that produces γ-aminobutyric acid.

[0028] As a preferred embodiment of the preparation method of the present invention, in step (2), the γ-aminobutyric acid-producing lactobacillus expresses glutamate decarboxylase GadB.

[0029] As a preferred embodiment of the preparation method of the present invention, in step (2), the nucleotide sequence of the glutamate dehydrogenase GadB is as shown in SEQ ID NO.3.

[0030] In a preferred embodiment of the preparation method described in this invention, in step (2), the EC number of the glutamate decarboxylase is EC 4.1.1.15.

[0031] As a preferred embodiment of the preparation method of the present invention, in step (2), the activity of the glutamate decarboxylase is ≥13.9 U / mL.

[0032] As a preferred embodiment of the preparation method of the present invention, in step (2), the culture medium containing the pretreated mung bean seeds obtained in step (1) includes the pretreated mung bean seeds and the basal culture medium.

[0033] As a preferred embodiment of the preparation method of the present invention, in step (2), the volume ratio of the pretreated mung bean seeds to the basic culture medium is pretreated mung bean seeds: basic culture medium = (6-8): (2-4).

[0034] As a preferred embodiment of the preparation method of the present invention, in step (2), the volume ratio of the pretreated mung bean seeds to the basic culture medium is 7:3.

[0035] As a preferred embodiment of the preparation method of the present invention, in step (2), the basic culture medium includes the following components: yeast powder 3-6 g / L, peptone 8-12 g / L, glucose 18-25 g / L, sodium acetate 4-6 g / L, diammonium citrate 1-3 g / L, MgSO4·7H2O 0.1-0.3 g / L, MnSO4·H2O 0.03-0.08 g / L, K2HPO4·3H2O 1-3 g / L, and Tween-80 0.5-2 mL / L.

[0036] As a preferred embodiment of the preparation method of the present invention, in step (2), the basic culture medium includes the following components: yeast powder 4g / L, peptone 10g / L, glucose 20g / L, sodium acetate 5g / L, diammonium citrate 2g / L, MgSO4·7H2O 0.2g / L, MnSO4·H2O 0.05g / L, K2HPO4·3H2O 2g / L, and Tween-80 1mL / L.

[0037] As a preferred embodiment of the preparation method of the present invention, in step (2), the volume of the lactobacillus accounts for 5-10 v / v of the sum of the volume of the lactobacillus and the culture medium containing the pretreated mung bean seeds.

[0038] As a preferred embodiment of the preparation method of the present invention, in step (2), the fermentation is anaerobic fermentation at 35-40℃ and pH=5-6.5 for 24-72h.

[0039] As a preferred embodiment of the preparation method of the present invention, in step (2), the fermentation is anaerobic fermentation at 37°C and pH=5-6.5 for 48 hours.

[0040] As a preferred embodiment of the preparation method described in this invention, the mung bean seed fermentation product obtained in step (2) is centrifuged at 8000-10000 r / min for 15-25 min, and the supernatant is filtered through a filter membrane with a pore size of 0.22 μm to obtain the mung bean seed fermentation filtrate. The precipitate is washed twice with water, and the OD is controlled. 600 =10 After homogenization, the fermented lysate of mung bean seeds was obtained.

[0041] As a preferred embodiment of the preparation method described in this invention, the mung bean seed fermentation product obtained in step (2) is centrifuged at 9000 r / min for 20 min, and the supernatant is filtered through a filter membrane with a pore size of 0.22 μm to obtain the mung bean seed fermentation filtrate.

[0042] Thirdly, the present invention provides the application of the above-mentioned mung bean seed fermentation product in the preparation of repair and / or anti-aging and / or anti-inflammatory products.

[0043] As a preferred embodiment of the application described in this invention, the article includes at least one of cosmetics, pharmaceuticals, and food.

[0044] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention utilizes a composite enzyme agent containing endoglucanase and xylanase to pretreat mung bean seeds, which can synergistically act on the epidermal fiber structure of mung bean seeds. On the one hand, it breaks down the fiber barrier, making it easier for flavonoids to be released during subsequent lactic acid bacteria fermentation. On the other hand, it degrades proteins and / or polysaccharides in mung bean seeds to generate glutamic acid (a key precursor for the synthesis of γ-aminobutyric acid), providing a core substrate for the metabolism of γ-aminobutyric acid-producing lactic acid bacteria. From the process mechanism, it ensures the synchronous and efficient synthesis of flavonoids and γ-aminobutyric acid, solving the pain point of traditional fermentation that produces only one active ingredient.

[0045] (2) This invention improves the flavonoids in mung bean seed ferment by selecting compound enzyme agents for pretreatment and synergistic fermentation with lactobacillus. At the same time, the mung bean seed ferment also contains γ-aminobutyric acid, which can effectively form a dual functional system of "flavonoids (anti-aging and anti-inflammatory) + γ-aminobutyric acid (repair and soothe)", significantly expanding the application scenarios of the product in health products, skin care products, functional foods and other fields, and enhancing the market competitiveness of the technology. Attached Figure Description

[0046] Figure 1 The results of the repair effect measurement in Example 2 of the present invention; Figure 2 In Example 2 of this invention, the anti-aging effect is achieved by the type I collagen gene ( col1a1a, col1a1b and col1a2 ) Expression level measurement results; Figure 3 In Example 2 of the present invention, the elastin gene ( Elna ) Expression level measurement results; Figure 4 The results of the anti-inflammatory effect measurement are shown in Example 2 of the present invention. Detailed Implementation

[0047] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0048] Unless otherwise specified, all other materials and reagents used in the examples, comparative examples, and effect examples are commercially available.

[0049] Lactobacillus 1 mentioned in the following examples and comparative examples is a type of lactobacillus. Lentilactobacillus buchneri WPZ001, derived from "Research on Efficient Production of γ-aminobutyric Acid by Microbial Fermentation" (Zhao Anqi, 2017, Jiangnan University), expresses glutamate decarboxylase GadB. The nucleotide sequence of glutamate decarboxylase GadB is shown in SEQ ID NO.3. The activity of glutamate decarboxylase was detected to be 13.9 U / mg cell protein.

[0050] The Lactobacillus 2 is a model strain of Lactobacillus. Lentilactobacillus buchneri DSM 20057 was purchased from Shanghai Sangon Biotech Co., Ltd., with product number DSM-20057. The glutamate decarboxylase activity was tested to be 1 U / mg bacterial protein. The compound enzyme agent 1 is a recombinant Pichia pastoris engineered strain constitutively expressing endoglucanase and xylanase. The nucleotide sequence of the endoglucanase is shown in SEQ ID NO.1, and the nucleotide sequence of the xylanase is shown in SEQ ID NO.2. The constitutive expression of endoglucanase and xylanase is indicated by linking the expression sequences of endoglucanase and xylanase to a constitutive promoter (such as the GAP promoter), thereby enabling the transcription of endoglucanase and xylanase to be initiated by the constitutive promoter. SEQ ID NO.1: ATGAAGTTGCCTGTTTCACTTGCAATGCTAGCAGCCACAGCCATGGGTCAGACCATGTGTTCTCAATACGACTCCGCCTCCAGTCCACCTTACTCTGTTAATCAGAATCTGTGGGGCGAATACCAGGGAACCGGATCACAATGCGTGTATGTCGATAAGTTGTCCTCTTCTGGCGCCAGTTGGCATACCGAGTGGACATGGTCTGGTGGTGAGGGAACTGTCAAGTCATATTCCAACTCCGGAGTTACTTTTAATAAGAAGCTGGTGAGTGACGTGTCATCTATCCCCACTTTAGTCGAGTGGAAGCAAGATAACACAAATGTTAACGCTGATGTTGCTTACGACTTGTTTACAGC TGCAAATGTTGATCACGCCACAAGTTCTGGTGATTACGAGCTGATGATTTGGCTTGCAAGGTATGGAAATATCCAGCCTATAGGAAAACAAATTGCTACCGCAACCGTTGGAGGTAAGTCTTGGGAGGTTTGGTATGGAAGTACTACTCAAGCTGGCGCCGAGCAGAGGACTTACTCTTT CGTCTCAGAGGTCTCCAATTAATTCATATTCTGGTGATATCAACGCTTTCTTTTCATACCTAACCCAGAATCAAGGATTCCCAGCCTCTAGTCAGTACCTGATAAACCTTCAATTTGGTACTGAAGCTTTTACCGGAGGTCCAGCCACTTTTACAGTCGACAACTGGACCGCCTCCGTAAAT SEQ ID NO.2:

[0051] The recombinant Pichia pastoris engineered strain constitutively expressing endoglucanase and xylanase can be constructed using genetic engineering techniques (including but not limited to CRISPR technology, seamless cloning technology, etc.), provided that the recombinant Pichia pastoris can express the enzymes of SEQ ID NO. 1-2. The construction method of the recombinant Pichia pastoris engineered strain used in the following examples and comparative examples is as follows: S1, the endoglucanase gene Aucel12A (GenBank accession number: JN128871), is derived from Aspergillus yusami. Aspergillus usamii E001, the xylanase gene Aoxyn11A (Gen Bank accession number: XM_001823746) is derived from Aspergillus oryzae ( Aspergillus oryzae CICC41086, after codon optimization of the Aoxyn11A and Aucel12A genes, the gene sequences were synthesized by Genewiz Biotechnology Co., Ltd. (Suzhou). The codon-optimized Aucel12A nucleotide sequence is shown in SEQ ID NO.1, and the codon-optimized Aoxyn11A nucleotide sequence is shown in SEQ ID NO.2. S2. Using a one-step cloning kit (such as Gibson assembly) ® Following the instructions of the cloning kit (NEB, E5510S), using pGAPZαA as the vector, expression plasmids pGAPZαA-P (linked to Aucel12A), pGAPZαA-M (linked to Aoxyn11A), and pGAPZαA-PM (linked to Aucel12A and Aoxyn11A) were constructed. After being transformed into E. coli DH5α, positive transformants were obtained by colony PCR verification and gene sequencing screening. S3. Linearization of the correct recombinant expression plasmids by single enzyme digestion: XmaJI restriction endonuclease was used for enzyme digestion to obtain linearized recombinant plasmids (pGAPZαA-P, pGAPZαA-M, pGAPZαA-PM); the linearized recombinant plasmids were introduced into Pichia pastoris GS115 competent cells by electroporation, and colony PCR was used for preliminary verification. Subsequently, gene sequencing analysis was used to finally screen out the recombinant strains that met the expectations, and the secretory expression of endonuclease and xylanase was successfully achieved.

[0052] The primer sequences used are as follows (5'-3'): Amplification of the endoglucanase gene Aucel12A: PF:ATGAAGTTGCCTGTTTCACTTG; PR:ATTTACGGAGGCGGTCCA; Amplification of the xylanase gene Aoxyn11A: MF:ATGGTCTCATTCTCAAGTATCCT; MR:TCAATAAACGGTAATAGCAGAGGAAC; Amplifying the pGAPZαA vector containing the complementary fragment of the endoglucanase gene Aucel12A: GAP-MF:CTGCTATTACCGTTTATTGAGAATTCACGTGGATGGGC; GAP-MR:ACTTGAGAATGAGACCATCCATCTCCATCTCCTTCTCC; Amplifying the pGAPZαA vector containing the complementary fragment of the xylanase gene Aoxyn11A: GAP-PF:ACCGCCTCCGTAAATATGTGGTCTAGGAGATGGAG; GAP-PR:GAAACAGGCAACTTCATAGCTTCAGCCTCTCTTTTCT; Amplifying the pGAPZαA-P vector containing complementary fragments of the endoglucanase gene Aucel12A and the xylanase gene Aoxyn11A: PM-F:ACCGCCTCCGTAAATATGTGGTCTAGGAGATGGAGAAGGAGATGGAGATGGATGGTCTCATTCTCA; PM-R: TGAGAATGAGACCATCCATCTCCATCTCCTTCTCCATCTCCTAGACCACATATTTACGGAGGCGGT.

[0053] The compound enzyme agent 2 is a recombinant Pichia pastoris engineered strain constitutively expressing endoglucanase, and the amino acid sequence of the endoglucanase is shown in SEQ ID NO.1; The compound enzyme agent 3 is a recombinant Pichia pastoris strain constitutively expressing xylanase, the amino acid sequence of which is shown in SEQ ID NO.2. The construction methods for compound enzyme agents 2 and 3 are the same as those for compound enzyme agent 1, and recombinant Pichia pastoris strains expressing only endoglucanase or xylanase are constructed according to the intended purpose.

[0054] Both the aforementioned Lactobacillus and recombinant Pichia pastoris engineered strains were cultured using a basal culture medium, which included the following components: yeast extract 4 g / L, peptone 10 g / L, glucose 20 g / L, sodium acetate 5 g / L, diammonium citrate 2 g / L, MgSO4·7H2O 0.2 g / L, MnSO4·H2O 0.05 g / L, K2HPO4·3H2O 2 g / L, and Tween-80 1 mL / L.

[0055] The inoculation amount mentioned below refers to the ratio of the volume of the inoculated bacterial solution to the sum of the volumes of the inoculated bacterial solution and the culture medium. For example, a 10% inoculation amount means 10 mL of inoculated bacterial solution is inoculated into 90 mL of culture medium.

[0056] Example 1 This embodiment provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: S1. Grind the mung bean seeds with a grinder, pass them through a 60-mesh sieve, weigh out 100g of mung bean seed powder and mix it with 3L of sterile water to prepare a fermentation substrate containing mung bean seeds. S2. The fermentation substrate containing mung bean seeds obtained in step S1 is mixed with compound enzyme agent 1 to form a mixture, wherein the final concentration of compound enzyme agent 1 in the mixture is 1×10⁻⁶. 7 CFU / mL was fermented in a bioreactor under the following conditions: 30℃, pH=5.0, stirring at 220r / min for 48h. After fermentation, the mixture was transferred to a high-temperature steam sterilizer and sterilized at 115℃ for 15min to obtain pretreated mung bean seeds. S3. Mix the pretreated mung bean seeds obtained in step S2 with the basic culture medium at a ratio of pretreated mung bean seeds: basic culture medium = 7:3 (v / v), adjust the pH to 6.0, and transfer to a high-temperature steam sterilizer to sterilize at 115°C for 15 min to obtain a culture medium containing pretreated mung bean seeds. S4. Inoculate Lactobacillus 1 at an inoculation rate of 10% into the culture medium containing pretreated mung bean seeds obtained in step S3, and ferment under anaerobic conditions at 37°C for 48 hours to obtain mung bean seed fermentation product. S5. Centrifuge the mung bean seed fermentation product obtained in step S4 at 9000 r / min for 20 min, and filter the supernatant through a filter membrane with a pore size of 0.22 μm to obtain the mung bean seed fermentation filtrate; wash the precipitate twice with sterile water and control the OD. 600 =10, after homogenization, the fermented lysate of mung bean seeds was obtained.

[0057] Example 2 This embodiment provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: In step S1, 100g of mung bean seed powder is mixed with 2L of sterile water to prepare a fermentation substrate containing mung bean seeds; In step S2, the final concentration of the compound enzyme agent 1 in the mixture is 1×10⁻⁶. 8 CFU / mL, fermentation conditions were 37℃, pH=6.0, and stirring at 220r / min for 24h; In step S3, the pretreated mung bean seeds obtained in step S2 are mixed with the basal culture medium at a ratio of pretreated mung bean seeds: basal culture medium = 6:4 (v / v); In step S4, the inoculum size of Lactobacillus 1 is 5%; The remaining steps and their parameters remain unchanged.

[0058] Example 3 This embodiment provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: In step S1, the 100g mung bean seed powder is mixed with 4L of sterile water to prepare a fermentation substrate containing mung bean seeds; In step S2, the final concentration of the compound enzyme agent 1 in the mixture is 1×10⁻⁶. 6 CFU / mL, fermentation conditions were 35℃, pH=4.0, and stirring at 220r / min for 72h; In step S3, the pretreated mung bean seeds obtained in step S2 are mixed with the basal culture medium at a ratio of pretreated mung bean seeds: basal culture medium = 8:2 (v / v); In step S4, the inoculum size of Lactobacillus 1 is 8%; The remaining steps and their parameters remain unchanged.

[0059] Example 4 This embodiment provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: In step S2, the compound enzyme agent is replaced with a compound enzyme agent, and the specific operation is as follows: S2. The fermentation substrate containing mung bean seeds obtained in step S1 is mixed with the compound enzyme agent to form a mixture. 18U of compound enzyme agent is added to every 1g of fermentation substrate containing mung bean seeds. The enzyme activity ratio of endoglucanase to xylanase in the compound enzyme agent is 10:8 (endoglucanase: xylanase). Enzymatic hydrolysis is carried out in a bioreactor under the following conditions: 30℃, pH=5.0, stirring at 220r / min for 48h. After fermentation, the mixture is transferred to a high-temperature steam sterilization device for high-temperature sterilization at 115℃ for 15min to obtain pretreated mung bean seeds. The remaining steps and their parameters remain unchanged.

[0060] Comparative Example 1 This comparative example provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: A1. Crush the mung bean seeds with a grinder and pass them through a 60-mesh sieve. Mix the mung bean seed powder with the basal culture medium at a ratio of pretreated mung bean seeds to basal culture medium of 7:3 (w / v). Adjust the pH to 6.0 and transfer the mixture to a high-temperature steam sterilizer at 115°C for 15 minutes to obtain a culture medium containing mung bean seeds. A2. Inoculate Lactobacillus 1 at an inoculation rate of 10% into the culture medium containing mung bean seeds obtained in step A1, and ferment it in a biological reaction. The fermentation conditions are anaerobic fermentation at 37℃ for 48 hours to obtain mung bean seed fermentation product. A3. Mix the mung bean seed fermentation product obtained in step A2 with compound enzyme agent 1 to form a mixture, wherein the final concentration of the compound enzyme agent in the mixture is 1×10⁻⁶. 7CFU / mL was fermented in a bioreactor under the following conditions: 30℃, pH=5.0, stirring at 220r / min for 48h. After fermentation, the product was transferred to a high-temperature steam sterilizer and sterilized at 115℃ for 15min to obtain the processed mung bean seed fermentation product. A4. Centrifuge the mung bean seed fermentation product obtained in step A3 at 9000 r / min for 20 min. Filter the supernatant through a 0.22 μm pore size filter membrane to obtain the mung bean seed fermentation filtrate. Wash the precipitate twice with sterile water and control the OD. 600 =10, after homogenization, the fermented lysate of mung bean seeds was obtained.

[0061] Comparative Example 2 This comparative example provides a fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method includes the following steps: B1. Crush the mung bean seeds with a grinder and pass them through a 60-mesh sieve. Mix the mung bean seed powder with the basal culture medium at a ratio of pretreated mung bean seeds to basal culture medium of 7:3 (w / v). Adjust the pH to 6.0 and transfer the mixture to a high-temperature steam sterilizer at 115°C for 15 minutes to obtain a culture medium containing mung bean seeds. B2. Inoculate Lactobacillus 1 at an inoculation rate of 10% into the culture medium containing mung bean seeds obtained in step B1, and ferment it in a bioreactor under anaerobic fermentation conditions of 37℃ for 48 hours to obtain mung bean seed fermentation product. B3. Centrifuge the mung bean seed fermentation product obtained in step B2 at 9000 r / min for 20 min. Filter the supernatant through a 0.22 μm pore size filter membrane to obtain the mung bean seed fermentation filtrate. Wash the precipitate twice with sterile water and control the OD. 600 =10, after homogenization, the fermented lysate of mung bean seeds was obtained.

[0062] Comparative Example 3 This comparative example provides a fermented mung bean seed extract with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method is similar to that of Example 1, except that: In step S2, the compound enzyme agent 1 is replaced with compound enzyme agent 2, while the remaining steps and parameters remain unchanged.

[0063] Comparative Example 4 This comparative example provides a fermented mung bean seed extract with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method is similar to that of Example 1, except that: In step S2, the compound enzyme agent 1 is replaced with compound enzyme agent 3, while the remaining steps and parameters remain unchanged.

[0064] Comparative Example 5 This comparative example provides a fermented mung bean seed extract with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method is similar to that of Example 1, except that: In step S3, the ratio of pretreated mung bean seeds to basal culture medium in the culture medium containing pretreated mung bean seeds is 3:7 (v / v), and the remaining steps and parameters remain unchanged.

[0065] Comparative Example 6 This comparative example provides a fermented mung bean seed extract with enhanced repair, anti-aging, and anti-inflammatory effects, and its preparation method. The preparation method is similar to that of Example 1, except that: In step S4, Lactobacillus 1 is replaced with Lactobacillus 2, while the remaining steps and parameters remain unchanged.

[0066] Example 1 To evaluate the effect of the combined treatment of compound enzyme agent and lactobacillus on the active components of mung bean seed fermentation products, the contents of reducing sugar, flavonoids, polyphenols, total nitrogen and γ-aminobutyric acid in the products of Examples 1-4 and Comparative Examples 1-6 were detected. The reducing sugar was measured using the pretreated mung bean seeds obtained in step S2, the treated mung bean seed fermentation products obtained in step A2, and the mung bean seed fermentation products obtained in step B2 as samples. The remaining indicators were measured using the mung bean seed fermentation filtrate as samples. The results are shown in Table 1.

[0067] The reducing sugar content was determined by the DNS method, the flavonoid content by the aluminum salt complexation spectrophotometric method, the polyphenol content by the Folin-Ciocalteu method, and the total nitrogen by the Kjeldahl method. The above methods can be performed using commercially available kits with the same principle, or by referring to the operating procedures disclosed in existing technologies such as "Biochemical Experiments" (edited by Chen Junhui, published by Science Press in 2014) and "Plant Chemistry Experiments" (Zhao Zijian et al., published by Xi'an University of Electronic Science and Technology Press in 2013).

[0068] γ-aminobutyric acid (GABA) was determined by HPLC using a C18 column (4.6 mm × 250 mm, 5 μm), a mobile phase of methanol-0.05 mol / L potassium dihydrogen phosphate buffer (pH=6.0) = 40:60 (v / v), a detection wavelength of 254 nm, a column temperature of 30 ℃, a flow rate of 1.0 mL / min, and external standard method for quantification.

[0069] Table 1. Results of determination of active ingredient content in different mung bean seed ferments As shown in Table 1, the mung bean seed fermentation product / fermentation filtrate obtained in the examples had higher contents of reducing sugars, flavonoids, polyphenols, total nitrogen, and γ-aminobutyric acid, indicating that the present invention effectively improves the active ingredients in the mung bean seed fermentation filtrate, giving it more diverse effects. Among these, compared with Example 1, the indicators in Example 4 were slightly lower, indicating that using existing endoglucanase and xylanase as a compound enzyme preparation can also release the cell contents of mung bean seeds, thereby increasing the content of various active ingredients in the mung bean seed fermentation filtrate.

[0070] Compared to Comparative Examples 1 and 2, the contents of various active ingredients in the Example were higher. This indicates that performing Lactobacillus fermentation first, followed by treatment with a compound enzyme agent (recombinant Pichia pastoris engineered strain), or omitting the compound enzyme agent treatment step, would lead to the inhibition of Pichia pastoris enzyme production activity by Lactobacillus metabolites. Furthermore, insufficient cell wall disruption of mung bean seeds affected the release of cell contents, making it difficult for Lactobacillus to access the active substances within the mung bean seed cells, thus failing to significantly increase the content of various active ingredients in the mung bean seed fermentation filtrate. Simultaneously, because the mung bean seed cell walls were not sufficiently disrupted, the resulting glutamate content was low, restricting the pathway for Lactobacillus to synthesize γ-aminobutyric acid (GABA). This prevented an increase in the content of active ingredients such as flavonoids and polyphenols in the mung bean seed fermentation filtrate, and also failed to increase the yield of GABA from Lactobacillus.

[0071] Compared to Comparative Examples 3-4, the contents of various active ingredients in the Examples were higher. This indicates that if mung bean seeds are treated with a compound enzyme agent that expresses only endoglucanase or xylanase, the cell walls of the mung bean seeds cannot be fully broken down, thus affecting the utilization of the mung bean seed cell contents by Lactobacillus and reducing the contents of active ingredients such as flavonoids, polyphenols, and γ-aminobutyric acid (GABA). Meanwhile, the combined GABA content of Comparative Examples 3 and 4 was much lower than that of the Examples, indicating that the combination of endoglucanase and xylanase can synergistically increase the GABA production of Lactobacillus.

[0072] Compared with Comparative Example 5, the contents of various active ingredients in the Example are higher, indicating that the mung bean seed fermentation filtrate obtained by the present invention can only achieve the characteristics of high active ingredients under specific parameter conditions. If the parameter conditions are adjusted to unsuitable conditions, the yield of active ingredients such as flavonoids and polyphenols will decrease significantly, and the purpose of achieving the multiple effects of mung bean seed fermentation filtrate cannot be achieved.

[0073] Compared with Comparative Example 6, the contents of various active ingredients in the Example are higher. This indicates that if the Lactobacillus described in this invention is replaced with Lactobacillus that produces less γ-aminobutyric acid (GABA), the GABA production in the mung bean seed fermentation filtrate will decrease significantly. At the same time, the contents of active ingredients such as flavonoids and polyphenols will also decrease. GABA is one of the main components in the mung bean seed fermentation filtrate that plays a repair role. The decrease in GABA content means that the repair effect of the mung bean seed fermentation filtrate will also decrease, which does not meet the purpose of enhancing the repair effect of this invention. It can be seen that specific types of Lactobacillus need to be selected to obtain the mung bean seed fermentation filtrate with the effects described in this invention.

[0074] Example 3 To evaluate the efficacy of the mung bean seed fermentation product obtained in this invention, the mung bean seed fermentation filtrate obtained in Example 1 was subjected to repair, anti-aging, and anti-inflammatory efficacy tests. The specific method is as follows: I. Repairing effects.

[0075] The fermented mung bean filtrate of each group was mixed with ultrapure water to prepare fermented mung bean filtrate with final concentrations of 5%, 10%, and 20% (v / v) respectively.

[0076] Zebrafish embryonic caudal fins were used as test subjects for repair and promotion experiments. Embryos with removed caudal fins were exposed to mung bean seed fermentation filtrate samples at concentrations of 20%, 10%, and 5% of the formulated product. A blank control group (embryos without caudal fin removal) and a model control group (embryos with removed caudal fins but not exposed to mung bean seed fermentation filtrate) were also set up. After 48 hours of exposure, the embryos were photographed under a microscope, and the regenerated caudal fin length was measured and statistically analyzed. The results are shown below. Figure 1 Each treatment group had 8 replicates.

[0077] like Figure 1 As shown, the fermented mung bean seed filtrate, at concentrations of 20%, 10%, and 5% in the formula, promoted the repair of zebrafish embryo tail fins by 28% (…). p =0.0000013), 13% p =0.0031) and 13% ( p =0.0062). This indicates that the fermented mung bean seed of the present invention can significantly promote the regeneration of the tail fin of zebrafish embryos and has a repair-promoting effect.

[0078] II. Anti-aging effects.

[0079] Each group of mung bean seed fermentation filtrate was mixed with ultrapure water to prepare mung bean seed fermentation filtrate sample solutions with final concentrations of 5%, 10%, and 20% (v / v).

[0080] Six-day-old zebrafish were used as test subjects to evaluate anti-aging efficacy. The six-day-old zebrafish were exposed to mung bean seed fermentation filtrate samples at concentrations of 20%, 10%, and 5% of the formulated product, respectively. A blank control group (not exposed to mung bean seed fermentation filtrate) was also included. After 24 hours of exposure, RNA was extracted from the zebrafish, cDNA was synthesized, and real-time PCR amplification was performed. β-actin As a housekeeping gene, Ct is used as the amplification result for calculation. col1a1a, col1a1b , col1a2 and Elna The relative expression levels were analyzed and statistically analyzed. The results are shown in […]. Figure 2-3 Each treatment group had 12 replicates.

[0081] like Figure 2 As shown, the effects of mung bean seed fermentation filtrate at a 20% formulation concentration on zebrafish... col1a1a, col1a1b and col1a2 The gene expression promotion rate was 39% ( p =0.0046), 51% ( p =0.00028), 60% ( p =0.0020). The effect of mung bean seed fermentation filtrate at a 10% formulation concentration on zebrafish... col1a1a, col1a1b and col1a2 The gene expression promotion rate was 35% ( p =0.033), 50% ( p =0.0030), 110% ( p =0.00012). The sample at a 5% formulation concentration was effective against zebrafish. col1a1a, col1a1b and col1a2 The gene expression promotion rate was 19% ( p =0.042), -19%( p =0.0030), 43% ( p =0.00048), indicating that the mung bean seed ferment of the present invention can significantly promote the expression of type I collagen gene in zebrafish, promote the regeneration of type I collagen, and has anti-wrinkle and firming effects.

[0082] like Figure 3 As shown, the effects of mung bean seed fermentation filtrate on zebrafish were investigated at concentrations of 20%, 10%, and 5% of the formulation. Elna The gene expression promotion rate was 82% ( p =0.000010), 94% ( p =0.000018) and 24% ( p =0.0066), indicating that the mung bean seed ferment of the present invention can significantly promote zebrafish growth. ElnaGene expression promotes elastin regeneration, resulting in anti-wrinkle and firming effects.

[0083] III. Anti-inflammatory effects.

[0084] The fermented mung bean filtrate of each group was mixed with ultrapure water to prepare fermented mung bean filtrate with final concentrations of 5%, 10%, and 20% (v / v) respectively.

[0085] Anti-inflammatory efficacy was tested using zebrafish embryos. The embryos were exposed to mung bean seed fermentation filtrate solutions at concentrations of 10µM anhydrous copper sulfate + 20%, 10µM anhydrous copper sulfate + 10%, and 10µM anhydrous copper sulfate + 5%. A blank control group (not exposed to anhydrous copper sulfate or mung bean seed fermentation filtrate) and a model control group (exposed only to anhydrous sodium sulfate) were also set up. After 40 min of exposure, the embryos were fixed and stained with Sudan Black. The number of neutrophils in the lateral line region was counted and statistically analyzed. The results are shown below. Figure 4 Each treatment group had 6 replicates.

[0086] like Figure 4 As shown, the fermented mung bean seed filtrate inhibited neutrophil aggregation in zebrafish embryos at concentrations of 20%, 10%, and 5%, respectively, with inhibition rates of 48% ( ). p =0.00000000046), 21% p =0.0027) and 23% ( p =0.0010), indicating that the fermented mung bean seed filtrate of the present invention can significantly inhibit the aggregation of neutrophils in zebrafish embryos and has a soothing and anti-inflammatory effect.

[0087] In summary, this invention significantly improves the fermentation efficiency of Lactobacillus by pretreating mung bean seeds with recombinant Pichia pastoris engineered strains expressing endoglucanase and xylanase. The resulting fermentation product filtrate is rich in active ingredients such as GABA, flavonoids, polyphenols, and polypeptides, exhibiting significant repair, anti-inflammatory, and anti-aging properties. Furthermore, the method for preparing mung bean seed fermentation products in this invention provides a new avenue for the high-value utilization of mung beans, and the products can be used in fields such as cosmetics.

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A fermented mung bean seed product with enhanced repair, anti-aging, and anti-inflammatory effects, characterized in that, The mung bean seed ferment was prepared by pretreatment with a compound enzyme agent and fermentation with lactobacillus.

2. The fermented mung bean seed product as described in claim 1, characterized in that, The compound enzyme agent is an engineered bacterium expressing endoglucanase and xylanase; the lactobacillus expresses glutamate decarboxylase.

3. The method for preparing the mung bean seed fermentation product with enhanced repair, anti-aging, and anti-inflammatory effects as described in any one of claims 1-2, characterized in that, Includes the following steps: (1) The fermentation substrate containing mung bean seeds was mixed with a compound enzyme agent and fermented to obtain pretreated mung bean seeds; (2) Inoculate Lactobacillus into a culture medium containing the pretreated mung bean seeds obtained in step (1) and ferment to obtain mung bean seed ferment.

4. The preparation method according to claim 3, characterized in that, In step (1), the compound enzyme agent is an engineered bacterium expressing endoglucanase and xylanase.

5. The preparation method according to claim 3, characterized in that, Includes at least one of the following (I)-(III): (I) In step (1), the fermentation substrate containing mung bean seeds is prepared by mixing mung bean seed powder with water; (II) In step (1), the final concentration of the compound enzyme agent after mixing with the fermentation substrate is 1×10⁻⁶. 6 -1×10 8 CFU / mL; (III) In step (1), the fermentation is carried out at pH=4-6 and 30-37℃ for 24-72h.

6. The preparation method according to claim 3, characterized in that, In step (1), the compound enzyme agent can be replaced with a compound enzyme preparation, which includes endoglucanase and xylanase.

7. The preparation method according to claim 6, characterized in that, Includes at least one of the following (Ⅳ)-(Ⅴ): (IV) In step (1), the enzyme activity ratio of endoglucanase and xylanase in the compound enzyme preparation is endoglucanase: xylanase = 10: (8-10). (V) In step (1), the ratio of the compound enzyme preparation to the fermentation substrate containing mung bean seeds is compound enzyme preparation: fermentation substrate containing mung bean seeds = (18-20)U:1g.

8. The preparation method according to claim 3, characterized in that, Includes at least one of (VI)-(X): (VI) In step (2), the lactobacillus is a lactobacillus that produces γ-aminobutyric acid; (VII) In step (2), the culture medium containing the pretreated mung bean seeds obtained in step (1) includes the pretreated mung bean seeds and the basal culture medium; (VIII) In step (2), the volume of the lactobacillus accounts for 5-10 v / v% of the sum of the volumes of the lactobacillus and the culture medium containing the pretreated mung bean seeds. (IX) In step (2), the fermentation is an anaerobic fermentation at 35-40℃ and pH=5-6.5 for 24-72h; (X) The mung bean seed fermentation product obtained in step (2) is centrifuged at 8000-10000 r / min for 15-25 min. The supernatant is then filtered through a 0.22 μm pore size filter membrane to obtain the mung bean seed fermentation filtrate. The precipitate is washed twice with water to control the OD. 600 =10 After homogenization, the fermented lysate of mung bean seeds was obtained.

9. The preparation method according to claim 8, characterized in that, In step (2), when the culture medium containing the pretreated mung bean seeds obtained in step (1) includes pretreated mung bean seeds and basal culture medium, the volume ratio of the pretreated mung bean seeds to the basal culture medium is pretreated mung bean seeds: basal culture medium = (6-8): (2-4).

10. The use of the mung bean seed ferment as described in any one of claims 1-2 in the preparation of repair and / or anti-aging and / or anti-inflammatory products.

Images