Dietary products lacking at least two non-essential amino acids
By designing dietary products and pharmaceutical compositions lacking specific non-essential amino acids, the problems of low selectivity and difficulty in patient classification in existing cancer treatments have been solved, enabling effective cancer treatment and patient screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2017-02-22
- Publication Date
- 2026-06-02
AI Technical Summary
In current cancer treatments, drug therapy has low selectivity for cancer cells, leading to suboptimal dosage and resistance, making it difficult to completely eradicate cancer. Furthermore, there is a lack of effective patient classification methods to identify patients who may benefit from metabolic targeted therapy.
A dietary product is provided that contains all essential amino acids but is substantially deficient in at least two non-essential amino acids, such as glycine, serine, cysteine, tyrosine, and arginine, for targeting cancer cell metabolism by restricting the intake of exogenous amino acids, in combination with pharmaceutical compositions such as cancer cell growth inhibitors and radiotherapy agents for cancer treatment.
By limiting cancer cells' dependence on non-essential amino acids, therapeutic effects on cancer can be achieved, the selectivity of drug therapy can be enhanced, survival rates can be improved, and a patient classification method can be provided to identify patient groups that may benefit.
Smart Images

Figure CN122124027A_ABST
Abstract
Description
[0001] This application is a divisional application of the application filed on February 22, 2017, with application number 201780025339.9 and invention title "Dietary product lacking at least two non-essential amino acids". Invention Field
[0002] This invention generally relates to the field of dietary therapies for treating cancer. More specifically, this invention relates to altering the levels of amino acids in a diet to treat cancer and improve existing cancer therapies. The invention also relates to biomarkers for identifying patients who will benefit from dietary therapies for treating cancer, as well as methods and kits for using said biomarkers. Background of the Invention
[0003] Cancer is a disease in which cells undergo uncontrolled growth, growing and dividing beyond the normal limits of cell growth. These cells can invade and destroy surrounding tissues. Furthermore, cancer cells can metastasize, spreading to other areas of the body via the bloodstream or lymphatic system.
[0004] Cancer treatment can involve surgical removal of the tumor, radiation therapy to shrink the tumor, or drug therapy / chemotherapy, which uses drugs or other medicines to treat the cancer. Cancer survival rates vary depending on the type of cancer; however, survival rates are particularly low for cancers that have metastasized. A key reason for this is the fact that drug therapy / chemotherapy often fails and rarely eradicates the cancer completely. Normal, non-cancerous cells can only tolerate a certain dose of drug therapy / chemotherapy, leading to the use of suboptimal doses of cancer treatment to prevent excessive adverse side effects. Complicating matters is that agents have limited selectivity for cancer cells compared to normal cells, and cancer cells may develop resistance to drug therapy / chemotherapy during treatment. Surviving cancer cells often still experience uncontrolled proliferation, and the cancer persists. This has led researchers to search for new ways to treat cancer.
[0005] In recent years, attention has turned to cancer metabolism, and particularly how cancer cells differ from normal cells, exhibiting the rapid, uncontrolled cell growth typically associated with disease. It is clear that cancers can reprogram their metabolism to grow, generate new cells, and adapt to metabolic stress. In treating cancer, enzymes in specific metabolic pathways can be targeted, or alternatively, chemicals and / or metabolites used in those pathways can be targeted. Proteins are key components of cells, and protein synthesis pathways are crucial for cancer cell growth.
[0006] Proteins can be synthesized from amino acids, and there are 20 known biologically active amino acids in mammals. These can be synthesized in the body (non-essential amino acids), but those that cannot be synthesized are essential components of the diet (essential amino acids). Cancer cells are highly dependent on utilizing non-essential amino acids to support proliferation. Some cancers can synthesize these de novo to support proliferation, while others rely on the absorption of exogenous amino acids. (Jason W. Locasale, Nature Reviews Cancer, 2013, 13, 572-583; R. Possemato et al., Nature, 2011 476, 346-350; O. Maddocks et al., Nature, 2013, 493, 542-546; C. Labuschagne et al., Cell Rep. 2014, 22, 7(4), 1248-58). Non-essential amino acids are used in protein synthesis as well as many other anabolic processes necessary for cancer cell growth.
[0007] The dependence of cancer on exogenous amino acids has the potential to be explored to treat cancer by regulating the amount of exogenous amino acids available to cancer cells through restricting dietary amino acid levels. Starvation of cancer cells for essential components required for growth and survival may have the effect of preventing cancer growth or inducing cancer cell death. This can be used alone as a therapy or in combination with other strategies such as radiation therapy and drug / chemotherapy.
[0008] This strategy will require improved methods for classifying cancer types in order to identify patients and patient populations that may benefit from this therapy.
[0009] Therefore, there remains a need for improved methods to identify patients and patient populations who will benefit from metabolic targeted therapies. Brief description of the publicly available information
[0010] According to the present invention, a dietary product comprising multiple amino acids is provided, wherein the dietary product contains all essential amino acids, and wherein the dietary product is substantially lacking at least two non-essential amino acids. Suitably, the dietary product may contain at least nine amino acids.
[0011] At least one essentially deficient non-essential amino acid can be selected from the group consisting of glycine, serine, cysteine, tyrosine, and arginine.
[0012] At least two substantially deficient non-essential amino acids may be present, but the product may contain two or more of the following amino acids: glycine, serine, cysteine, tyrosine, and arginine. Suitablely, dietary products may be substantially deficient in: a. Glycine, serine, and cysteine; b. Glycine, serine, and arginine; c. Glycine, serine, and tyrosine; d. Glycine, serine, arginine, and cysteine; e. Glycine, serine, tyrosine, and cysteine; f. Cysteine and arginine; g. Cysteine and tyrosine; h. Cysteine and glycine; i. Cysteine, tyrosine, and arginine; or j. Glycine, serine, arginine, tyrosine, and cysteine.
[0013] Where appropriate, dietary products may also contain one or more macronutrients and / or one or more micronutrients.
[0014] Dietary products may also contain methionine at levels below 25 mg / kg subject body weight / day or below 20 mg / kg / day or below 18 mg / kg / day or below 16 mg / kg / day.
[0015] The dietary products of this invention can be formulated to provide at least the recommended daily intake of essential amino acids (optionally excluding methionine) based on average daily total protein consumption.
[0016] The dietary products of the present invention may be in the form of solids or beverages.
[0017] The present invention also provides a process for preparing the dietary products of the present invention, wherein the components are dissolved or dispersed in water and spray-dried.
[0018] In another aspect, the present invention provides a pharmaceutical composition comprising the dietary product of the present invention or a dietary product produced according to the present invention, and a pharmaceutically acceptable carrier, excipient, or diluent.
[0019] Suitablely, the pharmaceutical compositions of the present invention may also comprise therapeutic agents selected from: cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents. The therapeutic agents may inhibit OXPHOS and / or may increase reactive oxygen species and / or reduce antioxidant defense.
[0020] In another aspect, the present invention provides dietary products of the present invention or dietary products produced according to the process of the present invention or pharmaceutical compositions of the present invention for use in cancer treatment.
[0021] The cancers can be selected from the group consisting of colorectal cancer, liver cancer, lung cancer, osteosarcoma, lymphoma, leukemia, and breast cancer.
[0022] Cancer can be positive for wild-type KRAS.
[0023] Cancer may have already deregulated cMyc expression.
[0024] Dietary products may be largely deficient in serine and / or glycine.
[0025] Cancer can be associated with downregulation of MTAP expression, and optionally, dietary products may have reduced levels of cysteine or be essentially cysteine-free.
[0026] Suitable dietary products for use in cancer treatment may be used in combination with therapeutic agents selected from the following: cancer cell growth inhibitors, radiotherapy agents, chemotherapy agents, amino acid metabolism / turnover / interconversion inhibitors, non-essential amino acid biosynthesis inhibitors, amino acid transport inhibitors, enzymes or drugs that promote amino acid degradation, or substances that sequester amino acids.
[0027] Therapeutic agents can inhibit OXPHOS and / or increase reactive oxygen species and / or reduce antioxidant defense.
[0028] In another aspect, the present invention provides the use of the dietary products of the present invention, or dietary products produced according to the present invention, or pharmaceutical compositions of the present invention, in the preparation of medicaments for treating cancer.
[0029] Appropriately, cancer can be selected from the group consisting of colorectal cancer, lymphoma, liver cancer, lung cancer, osteosarcoma, and breast cancer.
[0030] Cancer may be positive for wild-type KRAS, and / or cancer may have deregulated cMyc expression and / or downregulated MTAP expression.
[0031] Suitable, the dietary products of the present invention may be substantially deficient in serine, glycine, or serine and glycine.
[0032] Suitablely, the dietary products of the present invention may have reduced levels of cysteine or may be substantially lacking in cysteine.
[0033] Suitable, the dietary product may be used in combination with one or more therapeutic agents selected from: cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0034] Therapeutic agents can inhibit OXPHOS and / or increase reactive oxygen species and / or reduce antioxidant defense.
[0035] In another aspect, the present invention relates to a method of treating cancer in a subject, comprising administering a therapeutically effective amount of the dietary product of the present invention or a dietary product produced according to the present invention or a pharmaceutical composition of the present invention.
[0036] Appropriately, cancer can be selected from the group consisting of colorectal cancer, liver cancer, osteosarcoma, lung cancer, lymphoma, and breast cancer.
[0037] Cancer may be positive for wild-type KRAS and / or may have deregulated cMyc expression.
[0038] Dietary products may be largely deficient in serine and / or glycine.
[0039] The dietary product may be used in combination with one or more therapeutic agents selected from cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0040] Therapeutic agents can inhibit OXPHOS and / or increase reactive oxygen species and / or reduce antioxidant defense.
[0041] Suitablely, in all aspects of the invention, the dietary product may be the sole source of nutrition for the subject.
[0042] Treatment is administered over a period of at least 24 hours, or until the treatment endpoint is observed.
[0043] Dietary products can be applied between once and six times a day.
[0044] Appropriately, the recommended daily intake of essential amino acids can be met through a daily administration regimen.
[0045] The present invention also provides the use of KRAS and / or MTAP as biomarkers to identify patients or patient populations who are responsive to or sensitive to cancer treatments, said cancer treatments comprising a diet substantially deficient in serine and / or glycine.
[0046] Appropriately, cancer treatment can include a diet that is essentially deficient in serine and glycine.
[0047] Appropriately, cancer treatment may further include the administration of therapeutic agents selected from: cancer cell growth inhibitors, radiotherapy agents, and / or chemotherapy agents.
[0048] In another aspect, the present invention provides a method for identifying subjects who have a reduced likelihood of response or sensitivity to cancer treatments comprising a diet substantially lacking serine, the method comprising: a) Determine the expression or activity level of Kras in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in the biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein the level of increase in Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level indicates nonresponsiveness or insensitivity to the cancer treatment.
[0049] In another aspect, the present invention provides a method for identifying subjects who have an increased likelihood of responding to or being sensitive to cancer treatments comprising a diet substantially lacking serine, the method comprising: a) Determine the expression or activity level of Kras in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in a biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein the level of reduction in Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level, or the level of Kras expression or activity substantially the same as that in the control sample or the predetermined reference level, indicates responsiveness or sensitivity to said cancer treatment.
[0050] In another aspect, the present invention provides a method for identifying subjects who may benefit from cancer treatment comprising a diet substantially lacking serine, the method comprising: a) Determine the expression or activity level of Kras in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in the biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein a decrease in Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level, or a Kras expression or activity level substantially the same as the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment.
[0051] On the other hand, the present invention provides a method for identifying subjects who have an increased likelihood of responding to or being sensitive to cancer treatment, said cancer treatment comprising i) a diet substantially deficient in serine, and / or ii) a diet with restricted levels of cysteine, said method comprising: a) Determine the expression or activity level of MTAP in biological samples isolated from subjects; b) Compare the expression or activity level of MTAP in a biological sample to a control sample or a predetermined reference level of MTAP expression or activity, wherein the level of reduction in MTAP expression or activity in the biological sample compared to the control sample or the predetermined reference level, or the level of MTAP expression or activity substantially the same as the control sample or the predetermined reference level, indicates responsiveness or sensitivity to said cancer treatment.
[0052] In another aspect, the present invention provides a method for identifying subjects who may benefit from cancer treatment comprising i) a diet substantially deficient in serine and / or ii) a diet with restricted levels of cysteine, the method comprising: a) Determine the expression or activity level of MTAP in biological samples isolated from subjects; (b) The expression or activity level of MTAP in the biological sample is compared with a control sample or a predetermined reference level of MTAP expression or activity, wherein a decrease in MTAP expression or activity in the biological sample compared to the control sample or the predetermined reference level, or a level of MTAP expression or activity substantially the same as that in the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment. Suitably, in all respects, the biological sample may contain cancer cells or cancerous tissue. Similarly, in all respects, the control sample may be a normal cell or tissue sample. The normal cell or tissue sample may be cells or tissue of the same type as cancer cells or cancerous tissue.
[0053] In another aspect, the present invention provides a method for treating a subject suffering from cancer, the method comprising: a) Determine whether the level of Kras expression or activity in biological samples isolated from subjects indicates responsiveness or sensitivity to cancer treatments, including diets that are substantially serine-deficient; and b) Administering cancer treatment to a subject, wherein the expression or activity level of Kras in a biological sample indicates responsiveness or sensitivity to the cancer treatment.
[0054] In another aspect, the present invention provides a method for treating a subject suffering from cancer, the method comprising: a) Determine whether the level of MTAP expression or activity in biological samples isolated from subjects indicates responsiveness or sensitivity to cancer treatment, said cancer treatment including i) a diet substantially lacking serine and / or ii) a diet with limited cysteine; and b) Administering cancer treatment to a subject, wherein the expression or activity level of MTAP in a biological sample indicates responsiveness or sensitivity to the cancer treatment.
[0055] Suitable, the cancer treatment may include a diet that is substantially deficient in serine and glycine.
[0056] Suitable, the cancer treatment may also include the administration of a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and / or chemotherapy agents.
[0057] Determining whether the level of Kras expression or activity in biological samples isolated from a subject indicates responsiveness or sensitivity to cancer treatments that include a diet substantially lacking serine may include: a) Determine the expression or activity level of Kras in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in the biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein an increase in Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level indicates non-responsiveness or insensitivity of the subject to the cancer treatment, and wherein a decrease in Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level, or a Kras expression or activity level substantially the same as that in a control sample or a predetermined reference level, indicates responsiveness or sensitivity of the subject to the cancer treatment.
[0058] Determining whether the level of MTAP expression or activity in biological samples isolated from subjects indicates responsiveness or sensitivity to cancer treatments, including i) diets substantially lacking serine and / or ii) diets limited by cysteine, may include: a) Determine the expression or activity level of MTAP in biological samples isolated from subjects; b) Compare the expression or activity levels of MTAP in biological samples with control samples or predetermined reference levels of MTAP expression or activity. The level at which the expression or activity of MTAP in the biological sample is reduced compared to the control sample or the predetermined reference level, or the level at which the expression or activity of MTAP is substantially the same as that in the control sample or the predetermined reference level, indicates the subject’s increased responsiveness or sensitivity to the cancer treatment.
[0059] In another aspect, the present invention provides a kit for use in identifying subjects who will benefit from cancer treatment comprising a diet substantially lacking serine and / or glycine, the kit comprising: a. Agents used to determine the expression or activity of Kras; and b. Reagents used for the determination.
[0060] Suitable, the kit may also contain agents for determining the expression or activity of MTAP.
[0061] The kit may further include a description that the level of increased Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level indicates the subject’s non-responsiveness or insensitivity to the cancer treatment, and wherein the level of decreased Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level, or the Kras expression or activity level being substantially the same as that of the control sample or the predetermined reference level, indicates the subject’s responsiveness or sensitivity to the cancer treatment.
[0062] On the other hand, the present invention provides a kit for use in identifying subjects who will benefit from cancer treatment comprising: i) a diet substantially deficient in serine and / or glycine, and / or ii) a cysteine-limited diet, the kit comprising: a. Agents used to determine the expression or activity of MTAP; and b. Reagents used for the determination.
[0063] The kit may further include a description of the level of reduction in MTAP expression or activity in the biological sample compared to a control sample or a predetermined reference level, or the level of MTAP expression or activity substantially the same as that in a control sample or a predetermined reference level, indicating the subject’s responsiveness or sensitivity to the cancer treatment. Brief description of the attached diagram
[0064] Embodiments of the present invention are further described below with reference to the accompanying drawings, wherein: Figure 1 a. PDAC Kras G12D / + p53+ / -, and 1b. PDAC Kras G12D / + p53R172H / +: Mice were fed at ~60 days of age until the clinical endpoint (PDAC-related survival). Survival was calculated from dietary changes (not birth). P-values were calculated using the Mantel-Cox test.
[0065] Figure 1 c. Inject 100 μl of 100 μM solution into the tail vein of mice. 13 C3 15 N1 serine was incubated for 2 hours. After sacrifice, tissues were frozen, homogenized in metabolite extraction buffer, and quantified by LCMS. P-values were calculated using paired T-tests.
[0066] Figure 1d. Kras-inducible cell lines (iKRAS1, iKRAS3, and AK196) were grown in complete media containing or without doxycycline (KRAS-ON). The mRNA expression of serine synthesis pathway enzymes was analyzed by qRT-PCR. Error bars = SEM.
[0067] Figure 1 e. Three Kras-inducible cell lines (iKRAS1, iKRAS3, and AK196) were grown for 3 days, and protein expression was analyzed by Western blotting. The relative changes in Kras-ON / Kras-OFF protein expression in SSP and Phospho-ERK1 across iKRAS1, iKRAS3, and AK196 cells (quantitatively measured by LiCor infrared spectroscopy) were averaged; the quantified bands are those displayed in the Western blot. Error bar = STDEV.
[0068] Figure 1 f. Kras-inducible cell lines were grown in media with or without serine and glycine (+SG / -SG) and counted after 48 and 96 hours. Error bars = SEM.
[0069] Figure 2 a. APCmin / APCmin KRAS organoids were grown for 24-48 hours with or without serine and glycine.
[0070] Figure 2 b. APCmin / APCmin KRAS organoids were grown for 5 days without serine and glycine, then inoculated into a medium containing serine and glycine and allowed to grow for 24-72 hours. Figure 2 c. qRT-PCR of mRNA extracted from APCmin / APCmin KRAS organoids grown with or without serine and glycine.
[0071] Figure 2 d. in 13 APCmin / APCmin KRAS organoids grown for 5 hours in the presence of C6-glucose were analyzed by LCMS, and metabolites were extracted. P-values were calculated using paired t-tests. Error bars = STDEV.
[0072] Figure 3 a and Figure 3 b. Effects of a serine / glycine-free diet on serum amino acid levels in two mouse models of pancreatic cancer, measured by mass spectrometry analysis of serum samples. Statistical comparisons are detailed in the figure. a. Pdx1 cre ;KRasG12D / + p53 + / - Mice were fed a normal diet until 60 days of age, then switched to either a control diet (Ctr) containing serine and glycine or a matched diet (-SG) lacking serine and glycine, until the clinical endpoint. Serum isolated from terminal hemorrhage was analyzed by LCMS. Relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P-values for each amino acid were calculated by t-test (unpaired, 2-tailed), and P-values below 0.05 are shown. b. Pdx1 cre ;KRas G12D / + p53 R172H / + Mice were fed either a control diet or a non-SG (-SG) diet at 60 days of age until the clinical endpoint. Serum isolated from terminal hemorrhage was analyzed by LCMS. Relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P-values for each amino acid were calculated by t-test (unpaired, 2 tails), and P-values below 0.05 are shown.
[0073] Figure 4 a. Growth rate of tumors arising from HCT116 cells (human colorectal cancer, p53 wt or null). In mice fed a control diet, tumors grew rapidly, but a diet lacking serine and glycine (-SG) significantly attenuated tumor growth. b. From Figure 4 The survival rate of mice in experiment a is shown. A serine-free diet significantly improved the survival rate of mice.
[0074] Figure 5 Effects of serine starvation on the growth inhibition of anticancer drugs in HCT116, DLD1, and SW480 cell lines. When co-administered with serine and glycine starvation, a significant proportion of chemotherapy showed enhanced antiproliferative effects.
[0075] Figure 6 Effects of dietary serine and glycine restriction on amino acid levels in serum samples from mice. C57BI6 mice were fed either a control diet containing all 20 amino acids or a diet lacking serine and glycine but containing all 18 other amino acids. Serum samples were analyzed by LCMS, and the relative amounts of all non-essential amino acids are shown. Decreased levels of serine, glycine, and cysteine were observed with the dietary restriction.
[0076] Figure 7 Cysteine uptake from cell culture media of various cell lines (A549, HCT116, SW480, RKO, MCF7, MDA MB 231, and MDA MB 468) was demonstrated. The cancer cell lines voraciously consumed exogenous cysteine.
[0077] Figure 8 The effects of cysteine starvation on various cell lines (HCT116, HepG2, MDA MB 231, RKO, and U2OS). Basal medium = all amino acids added except serine, glycine, and cysteine. S = serine 0.8 mM, G = glycine 0.4 mM, C = cysteine 0.4 mM. The medium was changed every 24 hours.
[0078] Figure 9 Effects of combined and individual starvation of cysteine, serine, and glycine on cell numbers in three cell lines (HCT116, SW480, and DLD1). Cells were seeded in a medium containing different concentrations of serine, glycine, and cysteine (but enriched with all other amino acids) and counted after 48 h.
[0079] Figure 10 The mechanism of serine and cysteine interdependence. Homocysteine efflux prevents the depletion of serine aggregates in two ways: 1. Serine-derived single carbons are not used for remethylation, allowing serine-derived single carbon aggregates to be used instead for nucleotide (DNA, RNA) synthesis; 2. Cysteine production does not require serine. However, homocysteine efflux means that cysteine can no longer be synthesized de novo, so it must be derived from outside the cancer cells. To meet the high anabolic demands of nucleotide and glutathione (GSH) synthesis, cancer cells require the uptake of exogenous serine and cysteine.
[0080] Figure 11 Summary of systemic metabolism and tumor metabolism.
[0081] Figure 12 Effects of non-essential amino acid withdrawal (excluding serine and glycine) on the growth of HCT116 and RKO cells. The effects of improving the anticancer effects of a serine- and glycine-free diet by modulating other amino acids are shown. a. Serine and glycine starvation alone reduces proliferation rate. In addition to the removal of serine and glycine, the withdrawal of certain other non-essential amino acids (aspartic acid, glutamic acid, proline, and asparagine) has a slight additional effect on cell proliferation rate at day 2. b. Serine and glycine starvation alone reduces proliferation rate. Furthermore, the removal of tyrosine, arginine, or cysteine alone has a greater anti-proliferative effect.
[0082] Figure 13Effects of different combinations of serine, glycine, cysteine, arginine, and tyrosine starvation on HCT116 cell growth and cell death over 4 days (shown as changes in cell number as a percentage). Cell growth in complete medium (control) was +1400%. Tyrosine starvation alone; tyrosine, serine, and glycine starvation; arginine starvation alone; and arginine, serine, and glycine starvation all resulted in growth inhibition. Cysteine starvation alone; cysteine, serine, and glycine starvation; and serine, glycine, cysteine, and arginine starvation resulted in both growth inhibition and cell death.
[0083] Figure 14 The expression of serine synthesis pathway enzymes is a determinant of sensitivity to serine starvation. Tumors with elevated expression or enhanced activity of serine synthesis pathway enzymes (PHGDH, PSAT1, PSPH) are less sensitive to serine starvation. Serine synthesis pathway activity can be increased through various mechanisms in cancer, including gene copy number amplification, transcriptional activation (e.g., via the oncogene Kras), epigenetic pathways, or potentially through other mechanisms such as allosteric activation.
[0084] Figure 15 The release of cysteine precursor / homocysteine dimer was measured in four cell lines (SW480, DLD1, HCT116, and RKO) after 48 hours of culture in complete medium. Homocysteine is a precursor for de novo cysteine synthesis; however, homocysteine was released from cancer cells, and a homodimer, homocysteine, was detected.
[0085] Figure 16 Under serine and glycine starvation conditions, the release of cysteine precursor / homocysteine dimer was measured in two cell lines (HCT116 and RKO). homoC-cys = homocysteine + cysteine dimer. Homocysteine = homocysteine + homocysteine dimer.
[0086] Figure 17 Under serine and glycine starvation conditions, the release of cysteine precursor / homocysteine dimer was measured in two cell lines (A549 and MDA MB231). homoC-cys = homocysteine + cysteine dimer. Homocysteine = homocysteine + homocysteine dimer.
[0087] Figure 18A serine- and glycine-free diet was an effective therapeutic intervention for lymphoma and colorectal cancer in GEMM. a. Eμ-Myc mice received a normal diet until ~60 days of age, then were switched to a control diet (containing serine and glycine) or a matched diet lacking serine and glycine (no Ser, no Gly) until the clinical endpoint (lymphoma-related survival). Survival was calculated from the dietary change (not from birth). P-values were calculated using the Mantel-Cox test. b. APCMin / + mice received a normal diet until ~80 days of age, then were switched to a control diet (containing serine and glycine) or a matched diet lacking serine and glycine (no Ser, no Gly) until the clinical endpoint (colorectal cancer-related survival). Survival was calculated from the dietary change (not from birth). P-values were calculated using the Mantel-Cox test. c. Serum from the Eμ-Myc group and d. Serum from the APCMin / + group were analyzed by LCMS, showing relative abundance (by metabolite peak area). Error bars = STDEV, P-values were calculated using a t-test (unpaired, 2 tails, *=P<0.0005). Relative quantifications of all amino acids are shown below. Figure 21 e. Serum concentrations of serine and glycine in the APCMin / + group were determined using a 6-point calibration curve of 13C15N-serine and glycine diluted in serum. Error bar = STDEV. f. Lgr5-creER APCfl / fl mice were induced at 7–10 weeks of age, with a dietary change 7 days after the first tamoxifen treatment and maintained until the clinical endpoint (intestinal tumor-related survival). Survival was calculated from the start of the first tamoxifen treatment. P-values were calculated using the Mantel-Cox test.
[0088] Figure 19 The manipulation of antioxidant responses enhanced diet-induced anticancer effects. a. Eμ-Myc mice were administered either a control diet containing 100 mg / kg / day of phenformin (Phen) or a diet without serine and glycine (no Ser, no Gly) by gavage at ~60 days of age and were carried to the clinical endpoint. Lymphoma-related survival was calculated from the dietary change (not from birth). b. APCMin / + mice were switched to a control diet or a diet without serine and glycine (no Ser, no Gly) at ~80 days of age, and then administered metformin (Metf) in drinking water four days later. Intestinal tumor-related survival was calculated from the dietary change (not from birth). P-values were calculated using the Mantel-Cox test. A complete comparison of survival curves can be found in [link to full comparison]. Figure 22 a. c. Comparison of tumor burden data based solely on diet with tumor burden data based on metformin plus diet. (Regarding APC) Min+ Tumor numbers were post-mortem counted in the small intestine (SI) of mice. P-values were calculated using a t-test (unpaired, 2-tailed). Tumor area data are shown below. Figure 22 c. Copy the diet data from (a) and (b) above. d. Sourced from Villin. creER Organoids of intestinal tumors; enabling APC fl / fl Mice were grown for two days at concentrations of + / - SG and + / - metformin. The relative change in organoid diameter (relative to '-drug') was plotted. Data are the mean of four independent experiments, error bars = SEM. P-values were calculated using a t-test (unpaired, 2-tailed, with correction for multiple comparisons). e. APC fl / fl Organoids with + / - SG and + / - metformin were grown for two days, then fixed and immunostained for the lipid peroxidation product malondialdehyde (MDA). Data are the mean of three independent experiments, error bars = SEM. P-values were calculated using a t-test (unpaired, 2-tailed, corrected for multiple comparisons). f. Eμ-Myc mice were crossed with Tigar- / - mice, and the groups were fed at ~60 days of age until the clinical endpoint (lymphoma-related survival). Survival was calculated from the start of dietary change (not birth). P-values were calculated using the Mantel-Cox test.
[0089] Figure 20 A diet lacking serine and glycine has an impact on APC. min / + The effect of APC on tumor burden in mice. Min / + Mice were fed a normal diet until 80 days of age, then switched to a control diet (containing serine and glycine) or a matched diet lacking serine and glycine (no Ser, no Gly;-SG) until the clinical endpoint (intestinal tumor-related survival). Postmortem tumor measurements of intestinal tissue were performed at dietary change (80 days) or the clinical endpoint. P-values were calculated using a t-test (unpaired, 2-tailed, with correction for multiple comparisons).
[0090] Figure 21 The effects of a diet lacking serine and glycine on serum amino acids: a. εμ-myc and b. APC min / + Mice were fed a normal diet until ~60 and ~80 days of age, respectively, and then switched to a control diet (Ctr) containing serine and glycine or a matched diet (-SG) lacking serine and glycine, until the clinical endpoint. Serum isolated from terminal hemorrhage was analyzed by LCMS. The relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P-values were calculated by t-test (unpaired).
[0091] Figure 22 Metformin treatment in APC min / +The anticancer effect of diets lacking serine and glycine was not enhanced in mice. Mice were switched to a diet lacking serine and glycine (no Ser, no Gly) (a) or a control diet (b) at ~80 days of age, and then received metformin (Metf) at 200 mg / kg / day in drinking water four days later. Intestinal tumor-related survival was calculated from the dietary change, rather than from birth. P-values were calculated using the Mantel-Cox test. c. Comparison of tumor burden data by diet alone versus metformin + diet tumor burden. (APC) min / + Postmortem measurements of tumor area were performed on the small intestine (SI) of mice. P-values were calculated using a t-test (unpaired, two-tailed). "Diet-only" data were obtained from... Figure 20 It was copied from China.
[0092] Figure 23 Metformin levels in the body have little effect on systemic metabolism and are too low to enable the anti-cancer effects of a diet lacking serine and glycine. a. [The text abruptly shifts to a seemingly unrelated topic:] ...APC... min / + Mice were switched to a control diet or a diet without serine and glycine (-SG) and then given metformin 200 mg / kg / day in drinking water. Serum isolated from terminal hemorrhage was analyzed by LCMS. Error bar = STDEV. b. Tissue samples from metformin-treated mice were analyzed by LCMS. NC = normal colon, NSI = normal small intestine, TC = tumor colon, TSI = tumor small intestine. Error bar = STDEV. c. For mice with matching serum and tumor (SI or colon) tissue samples available (Ctr diet n=7, -SG diet n=6), a curve of serum versus tumor metformin concentrations was plotted. Metformin concentrations in all samples were determined using a six-point calibrated curve with relevant biological matrices (tissue / serum). d. Analysis of APCs treated with metformin using an Agilent 2100 Bioanalyser. min / + Serum glucose and lactate levels in mice. e. Human colorectal cancer cells DLD1 and SW480 expressing truncated APCs were grown for three days in different concentrations of metformin without serine and glycine (no Ser, no Gly), or with low serine and glycine (10 μM), after which cell counts were performed. Data are the average of three wells, with error bars = STDEV.
[0093] Figure 24Unbiased metabolomics analysis (OPLS-DA; orthogonal partial least squares discriminant analysis) of .Eμ-myc tumor tissue (spleen carrying the tumor) yielded an S-plot (Ctr n=20, -SG n=13). The metabolites detected that showed the greatest reduction due to diet were serine and glycine. Decreased levels of carnitine and choline-related metabolites were also observed. Increased levels of phosphatidylcholine (PC) metabolites, as well as alanine and threonine, were also observed. SG starvation is known to affect glycolysis and OXPHOS (potentially explaining the changes in carnitine and alanine levels) and one-carbon metabolism (potentially explaining the changes in choline-related metabolites).
[0094] Figure 25 The effect of the -SG diet on Eu-myc tumor cells is shown. a. Lymphoma cells were isolated from Eu-myc mice and expanded in culture. Cells were subcutaneously injected (5 x 10^5 / rib-abdomen) into nude mice and allowed to form tumors. Once the tumors (Ctr n=4, -SG n=4) were visible and measurable, the mice were switched to either a control (Ctr) or a diet without serine and glycine (-SG). Mice were sacrificed and tumors were excised at a single time endpoint (6 days on the diet). Mean tumor volume (as a percentage of initial tumor volume) is shown, error bar = STDEV. b. To assess the cell count for each subcutaneous Eu-myc tumor, two separate cell counts were performed for each tumor (using H&E-stained cross-sections) and the mean was taken. Mean of mean is shown, error bar = SEM. P-values were calculated using a t-test (unpaired, one-tailed). c. Sections of the entire subcutaneous Eμ-myc tumor tissue (Ctr n=3, -SG n=4) were immunostained for cleaved caspase-3 (CC3) and BrdU. Image analysis of the non-necrotic area of the entire tumor allowed for quantitative assessment of the % of cleaved caspase-3 positive cells and the % of BrdU positive cells in each tumor. Data are mean, error bars = STDEV. d. Cross-sections of Eμ-myc tumors (as described in ac above) were H&E stained, with a scale bar of 4 mm for each image, and illustrative necrotic areas marked with arrows. Additional tumor tissue sections (marked *) were included to compare tumors that developed after dietary changes (these three tumors were measurable two days after dietary changes and placed on a diet for 4 days prior to the endpoint). e. Necrosis was quantified by image analysis of the necrotic and non-necrotic surface areas of the H&E-stained sections shown in (d). Error bars = STDEV, p-values were calculated using a t-test (unpaired, one-tailed, Ctr, n=5; -SG, n=6). f. APC min / +Mice were fed either a control diet (Ctr, n=3) or a diet lacking serine and glycine (-SG, n=3) at 80 days of age. At a single time endpoint (day 14 of feeding), mice were sacrificed and the small intestine was harvested for histological analysis. Tissue sections were immunostained for cleaved caspase-3 and BrdU. Image analysis of the entire intestine allowed for quantitative assessment of the cell count, % CC3-positive cells, and % BrdU-positive cells per adenoma. Data are the mean of all adenomas identified in each small intestinal section, with error bars equal to SEM. P-values were calculated using a t-test (unpaired, one-tailed). P-values less than 0.1 are shown for all analyses (af).
[0095] Figure 26 SSP enzyme expression in tumor tissues from PDAC and Eμ-myc models. SSP enzyme expression in protein lysates from PDAC tumors and spleens containing tumors in control or Eμ-Myc mice receiving a non-SG diet was analyzed by Li-Cor quantification using proteoblotting. Relative SSP enzyme expression (relative to control diet) is shown. Error bar = STDEV. Each tissue sample was taken from a different mouse; mouse / tumor number is shown above the bar.
[0096] Figure 27 The study showed that the -SG diet resulted in decreased serine and glycine levels, as well as a reduced GSH / GSSG ratio, in Eu-myc tumors, but no decrease in glycine or the GSH / GSSG ratio in PDAC tumors. Analysis of Pdx1 tumors by LCMS... cre ;KRas G12D / + p53 + / - Pancreatic tumors from mice and tumor-bearing spleens from EV1-myc mice were analyzed for serine, glycine, GSH (reduced glutathione), and GSSG (oxidized glutathione). P-values were calculated using t-tests (unpaired, 2-tailed). Error bars = STDEV.
[0097] Figure 28 Tumor organoids expressing Kras are more resistant to serine and glycine starvation. Villin creER APC fl / fl and Villin creER APC fl / fl ;KRas G12D / + Intestinal tumor organoids (each genotype from n = 3 mice) were grown for 5 days without serine and glycine, then dissociated and seeded into complete growth medium. Organoid diameter was measured daily in complete (recycled) medium. Data are averages of organoids from three mice obtained in a single experiment. Error bars = SEM.
[0098] Figure 29 The results show that a diet lacking glycine and serine reduced the growth of xenograft tumors already formed in vivo, decreased intratumoral serine and glycine levels, and that such levels translated into slower cancer cell proliferation in vitro. a. HCT116 cells were injected bilaterally (3 x 10⁶ cells per side) and tumor formation was allowed. Once tumors were visible and measurable by calipers, mice were switched to a control diet or a diet lacking serine and glycine (-SG). Tumors were measured three times weekly, and the weekly mean tumor volume was plotted, with error bars equal to SEM. P-values were calculated using a t-test (unpaired, one-tailed). b. Absolute concentrations of serine and glycine in HCT116 tumors (from clinical endpoints) were analyzed by LCMS (analysis of 1–3 pieces per tumor). Data are mean values, and bars are STDEVs. P-values were calculated using a t-test (unpaired, one-tailed). c. HCT116 cells were grown in vitro (24-well plates), and intratumoral serine and glycine concentrations are shown in “b”. The culture medium was changed every 24 hours, and cell counts were performed on the specified dates. Data are the mean from a single experiment, 12 wells per condition, error bars = STDEV. d. HCT116 cells were grown in vitro (24-well plates, 12 wells per condition), intratumoral serine and glycine concentrations are shown in "b". Culture medium was changed every 24 hours, and cell counts were performed after four days. Data are the mean from three independent experiments, error bars = SEM. P-values were calculated using a t-test (unpaired, one-tailed).
[0099] Figure 30 Cells expressing *KRas* acquire serine and glycine through de novo serine and glycine synthesis, rather than through micropinocytosis. Macrocytosis in *iKRas* cells was assessed using a TMR-labeled dextran uptake assay. Cells were initially grown under + / - doxycycline conditions for 48 h, followed by + / - doxycycline, + / - SG conditions for 40 h (without FBS for the last 16 h), and then administered TMR dextran / FBS in matched medium for 30 min. Error bars and lines show the mean and STDEV.
[0100] Figure 31 a. Daunorubicin supplements serine and glycine during starvation. Villin creER APC fl / fl Mice were grown for two days under conditions of + / -serine and glycine, + / -daunorubicin at specified concentrations. The relative changes in organoid diameter (relative to '-drug') were plotted. Data are the average of three independent experiments; error bars = SEM. b. Villin creER APC fl / flOrganoids were grown for two days under + / - serine and glycine, + / - daunorubicin conditions, then fixed with malondialdehyde (MDA) and stained with MDA. Data are the mean of three independent experiments, with error bars equal to SEM. P-values were calculated using a t-test (unpaired, 2-tailed, with correction for multiple comparisons).
[0101] Figure 32 A simplified schematic diagram illustrating de novo cysteine and polyamine synthesis in humans is shown. Metabolites are shown in normal text, and enzymes are shown in boxes.
[0102] Figure 33 The study showed that MTA efflux (an indicator of MTAP deficiency / inactivation) was associated with enhanced cysteine starvation sensitivity. a. Pancreatic cancer cell lines were grown in 24-well plates for three days in a cysteine-deficient medium containing all 19 other essential and non-essential amino acids (RPMI-based). Cell counts were performed using a CASY TT cell counter. MTA levels in the cell culture medium were measured by liquid chromatography-mass spectrometry (LC-MS) after 3 days. b. Colorectal and breast cancer cell lines were grown in 24-well plates for three days in a cysteine-deficient medium containing all 19 other essential and non-essential amino acids (RPMI-based). Cell counts were performed using a CASY TT cell counter. MTA levels in the cell culture medium were measured by LC-MS after 24 hours. 2 =Correlation coefficient calculated by MS Excel (with logarithmic trend line).
[0103] Figure 34 The results show that MDA-MB-231 cells exhibit higher rates of MTA and spermidine synthesis, indicating that a significant amount of methionine is diverted to the polyamine pathway in these cells. In contrast, in HCT116 and SW480 cells, less methionine is diverted to the polyamine pathway, and more methionine reaches homocysteine / cystathionine, which can be converted to cysteine. This helps explain the better survival of HCT116 and SW480 cells during cysteine starvation. SW480 and MDA-MB-231 (M231) cells were grown for two days in a formulated medium (based on RPMI medium, lacking C-12 methionine, supplemented with C-13 labeled methionine, and containing all 19 other essential and non-essential amino acids). Cell lysates were analyzed by liquid chromatography-mass spectrometry. The most abundant isotopes are shown. MTA = methylthioadenosine, Met = methionine, He = homocysteine, SAM = S-adenosylmethionine. M+x = mass plus x units.
[0104] Figure 35 The results show that HCT116 and SW480 cells are able to recycle MTA back to methionine, but MDA-MB-231 cells (which efflux MTA) cannot. Metabolite tracing with C13-labeled methionine shows that, unlike MDA-MB-231 cells, SW480 and HCT116 cells are able to recycle methionine already used in the polyamine pathway (via MTA) as “m+1” methionine. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for two days in a formulated medium (RPMI-based, C12-deficient methionine supplemented with C13-labeled methionine and containing all 19 other essential and non-essential amino acids). Cell lysates were analyzed by liquid chromatography-mass spectrometry. Major methionine isomers are shown.
[0105] Figure 36 The results show that MDA-MB-231 (M231) cells exhibited significant MTA efflux compared to HCT116 and SW480 cells, and this efflux continued even during cysteine starvation. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for two days in formulated media (based on RPMI medium, with or without cysteine, lacking C-12 methionine, supplemented with C-13-labeled methionine, and containing all 19 other essential and non-essential amino acids). Metabolite extracts were prepared from medium samples (collected at specific time points) and analyzed by liquid chromatography-mass spectrometry. MTA = Methylthioadenosine. M+x = mass plus x - unit. Data for MDA-MB-231 cells after 48 h of cysteine starvation are unavailable because no viable cells remained at that time point.
[0106] Figure 37 This study demonstrates how knocking out MTA gene expression induces MTA efflux. HCT116 cells were transfected using CRISPR / Cas9 and either a targeting sequence (Seq 1 & 2) or a non-targeting control sequence (NTC) for MTAP. Several clones were isolated from each sequence and grown in complete medium for 4 days. Protein lysates were analyzed for MTAP expression by proteoblotting. MTA content in the medium samples was analyzed by liquid chromatography-mass spectrometry.
[0107] Figure 38The data shows that HCT116 cells effluxed homocysteine (an upstream precursor of cysteine), but were able to re-take homocysteine during cysteine starvation. HCT116 cells remained sensitive to cysteine starvation, but not as sensitive as MDA-MB-231 (M231) cells. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for two days in a formulated medium (based on RPMI medium, with or without cysteine, lacking C-12 methionine, supplemented with C-13 labeled methionine, and containing all 19 other essential and non-essential amino acids). Metabolite extracts were prepared from medium samples (collected at specific time points) and analyzed by liquid chromatography-mass spectrometry. HC = homocysteine. M+x = mass plus x - unit. Data were not available for MDA-MB-231 cells after 48 h of cysteine starvation because no viable cells remained at that time point.
[0108] Figure 39 This study demonstrates that homocysteine supplementation can rescue cells from cysteine starvation, indicating that when precursor supply is adequate, enzymes CTH and CBS are expressed, active, and capable of de novo cysteine synthesis. These data support the idea that precursor deficiency (rather than a deficiency / insufficiency of CTH and CBS enzyme expression, or anything other than a deficiency / insufficiency of CTH and CBS enzyme expression) contributes to sensitivity to cysteine starvation. Colorectal and breast cancer cell lines were grown in 24-well plates. The prepared basal medium (RPMI-based medium) was cysteine-deficient but contained all 19 other essential and non-essential amino acids. This basal medium was supplemented with the aforementioned components; 0.4 mM cysteine (+Cys), 0.2 mM homocysteine & 0.8 mM (HC), and growth was continued for three days. Data are averages from three wells. Error bars = STDEV.
[0109] Figure 40 Inhibition of AMD1 (an enzyme that diverts methionine-derived SAM to the polyamine synthesis pathway) is shown to protect cells from acute susceptibility to cysteine starvation (i.e., cell death). MDA-MB-231 cells were initially seeded in complete (DMEM) medium in 24-well plates. After 24 hours, cells were treated with the AMD1 inhibitor sardozide (20 μM) for 16 hours or untreated (Ctr). Cells were then washed with PBS and given medium lacking cysteine but containing all 19 other amino acids. Images (a) were taken using an optical microscope, and cell counts (b) were performed using a CASY TT cell counter. Data are averages from three wells. Error bars = STDEV. Detailed description
[0110] The inventors were surprised to discover that a diet essentially lacking at least two non-essential amino acids could be effective in treating cancer or proliferative disorders. Not wanting to be bound by theory, they found that by essentially removing the amino acids needed for tumor cell proliferation and growth, metabolic remodeling diverted resources to provide a source of these essentially-deficient amino acids, and reduced the amount of amino acids available for rapid proliferation, thereby slowing or even inhibiting cancer cell growth, or inducing cancer cell death.
[0111] Suitably, the present invention may relate to partially or completely replacing the normal diet of a subject with cancer with a prescription diet substantially lacking at least two non-essential amino acids. Such a diet may potentially be achieved by providing the dietary products detailed herein, or by two or more dietary supplements that can be administered simultaneously or sequentially. Potentially, such a diet may be further supplemented by appropriate food choices using currently available ingredients, so that the diet remains substantially lacking two or more non-essential amino acids.
[0112] Dietary products In a first aspect of the invention, a dietary product comprising a plurality of amino acids is provided, wherein the dietary product comprises all essential amino acids and wherein the dietary product is substantially lacking at least two non-essential amino acids.
[0113] "Essential amino acids" means methionine, leucine, phenylalanine, isoleucine, valine, lysine, threonine, histidine, and tryptophan.
[0114] "Dietary product" refers to a composition containing one or more essential amino acids or their salts or esters, used in, or consumed with a food product to provide a subject consuming the supplement with the required levels of amino acids or their salts or esters. Dietary components in these products may include vitamins, minerals, herbs or other botanicals, amino acids, and substances such as enzymes, organ tissues, glands, and metabolites. In some embodiments, the dietary product is the sole source of exogenous amino acids consumed by the subject as part of their diet. Suitably, in some aspects, the dietary product may be intended to substantially or completely replace the subject's diet. Thus, in some aspects, the dietary product may be a complete meal replacement for the subject.
[0115] Advantageously, replacing the consumption of conventional amino acid sources such as protein with the dietary products of the present invention will result in a diet substantially lacking at least two non-essential amino acids. This can provide therapeutic benefits to cancer patients.
[0116] As used herein, and according to all aspects of the invention, the term "subject" preferably refers to a mammal, including humans, veterinary or farm animals, domesticated animals or pets, and animals commonly used in clinical research, including non-human primates, dogs, and mice. More specifically, the subject of the invention can be a human.
[0117] Suitablely, the dietary product may contain at least 9 amino acids. Suitablely, the dietary product may contain at least 10, 11, 12, 13, 14, 15, 16, 17, or 18 amino acids. Suitablely, the dietary product may contain, for example, 9 to 18 amino acids, 12-18 amino acids, 12-17 amino acids, 13-17 amino acids, or 14-17 amino acids.
[0118] Suitablely, at least two substantially deficient amino acids include (or are substantially composed of) two or more of the following amino acids: glycine, serine, cysteine, tyrosine, proline, and arginine. Alternatively, the dietary product may be deficient in at least three, four, five, six, or seven of the following amino acids: glycine, serine, cysteine, tyrosine, proline, arginine, alanine, aspartic acid, glutamic acid, glutamine, and asparagine. Suitablely, the dietary product may be deficient in seven amino acids, wherein the dietary product does not contain serine and glycine, and five of the following amino acids: cysteine, tyrosine, proline, arginine, alanine, aspartic acid, glutamic acid, glutamine, and asparagine. Suitablely, the diet may be substantially deficient in cysteine, or may contain limited levels of cysteine.
[0119] In this document, "consistently constitutes" means that the dietary product is indispensable for having a substantial effect on the dietary product of the present invention, requiring additional amino acids. "Substantial effect" refers to a significant therapeutic effect, which can be measured as one of the following: a) a significant effect specific to cancer cells as opposed to healthy cells; b) a significant effect on inhibiting cell proliferation; c) a significant effect on cancer cell toxicity; or d) any combination of a)-c). In some aspects, this can be measured by comparing dietary products containing and not containing specific amino acids and determining whether the deficiency of the amino acid has a substantial effect.
[0120] 1. A method for measuring the effect of in vitro amino acid starvation on cell proliferation: Seed cells at a density of 1 × 10^4 to 1 × 10^5 cells per well into intact medium in multiple replicates of 24-well cell culture plates and allow adhesion overnight. After overnight adhesion, cells should be 5–20% confluence. Wash cells once with PBS and accept various cell cultures specially formulated to contain or lack specific amino acids / multiple amino acids, including a control medium containing all amino acids. Replace the medium with fresh matching medium every 24 hours. At multiple time points after initial medium changes (e.g., day 1, day 2, day 3, day 4, and day 5), use the plates for cell counting. Each condition should be used with at least three wells (i.e., three replicates), and the average value should be calculated. Count cells using a Casy TT cell counter, or by fixing cells, staining with DAPI, and counting with an Operetta scanner. Cell counts at different time points under different amino acid conditions will be compared. A significant effect resulting from altered amino acid composition in the culture medium is considered to be a change in cell number greater than 5% compared to the control culture medium, and is statistically significant when compared in at least three independent experiments by an appropriate TTEST (where P < 0.05 is quantified as a significant effect).
[0121] 2. Methods for measuring the effects of dietary amino acid composition on in vivo cancer cell proliferation / tumor growth and survival using mouse xenograft / allogeneic transplantation / orthotopic models. A suitable cancer cell line should be selected that will form a tumor when subcutaneously transplanted into the flank of nude mice (e.g., HCT116). An appropriate number of cells (e.g., 3 × 10^6 cells) should be used to form the tumor. Subcutaneous injection into the flank of mice. At least 10 mice should be used per group, either bilaterally or unilaterally. On the same day as injection, mice should be switched from their normal diet to a specially formulated experimental diet lacking a specific amino acid / multiple amino acids. A control group receiving a diet containing all amino acids should be included. Tumor length and width should be measured at least twice weekly until death and used to calculate tumor volume. Mice should be allowed to survive until the clinical endpoint, reaching a predetermined maximum tumor volume (as permitted by local ethics), and then culled. The mean tumor volume at each measurement time point before the first mouse dies / is culled should be compared. Significant effects on tumor volume should be assessed by an appropriate TTEST, where P < 0.05 is quantified as significant. Significant changes in survival should be calculated using the Mantel-Cox (log-rank) statistical test, where P < 0.05 is quantified as significant.
[0122] Alternatively, the above measurements can be performed in a manner in which mice are kept on a normal diet after injection of the transplanted cells and are only assigned to an experimental diet upon detection of a measurable tumor. In this case, tumor volume can be compared as an absolute volume or as a percentage of the initial tumor volume upon dietary change.
[0123] Alternatively, allogeneic transplants or in situ models can be used in the same manner as described above.
[0124] 3. Methods for measuring the effects of dietary amino acid composition on cancer cell proliferation / tumor growth and survival in vivo using a genetically engineered mouse model (GEMM). A suitable GEMM (e.g., APC) should be selected. min / + Or Eμ-myc); mice should be fed a normal diet until the dietary change. The dietary change should occur later in life (once the tumor begins to develop), but before death due to the clinical endpoint (tumor-related survival). For example, in APC min / + In mice, the process lasts for 80 days, and in Eμ-myc mice, for 60 days. At the specified age, mice should be transitioned from a normal diet to a specially formulated experimental diet lacking specific amino acids / multiple amino acids. A control group receiving a diet containing all amino acids should be included. If possible, tumor growth should be measured (e.g., by tumor measurement or by biomarker analysis, such as fluorescence signals from fluorescent protein markers in the tumor), and mice should be allowed to reach the clinical endpoint (tumor-related survival). Tumor burden should also be assessed at this time (e.g., by counting / weighing / measuring the tumor).
[0125] The mean tumor volume at each measurement time point should be compared before the first mouse dies / is eliminated. Significance of the effect on tumor volume should be assessed using an appropriate TTEST, where P < 0.05 is quantified as significant. Significant changes in survival should be calculated using the Mantel-Cox (log-rank) statistical test, where P < 0.05 is quantified as significant. For the endpoint of tumor burden, significance of the effect on tumor burden should be assessed using an appropriate TTEST, where P < 0.05 is quantified as significant.
[0126] Alternatively, the diet can be altered early in life, such as on day 10 / day 20 / day 40, and the same results described in (3) above can be measured and compared.
[0127] Suitable dietary products can be largely serine-deficient. Cancer cells can rapidly utilize large amounts of exogenous serine to support their rapid proliferation. When serine is depleted, cancer cells are forced to transport glycolytic intermediates through the serine synthesis pathway. Advantageously, this can lead to reduced proliferation and / or reduced cell survival.
[0128] Suitable dietary products can be substantially deficient in glycine. This can lower blood levels of both glycine and serine, since serine is used to synthesize glycine. Advantageously, the present invention shows that a diet substantially deficient in both serine and glycine can be particularly effective.
[0129] Suitablely, the dietary product can be substantially cysteine-free. This invention surprisingly demonstrates that many cancer cell lines (such as lung, colon, and breast cancer cell lines) consume large amounts of exogenous cysteine. Surprisingly, a diet substantially lacking cysteine can inhibit cell growth and lead to cancer cell death, as shown, for example, in colorectal cell lines. Suitablely, dietary products that are substantially cysteine-free or have limited cysteine levels can be particularly effective for subjects with downregulated MTAP expression.
[0130] Suitable dietary products can be substantially deficient in tyrosine. The present invention has surprisingly discovered that tyrosine restriction, alone or in combination with other non-essential amino acids, can reduce cancer cell growth.
[0131] Appropriately, dietary products are largely lacking: a. Glycine, serine, and cysteine; b. Glycine, serine, and arginine; c. Glycine, serine, and tyrosine; d. Glycine, serine, arginine, and cysteine; e. Glycine, serine, tyrosine, and cysteine; f. Cysteine and arginine; g. Cysteine and tyrosine; h. Cysteine and glycine; i. Cysteine, tyrosine, and arginine; or j. Glycine, serine, arginine, tyrosine, and cysteine.
[0132] Advantageously, the present invention surprisingly demonstrates that such combinations are particularly effective in inhibiting cell proliferation and / or inducing cancer cell death.
[0133] On the one hand, dietary products are largely deficient in glycine, serine, and cysteine. This invention has demonstrated that this combination is surprisingly effective in inhibiting cancer cell proliferation and increasing cancer cell death in many cancer cell lines, including colorectal cancer (such as in HCT116 and RKO), liver cancer (HepG2), osteosarcoma (U2OS), and breast cancer (MDA MB 231).
[0134] On the one hand, dietary products are largely deficient in glycine, serine, and arginine. This invention has demonstrated that this combination is surprisingly effective in inhibiting cancer cell proliferation and / or increasing cancer cell death in colorectal cancer cell lines such as RKO and HCT116.
[0135] On the one hand, dietary products are largely deficient in glycine, serine, and tyrosine. This invention has demonstrated that this combination is surprisingly effective in inhibiting cancer cell proliferation and / or increasing cancer cell death in colorectal cancer cell lines such as RKO and HCT116.
[0136] On the one hand, the dietary product is largely deficient in glycine, serine, arginine, and cysteine. Surprisingly, this combination has been shown to be particularly effective in inducing cell death in colorectal cancer cell lines.
[0137] On the one hand, the dietary composition may be essentially deficient in glycine, serine, arginine, tyrosine, and cysteine.
[0138] Suitablely, in all respects, dietary products may contain any one or any combination of methionine, glutamine, and leucine. Advantageously, leucine and glutamine.
[0139] Dietary products may also contain methionine at levels below 25 mg / kg subject body weight / day, or below 20 mg / kg / day, or below 18 mg / kg / day, or below 16 mg / kg / day.
[0140] Unless otherwise stated herein, the dietary products of this invention can be formulated to provide at least the recommended daily intake of essential amino acids based on average total daily protein consumption.
[0141] Based on average daily total protein consumption, the Institute of Medicine recommends the following daily essential amino acid intakes: histidine 18 mg / g protein consumption; isoleucine 25 mg / g protein; leucine 55 mg / g protein, lysine 51 mg / g protein, a combination of methionine and cysteine 25 mg / g protein; a combination of phenylalanine and tyrosine 47 mg / g protein, threonine 27 mg / g protein, tryptophan 7 mg / g protein, and valine 32 mg / g protein. Tyrosine and cysteine are non-essential amino acids. When the dietary product of the present invention is substantially deficient in tyrosine and / or cysteine, the dietary product will be adjusted to provide phenylalanine and methionine levels, thereby providing at least 25 mg / g of methionine and at least 47 mg / g of phenylalanine based on average daily protein consumption.
[0142] Appropriately, a cysteine-limited dietary product is one formulated to provide less than the recommended daily intake of cysteine based on average daily protein consumption. For example, a cysteine-limited dietary product may provide less than 20 mg / g of protein, less than 15 mg / g of protein, less than 10 mg / g of protein, or less than 5 mg / g of protein.
[0143] Suitable dietary products can be formulated to provide a limited level of total non-essential amino acids per gram of protein consumed. For example, the combined daily intake of non-essential amino acids can be equivalent to a diet substantially lacking at least one, two, three, four, five, six, or seven non-essential amino acids, compared to the recommended daily intake of total non-essential amino acids per gram of protein consumed.
[0144] For example, the Institute of Medicine recommends that adults consume protein at a rate of 0.8 grams per kilogram of body weight per day. Dietary products can be formulated to provide at least 0.8 grams of protein per kilogram of body weight during the recommended daily consumption period.
[0145] Suitable, the dietary products of the present invention can be formulated to provide the aforementioned recommended levels. For example, one or more amino acids can be formulated in the dietary product to provide at least 2, 3, 4, 5, or 6 times the average daily intake based on average daily total protein consumption.
[0146] Suitablely, the amino acids present in the dietary products of the present invention can be in free form, pre-drug form, salts, or amino acid esters. It is also conceivable that amino acids have one or more N-terminal or C-terminal modifications, and in homopolymer, homodimer, heteropolymer, and heterodimer forms.
[0147] Suitable dietary products can be formulated for administration from once to eight times daily. Preferably, from once to four times daily. Thus, dietary products can be formulated into suitable unit dosage forms.
[0148] The dietary products of the present invention may further contain one or more macronutrients and / or micronutrients.
[0149] Guidelines and recommended daily intakes of macronutrients can be found in the Dietary Reference Intakes for Energy, Carbohydrate, Fiber, Fat, Fatty Acids, cholesterol, protein and amino acids published by the Institute of Medicine in September 2002.
[0150] A non-exhaustive list of macronutrients that can be other components of dietary products includes: carbohydrates, fiber, and fats (such as n-6 polyunsaturated fatty acids, n-3 polyunsaturated fatty acids, saturated fatty acids and trans fatty acids, as well as cholesterol).
[0151] A non-exhaustive list of micronutrients includes vitamins A, C, D, E, and K, thiamine, riboflavin, niacin, vitamin B6, folic acid, vitamin B12, pantothenic acid, biotin, choline, calcium, chromium, copper, fluoride, iodine, iron, magnesium, molybdenum, phosphorus, selenium, zinc, potassium, sodium, and chloride. Suitable dietary products can be formulated to provide these at acceptable or recommended daily intakes, as detailed in the publication "Dietary Reference Intakes: RDA and A1 for Vitamins and Elements," NAS. IOM. Food and Nutrition Board.
[0152] An imbalanced diet often presents as a deficiency of two or more non-essential amino acids, optionally supplemented by an excess of one or more other amino acids. For example, the essentially deficient amino acid may be at least 10, 15, 20, 30, 45, 50, 100, or 1000 times lower in abundance than the average abundance of other amino acids. Foods low in protein but rich in other nutrients, such as fruits, vegetables, and certain nuts, can be consumed according to a dietitian's recommendations to ensure that the ratio of amino acid intake in the diet remains at the expected level. This diet is intended to be consumed alone or in combination with drug therapies, such as those with anti-cancer activity.
[0153] In some embodiments, the dietary product of the present invention is formulated across two or more dietary supplements, which together provide the dietary product of the present invention. These can be administered to the subject simultaneously or sequentially, such that the average diet provided by the combination of dietary supplements provides the dietary product of the present invention. This can be advantageous in increasing the dietary diversity of the subject.
[0154] Dietary products may be provided in the form of powders, gels, solutions, suspensions, pastes, solids, liquids, liquid concentrates, reconfigurable powders, shakes, concentrates, pills, bars, tablets, capsules, or ready-to-use products. Conversely, dietary products may also be pharmaceutical compositions when the supplement is in the form of tablets, pills, capsules, liquids, aerosols, injectable solutions, or other pharmaceutically acceptable formulations. Suitably, dietary products may be beverages. Suitably, beverages may be administered 2 to 6 times daily.
[0155] Appropriately, dietary products may not be naturally occurring foods.
[0156] Suitable, dietary products may contain compounds other than specific amino acids. Suitable, such compounds may not contribute to the de novo synthesis of amino acids that are essentially lacking.
[0157] As used in this article, “substantially lacking” when referring to an amino acid means that the amino acid is completely or almost entirely absent (e.g., in trace amounts).
[0158] Optionally, it will be administered intravenously. Optionally, parenteral administration may be provided by bolus injection or by infusion.
[0159] Appropriately, dietary products can be: a) Tube-fed enteral nutritional products (such as nasogastric nutrition products, which can be administered via NG tube; nasojejunal nutrition products, which can be administered via NJ tube; or PEG (percutaneous endoscopic gastrostomy) tube nutrition products). b) Parenteral nutrition products (which can be administered via a central venous catheter, for example, through a dedicated lumen on a venous catheter); or c) Intravenous infusion products.
[0160] Preferably, enteral nutrition can be administered via tube feeding.
[0161] In some embodiments, the diet or the dietary product of the present invention is administered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, at least 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, or until a treatment endpoint is observed (e.g., tumor shrinkage is observed).
[0162] The present invention also provides a process for preparing the dietary products of the present invention, wherein amino acids are dissolved or dispersed in water and spray-dried.
[0163] Where appropriate, amino acids can be mixed with other components such as macronutrients and micronutrients. Binders, emulsifiers, or other suitable ingredients for human or animal consumption may be added as needed.
[0164] Pharmaceutical Composition In another aspect, the present invention provides a pharmaceutical composition comprising the dietary product of the present invention or a dietary product produced according to the present invention, and a pharmaceutically acceptable carrier, excipient, or diluent.
[0165] The selection of suitable pharmaceutical formulations and routine procedures for their preparation are described, for example, in "Pharmaceuticals - The Science of Dosage Form Designs", ME Aulton, Churchill Livingstone, 1988.
[0166] The compositions of the present invention may be in a form suitable for oral use (e.g., tablets, lozenges, hard capsules or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs).
[0167] The compositions of the present invention can be obtained using conventional pharmaceutical excipients well known in the art through conventional procedures. Therefore, compositions intended for oral use may contain, for example, one or more colorants, sweeteners, flavoring agents, and / or preservatives.
[0168] Suitable, the pharmaceutical composition is formulated into a dietary product of the present invention that provides a therapeutically effective amount.
[0169] The effective dose used in the treatment of a condition is an amount sufficient to symptomatically relieve the symptoms of the condition or slow the progression of the condition in warm-blooded animals, especially humans.
[0170] The term "therapeuticly effective amount" refers to an amount of compound or composition that, when administered, is sufficient to prevent the development of one or more symptoms of the condition, disorder, or disease being treated, or to alleviate such symptoms to some extent. The term "therapeuticly effective amount" also includes an amount of compound or composition sufficient to elicit a biological or medical response in cells, tissues, organs, systems, animals, or humans, as sought by an investigator, physician, or clinician. In any given case, the appropriate "effective" amount can be determined by one of those skilled in the art using routine experiments. It should be understood that the specific dose level and frequency of administration for any particular patient can vary and will depend on a variety of factors, including the activity of the specific compound used; the compound's bioavailability, metabolic stability, excretion rate, and duration of action; the manner and timing of compound administration; the patient's age, weight, general health condition, sex, and diet; and the severity of the specific condition being treated.
[0171] The terms "treat," "treating," and "treatment" encompass the reduction or elimination of a condition, disorder, or disease, or one or more symptoms associated with a condition, disorder, or disease, and also encompass the reduction or eradication of the cause of the condition, disorder, or disease itself. In some embodiments, the terms "treat," "treating," and "treatment" refer to the administration of a compound, pharmaceutical composition, or pharmaceutical dosage form to a subject to reduce, eliminate, or prevent a condition, disorder, or disease, or its associated symptoms, or its cause.
[0172] Suitably, the pharmaceutical compositions of the present invention may further comprise therapeutic agents selected from: cancer cell growth inhibitors, radiotherapy agents, chemotherapy agents, amino acid metabolism / turnover / interconversion inhibitors, non-essential amino acid biosynthesis inhibitors, amino acid transport inhibitors, enzymes or drugs that promote amino acid degradation, or substances that chelate amino acids. The therapeutic agents may inhibit OXPHOS and / or may increase reactive oxygen species and / or reduce antioxidant defense.
[0173] Cancer and proliferation disorders In one aspect, the present invention provides dietary products of the present invention or dietary products produced according to the process of the present invention or pharmaceutical compositions of the present invention for use in medicines.
[0174] For example, the present invention provides dietary products of the present invention or dietary products produced according to the process of the present invention or pharmaceutical compositions of the present invention for use in cancer treatment.
[0175] In another aspect, the present invention provides the use of the dietary products of the present invention, or dietary products produced according to the present invention, or pharmaceutical compositions of the present invention, in the preparation of medicaments for treating cancer.
[0176] In another aspect, the present invention provides a method for treating cancer in a subject, the method comprising administering a therapeutically effective amount of a dietary product to the subject.
[0177] For all aspects, exemplary cancers include, but are not limited to, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphomas, anal cancer, anorectal cancer, anal canal cancer, appendiceal cancer, childhood cerebellar astrocytoma, childhood cerebral astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), bile duct cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumors, brainstem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor. Tumors), visual pathway and hypothalamic glioma, breast cancer, bronchial adenoma / carcinoid, carcinoid tumor, gastrointestinal, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myelodysplastic disorder, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoma, mycosis fungoides, Seziary syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumor, gonadal extragerminal tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, ovarian germ cell tumor, gestational trophoblastic tumor glioma, head and neck cancer, hepatocellular carcinoma, Hodgkin lymphoma. Lymphoma, hypopharyngeal cancer, intraocular melanoma, eye cancer, islet cell tumor (endocrine pancreas), Kaposi's sarcoma, kidney cancer, renal cancer, laryngeal cancer, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, lip and oral cancer, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, AIDS-related lymphoma, non-Hodgkin's lymphoma.Lymphoma, primary central nervous system lymphoma, Waldenstram macroglobulinemia, medulloblastoma, melanoma, intraocular (ocular) melanoma, Merkel cell carcinoma, mesothelioma, malignant mesothelioma, mesothelioma, metastatic squamous neck cancer, oral cancer, tongue cancer, polyendocrine neoplasia syndrome, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disorders, chronic myeloid leukemia, acute myeloid leukemia, multiple myeloma, chronic myeloproliferative disorders, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oral cavity cancer, oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, low-potency ovarian tumors, pancreatic cancer, islet cell pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer Cancer), pheochromocytoma, pineal cell carcinoma and supratentorial primitive neuroectodermal tumors, pituitary tumors, plasmacytoma / multiple myeloma, pleural pulmonary blastoma, prostate cancer, rectal cancer, renal pelvis and ureter, transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing family of sarcoma tumors, Kaposi's sarcoma, soft tissue sarcoma, uterine cancer, uterine sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), Merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) cancer. Cancer), supratentorial primitive neuroectodermal tumors, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter and other urinary organs, gestational trophoblastic tumors, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine corpus cancer, vaginal cancer, vulvar cancer, and Wilm's tumor. In some embodiments, cancer is selected from the group consisting of colorectal cancer, liver cancer, osteosarcoma, lymphoma, breast cancer, and lymphoma.
[0178] Cancer can be positive for wild-type KRAS.
[0179] Cancer may have already deregulated cMyc expression.
[0180] Cancer can be a tumor that exhibits downregulated MTAP expression. Cancer can be a solid tumor or a hematologic malignancy.
[0181] Exemplary solid tumors include, but are not limited to, mesothelioma, lung cancer, non-small cell lung cancer (NSCLC), adenocarcinoma, squamous cell carcinoma, glioma, pancreatic tumor, pancreatic cancer, ampullary cancer, gallbladder cancer, bile duct cancer, soft tissue sarcoma, esophageal cancer, endometrial cancer, chondrosarcoma, osteosarcoma, gastrointestinal stromal tumors and chordoma, primary malignant melanoma, metastatic melanoma, and primary breast cancer.
[0182] Exemplary hematologic malignancies include, but are not limited to, diffuse large cell lymphoma, low-grade lymphoma, B-line acute lymphoblastic leukemia, mantle cell lymphoma, T-cell acute leukemia, adult T-cell leukemia, and T-cell-derived lymphoma. The lymphoma may optionally be transformed.
[0183] Suitablely, the dietary products of the present invention can be effective in treating diseases or disorders in which abnormal or otherwise unwanted proliferation of cells can lead to debilitating symptoms.
[0184] Dietary products can be substantially lacking in cysteine. Appropriately, diets substantially lacking cysteine can be effective in cancers that rely on high intake of exogenous cysteine, such as lung cancer, colorectal cancer, and breast cancer. Appropriately, diets substantially lacking cysteine can be effective in cancers with downregulated MTAP expression. Dietary products can be substantially lacking in serine and / or glycine. Appropriately, diets substantially lacking serine and / or glycine can be effective in cancers that rely on high consumption of exogenous serine and / or glycine, such as lung cancer, colorectal cancer, breast cancer, lymphoma, colorectal cancer, liver cancer, osteosarcoma, and breast cancer.
[0185] Dietary products can be largely deficient in arginine and / or tyrosine. Appropriately, a diet largely deficient in arginine may be effective in cancers such as colorectal cancer.
[0186] Combination therapy The dietary products or pharmaceutical compositions of the present invention can be used alone to provide therapeutic effects. Suitably, the dietary products or pharmaceutical compositions of the present invention can also be used in combination with one or more other chemotherapeutic agents and / or radiotherapy.
[0187] This type of chemotherapy may include one or more of the following classes of anticancer agents: (i) Antiproliferative / antitumor drugs and combinations thereof, such as alkylating agents (e.g., cisplatin, oxaliplatin, carboplatin, cyclophosphamide, nitrogen mustard, uracil mustard, bendamustine, melphalan, chlorambucil, nitrogen mustard hydrochloride, busulfan, temozolomide, nitrosourea, ifosamide, melphalan, piperobromidine, triethylene melamine, triethylenethiophoporamine, carmustine, lomustine, streptozocin, and dacarbazine); antimetabolites (e.g., gemcitabine and folic acid antagonists such as fluoropyrimidines like 5-fluorouracil and...). Tegafur, raltitrexed, methotrexate, pemetrexed, cytosine arabinoside, fluorouracil, vidarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatin, gemcitabine, and hydroxyurea; antibiotics (e.g., anthracyclines such as doxorubicin, bleomycin, doxorubicin, daunorubicin, epirubicin, idarubicin, mitomycin-C, styromycin, and sclerotinib); antimitotic agents (e.g., vinblastine alkaloids such as vincristine, vinblastine, vinorelbine, and vinorelbine, and taxanes such as paclitaxel and taxotere). ), and polokinase inhibitors; proteasome inhibitors such as carfilzomib and bortezomib; interferon therapy; and topoisomerase inhibitors (e.g., epipodophyllotoxins such as etoposide and teniposide, acridine, topotecan, irinotecan, mitoxantrone, and camptothecin); bleomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, ara-C, paclitaxel (Taxol™), albumin-bound paclitaxel (abpaclitaxel), docetaxel (docetaxel), styramycin, deoxygenin Deoxyformycin, mitomycin-C, L-asparaginase, interferon (especially IFN-α), etoposide, teniposide, DNA demethylating agents (e.g., azacitidine or decitabine); and histone deacetylase (HDAC) inhibitors (e.g., vorinostat, MS-275, panobinostat, romidepsin, valproic acid, moxetine (MGCD0103), and prasinostat SB939). (ii) Cell growth inhibitors such as anti-estrogens (e.g., tamoxifen, fulvestrant, toremifene, raloxifene, droloxifene, and iodoxyfene), anti-androgens (e.g., bicalutamide, flutamide, nilumet, and cyproterone acetate), LHRH antagonists or LHRH agonists (e.g., goserelin, leuprorelin, and buserelin), progestins (e.g., megestrol acetate), aromatase inhibitors (e.g., anastrozole, letrozole, vorazole, and exemestane), and 5* reductase inhibitors such as finasteride; and avelbene, CPT-II, anastrozole, letrozole, capecitabine, reloxafme, cyclophosphamide, ifosfamide, and droloxifene; (iii) Anti-invasive agents such as dasatinib and bosutinib (SKI-606), as well as inhibitors of metalloproteinases, inhibitors of urokinase plasminogen activator receptor function, or antibodies against heparanase. (iv) Inhibitors of growth factor function: For example, such inhibitors include growth factor antibodies and growth factor receptor antibodies such as the anti-erbB2 antibody trastuzumab [Herceptin™], the anti-EGFR antibody panitumumab, the anti-erbB1 antibody cetuximab, and tyrosine kinase inhibitors such as inhibitors of the epidermal growth factor family (e.g., EGFR family tyrosine kinase inhibitors such as gefitinib, erlotinib, and 6-acrylamido-N-(3-chloro-4-fluorophenyl)-7-(3-morpholinopropoxy)-quinazoline-4-amine (CI). 1033), afatinib, van der tanib, osimertinib, and rochiglitinib; erbB2 tyrosine kinase inhibitors such as lapatinib; and antibodies against co-stimulatory molecules such as CTLA-4, 4-lBB, and PD-1, or cytokine antibodies (IL-10, TGF-β); inhibitors of the hepatocyte growth factor family; inhibitors of the insulin-like growth factor family; regulators of apoptosis protein regulators (e.g., Bcl-2 inhibitors); inhibitors of the platelet-derived growth factor family, such as imatinib and / or nilotinib (AMN107); inhibitors of serine / threonine kinases (e.g., Ras / Raf signaling inhibitors such as farnesyltransferase). Inhibitors (such as sorafenib, tipirafenib, and lonafanib), inhibitors of cell signaling via MEK and / or AKT kinases, c-kit inhibitors, abl kinase inhibitors, PI3 kinase inhibitors, Plt3 kinase inhibitors, CSF-1R kinase inhibitors, IGF receptor kinase inhibitors; aurora kinase inhibitors and cyclin-dependent kinase inhibitors such as CDK2 inhibitors and / or CDK4 inhibitors; CCR2, CCR4, or CCR6 antagonists; and RAF kinase inhibitors, such as those described in WO2006043090, WO2009077766, WO2011092469, or WO2015075483.
[0188] (v) Anti-angiogenic agents, such as those that inhibit the effects of vascular endothelial growth factor (VEGF), [e.g., the anti-VEGF antibody bevacizumab (Avastin™)]; thalidomide; lenalidomide; and VEGF receptor tyrosine kinase inhibitors such as vandetanib, vatalanib, sunitinib, axitinib, and pazopanib; (vi) Gene therapy methods, including, for example, replacing aberrant genes such as aberrant p53 or aberrant BRCA1 or BRCA2; (vii) Immunotherapy methods, including, for example, antibody therapies such as alemtuzumab, rituximab, ibritumomab tiuxetan (Zevalin®), and oframumab; interferons such as interferon-alpha; interleukins such as IL-2 (aldesleukin); interleukin inhibitors such as IRAK4 inhibitors; cancer vaccines, including prophylactic and therapeutic vaccines, such as HPV vaccines such as Gardasil, Cervarix, Oncophage, and Sipuleucel-T (Provenge); gp100; dendritic cell-based vaccines (such as Ad.p53). DC); Toll-like receptor modulators such as TLR-7 or TLR-9 antagonists; PD-1, PD-L1, PD-L2 and CTL4-A modulators (e.g., nifroma), antibodies and vaccines; other IDO inhibitors (such as indomethacin); anti-PD-1 monoclonal antibodies (such as MK-3475 and nifroma); anti-PDL1 monoclonal antibodies (such as MEDI-4736 and RG-7446); anti-PDL2 monoclonal antibodies; and anti-CTLA-4 antibodies (such as ipilimumab); and (viii) Cytotoxic agents such as fludaribine (fludara), cladribine, and pentostatin (Nipent™); (ix) Targeted therapies, such as PI3K inhibitors, like idelalisib and perifosine; SMAC (second mitochondrial-driven activator of caspase) mimics, also known as inhibitors of apoptosis proteins (IAP) antagonists. These agents inhibit IAPs such as XIAP, clAP1, and clAP2, thereby reconstructing the apoptotic pathway. Specific SMAC mimics include Birinapant (TL32711, TetraLogic Pharmaceuticals), LCL161 (Novartis), AEG40730 (Aegera Therapeutics), SM-164 (University of Michigan), LBW242 (Novartis), ML101 (Sanford-Burnham Medical Research Institute), AT-406 (Ascenta Therapeutics / University of Michigan), GDC-0917 (Genentech), AEG35156 (Aegera Therapeutic), and HGS1029 (Human Genome Sciences); and agents targeting the ubiquitin-proteasome system (UPS), such as bortezomib, carfizzomib, marizomib (NPI-0052), and MLN9708; and (xii) Chimeric antigen receptors, anticancer vaccines, and arginase inhibitors.
[0189] Suitably, the compositions of the present invention can be used in combination with one or more therapeutic enzymes that consume amino acids. Such therapeutic enzymes can be associated with the compositions of the present invention. For example, for compositions that are substantially deficient in arginine, therapeutic enzymes such as arginase can be used.
[0190] Alternatively, the compositions of the present invention may be used in combination with one or more compounds that participate in inhibiting de novo amino acid synthesis. Such compounds may be associated with the compositions of the present invention. For example, for compositions substantially lacking serine, compounds that inhibit de novo serine synthesis, such as PHGDH inhibitors, PSAT1 inhibitors, and PSPH inhibitors, may be used.
[0191] The therapeutic agent used in the method of the present invention can be a single agent or a combination of agents. Preferred combinations will include agents with different mechanisms of action.
[0192] In this document, when the term "combination" is used, it should be understood that this refers to simultaneous, separate, or successive application. In one aspect of the invention, "combination" refers to simultaneous application. In another aspect of the invention, "combination" refers to separate application. In yet another aspect of the invention, "combination" refers to successive application. In cases where application is successive or separate, a delay in the application of the second component should not result in a loss of the beneficial effects of the combination.
[0193] As used herein, the term "administered in combination with" and the grammatical equivalents are equally intended to cover the administration of a selected therapeutic agent to a single patient, and are intended to include treatment regimens in which the agent is administered via the same or different routes of administration or at the same or different times. In some embodiments, the compounds described herein will be administered in combination with other agents. These terms cover the administration of two or more agents to an animal such that both the agent and / or its metabolites are present in the animal. This includes simultaneous administration in separate compositions, administration in separate compositions at different times, and / or administration in a composition in which both agents are present.
[0194] The agents disclosed herein can be administered via any route, including intradermal, subcutaneous, oral, intra-arterial, or intravenous administration.
[0195] In some embodiments using combination therapy, when combined, the amount of the dietary product or pharmaceutical composition of the present invention and the amount of other pharmaceutically active agents are therapeutically effective in treating the targeted condition in a patient. In this case, when combined, the amount is considered a "therapeuticly effective amount" if the combined amount is sufficient to reduce or completely alleviate the symptoms or other adverse effects of the condition; cure the condition; reverse, completely stop, or slow the progression of the condition; or reduce the risk of the condition worsening. Typically, those skilled in the art can determine such an amount, for example, by starting with the dosage range of the compounds of the present invention described in this specification and the approved or otherwise published dosage ranges of other pharmaceutically active compounds.
[0196] According to another aspect of the invention, a dietary product or pharmaceutical composition of the invention as defined above and an additional anticancer agent as defined above are provided for use in combination therapy for cancer. According to another aspect of the invention, a method for treating a human or animal subject suffering from cancer is provided, the method comprising administering, simultaneously, sequentially, or individually, a therapeutically effective amount of the dietary product or pharmaceutical composition of the invention, together with an additional anticancer agent as defined above, to the subject.
[0197] According to another aspect of the invention, dietary products or pharmaceutical compositions of the invention are provided for use in cancer treatment, simultaneously, sequentially, or alone with additional anticancer agents as defined above.
[0198] The dietary products or pharmaceutical compositions of the present invention can also be used in combination with radiotherapy. Suitable radiotherapy treatments include, for example, X-ray therapy, proton beam therapy, or electron beam therapy. Radiotherapy may also encompass the use of radionuclide agents, such as 131I, 32P, 90Y, 89Sr, 153Sm, or 223Ra. Such radionuclide therapies are well known and commercially available. According to another aspect of the invention, dietary products or pharmaceutical compositions of the present invention, as defined above, or pharmaceutically acceptable salts thereof, are provided for use in combination with radiotherapy in the treatment of cancer.
[0199] According to another aspect of the invention, a method for treating a human or animal subject suffering from cancer is provided, the method comprising administering, simultaneously, sequentially, or separately to the subject, a therapeutically effective amount of the dietary product or pharmaceutical composition of the invention or a pharmaceutically acceptable salt thereof.
[0200] Suitablely, the present invention has surprisingly discovered that the combination of a diet substantially lacking at least one amino acid with at least one chemotherapeutic agent or radiotherapy can be more than just additive.
[0201] Suitablely, in some embodiments, the present invention may provide a synergistic combination of the dietary product or pharmaceutical composition of the present invention with at least one chemotherapeutic agent or radiotherapy.
[0202] In one embodiment, the dietary product or pharmaceutical composition of the present invention may be combined with one or more classes of chemotherapeutic agents selected from the group consisting of HDAC inhibitors, MTOR inhibitors, tyrosine kinase inhibitors, and proteasome inhibitors.
[0203] HDAC inhibitors Suitablely, a chemotherapy agent can be one or more histone deacetylase (HDAC) inhibitors. HDAC inhibitors regulate transcription and induce cell growth arrest, differentiation, and apoptosis. HDAC inhibitors (HDACIs) also enhance the cytotoxic effects of therapeutic agents used in cancer treatment, including radiation and chemotherapy drugs.
[0204] The term "HDAC" refers to a family of enzymes that remove acetyl groups from proteins, such as the ε-amino group of the N-terminal lysine residue of histones. HDACs can be human HDACs, including HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, and HDAC11. HDACs can also be derived from protozoan or fungal sources.
[0205] HDAC inhibitors (HDACIs) typically contain three structural elements similar to acetyllysine. These three structural elements are a zinc-binding group (M), which is responsible for chelating zinc in the active site; a linker region (L), which binds to the hydrophobic channel on the external enzyme surface; and a capping group (Cap), which interacts with residues on the external enzyme surface.
[0206] Examples of HDAC inhibitors include: SAHA, Romidepsin, valproic acid, PCI-24781, ITF-2357, MS275, Panbinoastat, Belinostat, Vorinodat, MGCD0103, and EVP-0334.
[0207] The present invention has surprisingly discovered that HDAC inhibitors such as romimetaside and vorinostat can synergize with the dietary products or pharmaceutical compositions of the present invention.
[0208] Suitably, the dietary products or pharmaceutical compositions of the present invention can be used in combination with HDAC inhibitors for any indication in which HDAC inhibitors have already proven effective in treatment. HDAC inhibitors have been approved or are undergoing clinical trials for at least the following: for example, T-cell lymphoma, multiple myeloma, renal cell carcinoma, Hodgkin's lymphoma, follicular lymphoma, leukemia, acute myeloid leukemia, melanoma, non-small cell lung cancer, solid tumors, prostate cancer, diffuse large B-cell lymphoma, and mesothelioma. Preferably, the HDAC inhibitor is romimetabolic peptide and / or vorinostat.
[0209] mTOR inhibitors Suitablely, the chemotherapeutic agent may be one or more mammalian targets of rapamycin (mTOR) inhibitors. As used herein, the phrase "mTOR inhibitor" includes, but is not limited to, compounds, proteins, or antibodies that target / inhibit the activity of members of the mTOR kinase family. Examples of mTOR activity inhibitors include, for instance, rapamycin with the following formula:
[0210] and rapamycin derivatives, such as including 40-O-substituted rapamycin derivatives, such as 40-O-alkyl-rapamycin derivatives, such as 40-O-hydroxyalkyl-rapamycin derivatives, such as 40-O-(2-hydroxy)-ethyl-rapamycin (everolimus), 32-Deoxyrapamycin derivatives and 32-hydroxyrapamycin derivatives, such as 32-deoxyrapamycin, 16-O-substituted rapamycin derivatives, such as 16-pent-2-alkynoxy-32-deoxyrapamycin, 16-pent-2-alkynoxy-32(S or R)-dihydro-rapamycin, 16-pent-2-alkynoxy-32(S or R)-dihydro-40-O-(2-hydroxyethyl)-rapamycin, Rapamycin derivatives acylated at the 40-oxy group, such as 40-[3-hydroxy-2-(hydroxy-methyl)-2-methylpropionate]-rapamycin (also known as CCI779), and rapamycin derivatives substituted with a heterocyclic group at the 40-position, such as 40-epio-(tetrazole)-rapamycin (also known as ABT578). So-called rapalogs, such as those disclosed in WO9802441 or WO0114387, include rapamycin derivatives containing 40-O-phosphate, such as 40-O-dimethylphospho-rapamycin, including AP23573, and 40-O-alkoxy-alkyl-rapamycin derivatives, such as compounds disclosed under the name biolimus (biolimus A9), including 40-O-(2-ethoxy)-ethyl-rapamycin (everolimus), and compounds disclosed under the names TAFA-93, AP23464, AP23675 or AP23841.
[0211] The present invention has surprisingly discovered that mTOR inhibitors such as tesiromoxetine and everolimus can synergize with the dietary products or pharmaceutical compositions of the present invention.
[0212] Suitably, the dietary products or pharmaceutical compositions of the present invention can be used in combination with mTOR inhibitors for any indication in which the mTOR inhibitors have already proven effective in treatment. mTOR inhibitors have been approved or are undergoing clinical trials in at least the following: for example, lymphocytic leukemia, colon and breast cancer, melanoma and ependymoblastoma, skin cancer, central nervous system tumors; renal cell carcinoma, mantle cell lymphoma, and neuroendocrine tumors of the breast and pancreas. Preferably, the mTOR inhibitor is tesimolimus and / or everolimus.
[0213] Tyrosine kinase inhibitors Appropriately, a chemotherapy agent can be one or more tyrosine kinase inhibitors.
[0214] Tyrosine kinases play a role in cell signal transduction. Cell proliferation, differentiation, migration, metabolism, and programmed cell death are examples of tyrosine kinase-mediated cellular responses. Various tyrosine kinase inhibitors are known to be effective in cancer treatment, and in one implementation, any known tyrosine kinase inhibitor may be used. Such inhibitors include commercially available inhibitors and inhibitors under development.
[0215] This includes small molecule inhibitors such as curcumin, difluorinated curcumin (DFC), [3-{5-[4-(cyclopentoxy)-2-hydroxybenzoyl]-2-[(3-hydroxy-1,2-benzisoxazol-6-yl)methoxy]phenyl}propionic acid] (T5224, Roche), nordihydroguaiac acid (NDGA), dihydroguaiac acid (DHGA), and [(E,E,Z,E)-3-methyl-7-(4-methylphenyl)-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonacarbontetracrotonic acid (SR1) 1302, TocrisBiosciences), (EJ-2-benzyl-3-(cyclohexylamino)-2,3-dihydro-1H-indone (BCI), TPI-2, TPI-3, tripterygium lactone, lapatinib, iritinib, sunitinib, and vemurafenib (PLX4032). In one embodiment, the c-Fos inhibitor used in the composition is curcumin, difluorinated curcumin (DFC), [3-{5-[4-(cyclopentoxy)-2-hydroxybenzoyl]-2-[(3-hydroxy-1,2-benzisoxazol-6-yl)methoxyphenyl}propionic acid] (T5224, Roche), desdihydroguaiac acid (NDGA), dihydroguaiac acid (DHGA), and [(E,E,Z,E)-3-methyl-7-(4-methylphenyl)-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonacarbontetracrotonic acid (SR1 1302, Tocris Biosciences). In one embodiment, the inhibitor of Dusp-1 is (EJ-2-benzylidene-3-(cyclohexylamino)-2,3-dihydro-1H-indone (BCI), also known as NSC 1501 17, TPI-2, TPI-3, and triptolide. In one embodiment, the inhibitor of tyrosine kinase is lapatinib, eletinib, sunitinib, and vemurafenib.
[0216] Further examples of tyrosine kinase inhibitors that can be used as chemotherapeutic agents according to the present invention include: afafenib (Giotrif), axitinib (Inlyta), bosutinib (Bosulif), crizotinib (Xalkori), dasatinib (Sprycel), erlotinib (Tarceva), gefitinib (Iressa), imatinib (Glivec), lapatinib (Tyverb), nilotinib (Tasigna), pazopanib (Votrient), regorafenib (Stivarga), sorafenib (Nexavar), and sunitinib (Sutent).
[0217] The present invention has surprisingly discovered that tyrosine kinase inhibitors such as dasatinib and regorafenib can synergize with the dietary products or pharmaceutical compositions of the present invention.
[0218] Suitably, the dietary products or pharmaceutical compositions of the present invention can be used in combination with tyrosine kinase inhibitors for any indication in which the tyrosine kinase inhibitors are useful in treatment. Tyrosine kinase inhibitors have been approved or are undergoing clinical trials in at least the following: for example, non-small cell lung cancer, renal cell carcinoma, soft tissue sarcoma, thyroid cancer, chronic myeloid leukemia (CML), lung cancer, acute myeloid leukemia, acute lymphoblastic leukemia, gastrointestinal stromal tumors (GIST), sarcomas, chronic eosinophilic leukemia, colorectal cancer, liver cancer, and pancreatic cancer. Preferably, the tyrosine kinase inhibitor is dasatinib and / or regorafenib.
[0219] Appropriately, the cancers to be treated when using dasatinib and / or regorafenib are colorectal cancer, chronic myeloid leukemia (CML), acute myeloid leukemia, acute lymphoblastic leukemia, bowel cancer, or GIST.
[0220] Proteasome inhibitors Appropriately, a chemotherapy agent may be one or more proteasome inhibitors.
[0221] Proteasome inhibitors are inhibitors of the ubiquitin-proteasome system (UPS), a non-lysosomal protein degradation pathway. The binding of ubiquitin to the protein surface is a multi-step process in which ubiquitin is activated by an E1 conjugating enzyme and transferred by ubiquitin conjugating enzymes (E2) and E3 ubiquitin ligases. Such inhibitors can include commercially available inhibitors and those under development.
[0222] Examples include: bortezomib (Velcade) and its analogues (such as boric acid derivatives, derivatives based on benzylmalonic acid and amino acids, and borate esters), salinosporamide A (NPI-0052), PR-171, E1 conjugating enzyme inhibitors, POSH inhibitors, MDM2-p53 inhibitors, and deubiquitinating enzyme inhibitors.
[0223] The present invention has surprisingly discovered that proteasome inhibitors such as carfilzomib can synergize with the dietary products or pharmaceutical compositions of the present invention.
[0224] Suitable, the dietary products or pharmaceutical compositions of the present invention can be used in combination with proteasome inhibitors for any indication in which the proteasome inhibitors are useful in treatment.
[0225] Non-limiting examples of solid tumors that can be treated with publicly available proteasome inhibitors include pancreatic cancer; bladder cancer; colorectal cancer; breast cancer, including metastatic breast cancer; prostate cancer, including androgen-dependent and androgen-independent prostate cancer; kidney cancer, including, for example, metastatic renal cell carcinoma; hepatocellular carcinoma; lung cancer, including, for example, non-small cell lung cancer (NSCLC), bronchoalveolar carcinoma (BAC), and lung adenocarcinoma; ovarian cancer, including, for example, progressive epithelial carcinoma or primary peritoneal carcinoma; cervical cancer; gastric cancer; esophageal cancer; head and neck cancers, including, for example, squamous cell carcinoma of the head and neck; melanoma; neuroendocrine carcinomas, including metastatic neuroendocrine tumors; brain tumors, including, for example, gliomas, anaplastic oligodendrogliomas, adult glioblastoma multiforme, and adult anaplastic astrocytomas; bone cancer; and soft tissue sarcomas.
[0226] Non-limiting examples of hematologic malignancies that can be treated with publicly available proteasome inhibitors include acute myeloid leukemia (AML); chronic myeloid leukemia (CML), including accelerated CMIL and CML blast crisis (CMIL-BP); acute lymphoblastic leukemia (ALL); chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); non-Hodgkin's lymphoma (NHL), including follicular lymphoma and mantle cell lymphoma; B-cell lymphoma; T-cell lymphoma; multiple myeloma (MM); Waldenstrom's macroglobulinemia; myelodysplastic syndromes (MDS), including refractory anemia (RA), refractory anemia with ring sideroblasts (RARS) (refractory anemia with excessive fibroblasts (RAEB) and transforming RAEB (RAEB-T); and myelodysplastic syndromes.
[0227] Preferably, the proteasome inhibitor is carfilzomib.
[0228] Appropriately, the cancer to be treated with carfilzomib is multiple myeloma or T-cell lymphoma.
[0229] EGFR inhibitors Suitablely, chemotherapy agents can be one or more epidermal growth factor receptor (EGFR) inhibitors. EGFR (also known as ErbB-1 or HER-1) inhibitors refer to cell surface receptor inhibitors of extracellular protein ligands belonging to the EGF family. EGFR plays a crucial role in controlling normal cell growth, apoptosis, and other cellular functions. Mutations in EGFR can lead to continuous or aberrant activation of the receptor, resulting in unregulated cell division, which can explain certain types of cancer.
[0230] On one hand, the term “EGFR” refers to HER2 / c-neu (ErbB-2), HER3 (ErbB-3), and HER4 (ErbB-4), as well as EGFR (ErbB-1).
[0231] The present invention has surprisingly discovered that EGFR inhibitors, such as cetuximab, can synergize with the dietary products or pharmaceutical compositions of the present invention.
[0232] Suitablely, the dietary products or pharmaceutical compositions of the present invention can be used in combination with EGFR inhibitors for any indication in which the EGFR inhibitors are useful in treatment. Non-limiting examples of solid tumors that can be treated with the disclosed EGFR inhibitors include non-small cell lung cancer, pancreatic cancer, breast cancer, colon cancer, and several other cancers caused by upregulation of the epidermal growth factor receptor.
[0233] Examples of EGFR inhibitors include: cetuximab, gefitinib, iritinib, lapatinib, panitumumab, vandetanib, necitumumab, and osimertinib.
[0234] Preferably, the proteasome inhibitor is cetuximab.
[0235] Other chemotherapeutic agents of interest. In one aspect, the dietary product or pharmaceutical composition of the present invention can be combined with one or more chemotherapeutic agents selected from the group consisting of: tamoxifen citrate, metformin, erlotinib hydrochloride, dasatinib, estradiol phosphate sodium, daunorubicin hydrochloride, vorinostat, cabozantinib, idelalisib, vinorelbine tartrate, sirolimus, hydroxyurea, elphalan hydrochloride, pentorubicin, everolimus, amifostine, retinoid, fludarabine phosphate, dacarbazine, vemurafenib, ceritinib, arsenic trioxide, temozolomide, and dextromethorphan. Razoxin, Regorafenib, Sorafenib, Exemestane, Romimetsylpeptide, Bosutinib, Capecitabine, Lenalidomide, Allopurinol, Lezocin, Hexamethylmelamine, Cisplatin, Doxorubicin Hydrochloride, Nilotinib, Imiquimod, Carfilzomib, Van der Tanib, Vemodrigin, Fluorouracil, Olaparib, Mitotan, Anastrozole, Epirubicin Hydrochloride, Raloxifene, Lapatinib, Pazopanib Hydrochloride, Fulvestrant, Uramustine, Afatinib, Ifosfamide, Etoposide, Triethylenemelamine, Panatinib and their analogues.
[0236] Advantageously, the present invention has shown that these chemotherapeutic agents have a more than additive effect (i.e., a synergistic effect) when combined with a diet containing limited amounts of serine and glycine.
[0237] Therefore, in one aspect, the present invention provides a synergistic combination of the dietary product or pharmaceutical composition of the present invention with one or more chemotherapeutic agents for use in cancer treatment. Any dose of the chemotherapeutic agent that results in the synergistic combination can be used.
[0238] Suitablely, the chemotherapeutic agent may be daunorubicin. The dietary product or pharmaceutical composition of the present invention, in combination with daunorubicin, can be used for the treatment of, for example, acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, and Kaposi's sarcoma.
[0239] In one respect, the dosage of each chemotherapeutic agent (or the total combined dosage of chemotherapeutic agents) may be equivalent to at least 0.1 g / kg of patient body weight per day, preferably at least 0.2 g / kg, 0.3 g / kg, 0.4 g / kg, or 0.5 g / kg per day. Suitably, the dosage of the chemotherapeutic agent (or combination of chemotherapeutic agents) may be equivalent to at least 1 g / kg per day, preferably 2 g / kg per day.
[0240] For example, for metformin, when the subject is human, the dose may be equivalent to at least 1g per day, preferably 2g per day, or an equivalent dose for non-humans.
[0241] Furthermore, in another aspect, the present invention provides a method for treating cancer in a subject, comprising administering a synergistically effective combination: a) the dietary product of the present invention and b) a chemotherapeutic agent. Suitably, the components of the synergistic combination may be administered simultaneously or sequentially.
[0242] Suitablely, according to all aspects of the invention, the chemotherapeutic agent can: a) inhibit OXPHOS; b) increase reactive oxygen species (ROS); c) reduce antioxidant defense, or d) provide any combination of a)-c).
[0243] Suitablely, chemotherapeutic agents can inhibit OXPHOS. For example, chemotherapeutic agents can be biguanides. It is not intended to be theoretically sound, but it is believed that the dietary products or pharmaceutical compositions of the present invention (especially those substantially lacking at least serine) will improve the antitumor effects of biguanides.
[0244] Suitablely, chemotherapy agents can increase ROS levels. Without being bound by theory, it is believed that the dietary products or pharmaceutical compositions of the present invention (especially those substantially lacking at least serine) will have an enhanced effect when used in combination with compounds that increase ROS levels. Cancer cells utilize large amounts of exogenous serine to support rapid proliferation in response to elevated ROS levels. Without being bound by theory, it is believed that when exogenous serine is depleted, cancer cells are forced to transport glycolytic intermediates through the serine synthesis pathway, and metabolic remodeling can lead to reduced proliferation and cell survival.
[0245] KRAS The inventors have surprisingly identified that the level of Kras expression or activity in cancerous cells / tissues indicates the likelihood of a patient's responsiveness or sensitivity to cancer treatments that include a diet substantially lacking serine (and / or glycine). The level of Kras expression or activity can be used to identify cancer cells, such as tumors, in subjects that will respond to cancer treatments that include a diet substantially lacking serine. The biomarker can also be used to identify subjects with an increased or decreased likelihood of responsiveness or sensitivity to cancer treatments that include a diet substantially lacking serine. The biomarker can also be used to aid in the selection of treatments for a patient's cancer. In this regard, the present invention provides biomarkers and their uses, including methods and kits incorporating the use of the biomarkers.
[0246] In one aspect, the present invention provides the use of KRAS as a biomarker to identify patient populations that respond to or are sensitive to cancer treatments including a diet substantially lacking serine. The term "biomarker" or "marker" refers to an organic biomolecule that differs in a phenotypic state when compared to another phenotypic state in a sample taken from a subject. A biomarker is considered to differ between different phenotypic states if the difference in the mean or median expression level of a biomarker between different groups is calculated to be statistically significant. Biomarkers, alone or in combination, provide a measure of the relative risk of a subject belonging to one or another phenotypic state. For the purposes of this invention, a biomarker is a marker used to predict the likelihood of responsiveness or sensitivity to cancer treatments including a diet substantially lacking serine. In some embodiments, the biomarker is a gene (e.g., a nucleic acid) disclosed herein. In some other embodiments, the biomarker is a product of a gene (e.g., a protein).
[0247] As used herein, the term "KRAS" refers to the human cell homolog of the transformed gene isolated from Kirsten rat sarcoma virus. The KRAS gene belongs to a class of genes called oncogenes. When mutated, oncogenes have the potential to transform normal cells into cancerous cells. The KRAS gene belongs to the Ras oncogene family, which also includes two other genes: HRAS and NRAS. The proteins produced from these three genes are GTPases. These proteins play important roles in cell division, cell differentiation, and cell self-destruction (apoptosis).
[0248] KRAS belongs to the RAS protein family, has a molecular weight of approximately 21 kDa, and exhibits GTP hydrolytic activity. KRAS is located inside the cell membrane and plays a role in transducing signals into the cell in response to the binding of extracellular growth factors (such as epidermal growth factor (EGF)) to receptors.
[0249] Activating mutations can be found in KRAS and in approximately 20% of human cancers.
[0250] As used in this article, the term "KRAS" is used to refer to both polypeptides and nucleic acid molecules.
[0251] Preferably, KRAS is a human KRAS polypeptide or nucleic acid molecule.
[0252] As used herein, the term "nucleic acid molecule" includes DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA), as well as, for example, DNA or RNA analogs generated using nucleotide analogs. Nucleic acid molecules can be single-stranded or double-stranded, but are preferably double-stranded DNA.
[0253] The nucleic acid sequence information of human KRAS can be found under Ensembl accession number ENSG00000133703. In one specific embodiment, the KRAS gene of the present invention comprises KRAS nucleic acid (e.g., Ensembl accession number ENSG0000133703) or a continuous fragment thereof, or a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to the nucleic acid sequence of Ensembl accession number ENSG0000133703 or a continuous fragment thereof.
[0254] As used herein, the term "wild-type" KRAS refers to a KRAS nucleic acid or peptide that does not contain mutations, such as a KRAS peptide or nucleic acid without mutations, compared to the KRAS nucleic acid or peptide found under Ensembl accession number ENSG0000133703. In addition to the human KRAS sequences provided herein, the nucleic acid sequences of KRAS from mammalian or non-mammal species can be identified by those skilled in the art using methods known in the art, such as by nucleic acid sequencing or hybridization assays, or by comparison manually or using computer programs, such as those procedures mentioned below in conjunction with the definition of the term "hybridization" and the degree of homology.
[0255] Hybridization assays for characterizing orthologs of known nucleic acid sequences / promoters are well known in the art; see, for example, Sambrook, Russell, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, NY (2001); Ausubel, "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley Interscience, NY (1989). As used herein, the terms "hybridization" or "hybridizes" can refer to hybridization under stringent or non-stringent conditions. Unless otherwise specified, the conditions are preferably non-stringent. The hybridization conditions can be established according to conventional protocols described, for example, in Sambrook (2001) loc. cit.; Ausubel (1989) loc. cit., or Higgins and Hames (Eds.) "Nucleic acid hybridization, a practical approach" IRL Press Oxford, Washington DC, (1985). The setting of the conditions is entirely within the skill of a person skilled in the art and can be determined according to protocols described in the art. Therefore, the detection of sequences that are specifically hybridized will typically require stringent hybridization and washing conditions, such as highly stringent hybridization conditions, for example, at 65°C with 0.1×SSC and 0.1% SDS, or 2×SSC at 60°C with 0.1% SDS. Less stringent hybridization conditions for detecting homologous or incompletely complementary sequences can be set, for example, at 65°C with 6×SSC and 1% SDS. It is well known that probe length and the composition of the nucleic acid to be determined constitute additional parameters of the hybridization conditions.
[0256] As used herein, the terms “homology” and “identity” are used interchangeably. The calculation of sequence homology or identity between sequences is performed as follows.
[0257] To determine the percentage of identity between two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., vacancies may be introduced into one or both of the first and second amino acid or nucleic acid sequences for optimal alignment, and non-homologous sequences may be ignored for comparison purposes). In a preferred embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence. The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position (as used herein, amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap.
[0258] Sequence comparison and determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms. In a preferred embodiment, the percentage of identity between two amino acid sequences is determined as follows: using Needleman et al. (1970), whose GAP program was incorporated into the GCG software package (available at http: / / www.gcg.com). J. Mol. Biol. The algorithm (48:444-453) uses a BLOSUM 62 matrix or a PAM250 matrix with vacancy weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percentage of identity between two nucleotide sequences is determined as follows: using the GAP procedure in the GCG software package (available at http: / / www.gcg.com), using the NWSgapdna.CMP matrix with vacancy weights of 40, 50, 60, 70, or 80 and length weights of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the set of parameters to be used if the practitioner is unsure which parameters should be applied to determine whether a molecule is within the sequence identity or homology limits of the present invention) is a BLOSUM 62 scoring matrix with a vacancy penalty of 12, a vacancy extension penalty of 4, and a frameshift vacancy penalty of 5.
[0259] Alternatively, the percentage of identity between two amino acid sequences or nucleotide sequences can be determined as follows: using the methods described by Meyers et al. (1989), which have been incorporated into the ALIGN program (version 2.0). CABIOS The algorithm (4: 11-17) uses a PAM120 weighted residual table, a vacancy length penalty of 12, and a vacancy penalty of 4.
[0260] As used herein, the term "continuous fragment" refers to an uninterrupted sequence of nucleic acids or amino acids that also appears in the same order in the mentioned sequence. Specifically envisioned are continuous fragments having at least 25%, 50%, 70%, 75%, 80%, or 90% of the reference sequence length, and continuous fragments typically having at least 25 nucleic acids or at least 8 amino acids.
[0261] In one embodiment, the nucleic acid fragment includes or consists of a sequence corresponding to a domain, region, or functional site of KRAS. Alternatively, the nucleic acid fragment of KRAS encodes an epitope-carrying region of the KRAS polypeptide.
[0262] In another embodiment, KRAS may be selected from, but is not limited to, the group consisting of: human KRAS (NP_004976.2, NP_203524.1, etc.), mouse KRAS (NP_067259.4, etc.), zebrafish KRAS (NP_001003744.1, etc.), frog KRAS (NP_001095209.1), bovine KRAS (NP_001 103471.1), chicken KRAS (NP_001243091.1), monkey KRAS (NP_001248441.1), NP_001028153.1, NP_113703.1, and NP_001008034.1, or variants or mutants thereof. Peptide sequence information for human KRAS can be found under Ensembl accession number ENSG00000133703. In one specific embodiment, the KRAS polypeptide of the present invention comprises KRAS (e.g., Ensembl accession number ENSG0000133703) or a continuous fragment thereof, or a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to the polypeptide sequence of Ensembl accession number ENSG0000133703 or a continuous fragment thereof.
[0263] KRAS peptides can be allelic variants of the KRAS peptide sequence with Ensembl accession number ENSG0000133703. KRAS peptides can be epitope-carrying regions of the KRAS peptide sequence with Ensembl accession number ENSG0000133703. KRAS peptides can be fragments of the KRAS peptide sequence with Ensembl accession number ENSG0000133703, such as biologically active fragments.
[0264] As used herein, a “bioactive fragment” of a KRAS peptide comprises a peptide containing an amino acid sequence sufficiently homologous to or derived from the amino acid sequence of a KRAS peptide, such as the one with Ensembl accession number ENSG0000133703, containing fewer amino acids than the full-length KRAS peptide, and exhibiting at least one activity of the KRAS peptide. For example, a bioactive fragment of a KRAS peptide may be a peptide comprising 10, 25, 50, 100, 200, or more consecutive amino acids of the KRAS peptide sequence of Ensembl accession number ENSG0000133703.
[0265] In the context of determining KRAS activity, the term "activity" as used herein includes, for example, determining enzyme activity at the protein level and / or determining expression levels (e.g., mRNA or protein). Methods for determining activity as defined herein are well known in the art and are also described below.
[0266] In one embodiment, KRAS is a mutant KRAS, such as an activated KRAS mutant. As used herein, the term "activated mutation" refers to a mutation in a gene, particularly in the KRAS gene, that results in increased activity of the corresponding gene product, i.e., the protein, particularly the KRAS protein, compared to the wild type. Methods for measuring the (increased) activity of proteins, particularly the KRAS protein, are known in the art and are also described below. Mutations in the KRAS gene can be detected by methods known in the art. Such methods are described, for example, in (Papadopoulos et al., 2006; Shendure et al., 2004).
[0267] The present invention provides a method for identifying subjects who have a reduced likelihood of response or sensitivity to cancer treatments, including diets that are substantially serine-deficient, the method comprising: a) Determine the level of Kras expression or activity in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in the biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein the increased level of Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level indicates non-responsiveness or insensitivity to the cancer treatment.
[0268] The present invention also provides a method for identifying subjects who have an increased likelihood of responding to or being sensitive to cancer treatments, including diets that are substantially serine-deficient, the method comprising: a) Determine the level of Kras expression or activity in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in a biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein the level of reduction in Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level, or the level of Kras expression or activity substantially the same as that in the control sample or the predetermined reference level, indicates responsiveness or sensitivity to said cancer treatment.
[0269] The present invention also provides a method for identifying subjects who may benefit from cancer treatment comprising a diet substantially lacking serine, the method comprising: a) Determine the level of Kras expression or activity in biological samples isolated from subjects; b) Compare the expression or activity level of Kras in the biological sample to a control sample or a predetermined reference level of Kras expression or activity, wherein a decrease in Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level, or a Kras expression or activity level substantially the same as the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment.
[0270] MTAP The inventors have surprisingly identified that the expression or activity level of methionine phosphorylase (MTAP) in cancerous cells / tissues indicates the likelihood of a patient's responsiveness or sensitivity to cancer treatments comprising a diet substantially lacking i) cysteine and / or ii) serine. The level of MTAP expression or activity can be used to identify cancer cells, such as tumors, in subjects that will respond to cancer treatments comprising a diet substantially lacking cysteine and / or serine. Biomarkers can also be used to aid in the selection of treatments for a patient's cancer. In this regard, the present invention provides biomarkers and their uses, including methods and kits incorporating the use of the biomarkers.
[0271] In another aspect, the present invention provides the use of MTAP as a biomarker to identify patient populations that respond to or are sensitive to cancer treatments, said cancer treatments comprising a diet substantially deficient in cysteine and / or serine.
[0272] The present invention also provides a method for identifying subjects who may benefit from cancer treatment comprising a diet substantially lacking in homocysteine, the method comprising: a) Determine the expression or activity level of MTAP in biological samples isolated from subjects; b) Compare the expression or activity level of MTAP in the biological sample to a control sample or a predetermined reference level of MTAP expression or activity, wherein a decrease in MTAP expression or activity in the biological sample compared to the control sample or the predetermined reference level, or a substantially similar level of MTAP expression or activity compared to the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment.
[0273] As used herein, the term "MTAP" refers to S-methyl-5'-thioadenosine phosphorylase, which catalyzes the reversible phosphorylation of S-methyl-5'-thioadenosine (MTA) to adenine and 5-methylthioribo-1-phosphate. This enzyme plays a crucial role in polyamine metabolism and is essential for the reabsorption of both adenosine and methionine. MTAP deficiency is well-known in many cancers, often resulting from the co-deletion of the MTAP gene and the tumor suppressor gene p16.
[0274] As used in this article, the term "MTAP" refers to both peptides and nucleic acid molecules.
[0275] Preferably, MTAP is a human MTAP polypeptide or nucleic acid molecule.
[0276] The nucleic acid sequence information of the human MTAP gene can be found under EnsembI accession number ENSG00000099810. In one specific embodiment, the MTAP gene of the present invention comprises MTAP nucleic acid (e.g., EnsembI accession number ENSG00000099810) or a continuous fragment thereof, or a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to the nucleic acid sequence of EnsembI accession number ENSG00000099810 or a continuous fragment thereof.
[0277] In addition to the human MTAP sequence provided herein, the nucleic acid sequences of MTAPs from mammalian or non-mammal species can be identified by those skilled in the art using methods known in the art, such as by nucleic acid sequencing or by using hybridization assays, or by comparing manually or by using computer programs, such as those mentioned below in conjunction with the definition of the term “hybridization” and the degree of homology.
[0278] In one embodiment, the nucleic acid fragment includes or consists of a sequence corresponding to a domain, region, or functional site of the MTAP. Alternatively, the nucleic acid fragment of the MTAP encodes an epitope-carrying region of the MTAP polypeptide.
[0279] In an alternative implementation, MTAP may be a nucleotide sequence encoding a human MTAP polypeptide or a variant or mutation thereof.
[0280] The polypeptide sequence information for human MTAP can be found under UniProtKB-Q13126. In one specific embodiment, the MTAP polypeptide of the present invention comprises human MTAP or a continuous fragment thereof, or a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to the polypeptide sequence or a continuous fragment thereof of UniProtKB-Q13126 (e.g., Q13126-1).
[0281] The MTAP peptide can be an allelic variant of the MTAP peptide sequence of UniProtKB-Q13126. The MTAP peptide can be an epitope-carrying region of the MTAP peptide sequence of UniProtKB-Q13126. The MTAP peptide can be a fragment of the MTAP peptide sequence of UniProtKB-Q13126, such as a bioactive fragment.
[0282] As used herein, a “bioactive fragment” of an MTAP peptide comprises a peptide containing an amino acid sequence sufficiently homologous to or derived from the amino acid sequence of an MTAP peptide such as UniProtKB-Q131263, containing fewer amino acids than the full-length MTAP peptide, and exhibiting at least one activity of the MTAP peptide. For example, a bioactive fragment of an MTAP peptide may be a peptide comprising 10, 25, 50, 100, 200, or more consecutive amino acids of an MTAP peptide containing or composed of the MTAP peptide sequence of UniProtKB accession number Q13126 (e.g., Q13126-1).
[0283] In the context of determining MTAP activity, the term "activity" as used herein includes, for example, determining enzyme activity at the protein level and / or determining expression levels (e.g., mRNA or protein). Methods for determining activity as defined herein are well known in the art and are also described below.
[0284] As used herein, a subject is “responsive” or “sensitive” to cancer treatment consisting of a diet substantially lacking serine if the treatment, after or following the treatment, slows cancer or tumor growth, stops cancer or tumor growth, or reduces one or more symptoms of cancer or tumor, such as tumor burden. Therefore, in a preferred embodiment, a subject is responsive if the treatment reduces tumor burden during or after treatment. In some embodiments, a subject is responsive to treatment if the tumor or cancer enters remission or eradication.
[0285] As used in this article, a subject is “unresponsive” or “insensitive” to cancer treatments that consist of a diet substantially lacking serine if the treatment, when administered after or immediately following treatment, does not slow cancer or tumor growth, does not stop cancer or tumor growth, or does not reduce one or more symptoms of cancer or tumor, such as tumor burden.
[0286] Therefore, in a preferred embodiment, the subject is non-responsive if the tumor burden increases during or after treatment. In some embodiments, the subject is non-responsive to treatment if the tumor or cancer expands, spreads, or metastasizes during or after treatment, or if one or more symptoms of the cancer worsen.
[0287] The methods disclosed in this invention typically involve detecting the expression levels of KRAS or MTAP in biological samples obtained from a subject. As used herein, the terms "biological sample" and "sample isolated from a subject" are used interchangeably to refer to tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject.
[0288] In a preferred embodiment, the subject is a patient with cancer, and more preferably, the sample is a sample of cancer cells or cancer tissue. The biological sample may include a single cancer cell, or preferably multiple cancer cells.
[0289] In some embodiments, the biological sample includes cancer cells obtained from a tumor. In some embodiments, the biological sample includes cancer cells that are not obtained from a tumor. For example, in some embodiments, the cancer cells are circulating cancer cells. The biological sample may include other components or cells that are not cancer cells. For example, the sample may include non-cancerous cells, tissues, etc. In a preferred embodiment, the biological sample includes cancer cells isolated or separated from normal tissue. In some embodiments, the biological sample is obtained from cancerous tissue or organs.
[0290] Biological samples can be obtained from subjects using various methods known in the art. In some embodiments, the sample is a tissue biopsy, such as a punch biopsy. The sample should be processed according to the assay method to be used. In some embodiments, biological samples of tissue or cell origin can be dissolved in a dissolution buffer, which optionally contains one or more of a dissolving agent, detergent, reducing agent, buffer, and salt. The processing conditions for biological samples for mRNA level analysis may differ from those for biological samples for protein level analysis, and these conditions are known in the art. If the sample is a blood sample containing clotting factors (e.g., whole blood), the formulation may include an anticoagulant.
[0291] Samples can be concentrated or diluted with a suitable diluent before analysis. Samples can be frozen, fresh, fixed (e.g., formalin fixed), centrifuged, and / or embedded (e.g., paraffin embedded), etc. Various well-known post-collection preparation and storage techniques (e.g., nucleic acid and / or protein extraction, fixation, storage, freezing, ultrafiltration, concentration, evaporation, centrifugation, etc.) can be used on cell samples before assessing the amount of markers in the samples. Similarly, biopsies can also be prepared and stored using post-collection techniques such as fixation.
[0292] The types of cancer that can be analyzed and treated using the methods of this invention include, but are not limited to, the following: colorectal cancer, liver cancer, osteosarcoma, lymphoma, and breast cancer.
[0293] In the context of this invention, KRAS / MTAP expression refers to the gene or protein expression level of the KRAS / MTAP gene or protein as measured by any suitable method.
[0294] Typically, the expression level of a specific gene can be reflected at the transcriptional level by measuring the level of mRNA transcribed from the KRAS / MTAP gene in cells or tissues, or at the translational level by measuring the protein level in cells or tissues. Methods can be cell-based or cell-free assays.
[0295] A method for detecting the expression level of KRAS or MTAP in a sample is provided according to the present invention. The expression level of KRAS or MTAP can be determined by measuring the mRNA or protein level of KRAS or MTAP in the sample. Methods for measuring mRNA in a sample include, for example, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), reverse transcription real-time PCR (RT-qPCR), transcriptome analysis using next-generation sequencing, array hybridization analysis, digital PCR, RNA analysis, dot blot, in situ hybridization, and RNase protection assay.
[0296] Quantitative real-time PCR is particularly suitable for determining the level of specific mRNAs in cell or tissue samples. In this case, the mRNA is first reverse transcribed into cDNA, and then amplified by PCR using gene-specific oligonucleotide PCR primers. This qRT-PCR method is well known in the art. Next-generation sequencing or microarrays can also be used to detect mRNA levels. Furthermore, in situ hybridization can also be used for in situ detection of KRAS mRNA levels in cell or tissue samples, such as FFPE tissue samples.
[0297] In some embodiments, PCR (e.g., qPCR, RT-PCR, RT-qPCR, etc.) can be used to determine the expression of KRAS and / or MTAP. Such PCR assays are well known in the art. For example, in some embodiments, a method for detecting mRNA from KRAS / MTAP in a biological sample includes generating cDNA from the sample by reverse transcription using at least one primer; amplifying the thus generated cDNA; and detecting the presence of the amplified cDNA. Furthermore, such methods may include one or more steps that allow one to determine the level of mRNA in the biological sample (e.g., by simultaneously examining the level of a comparative control mRNA sequence of a "housekeeping" gene such as a member of the actin family). Optionally, the sequence of the amplified cDNA can be determined. RNA blot analysis is a routine technique well known in the art and is described, for example, in Sambrook et al., Molecular Cloning, a Laboratory Manual, third edition, Cold Spring Harbor Press, NY (2000) 11803-2500.
[0298] In some implementations, the KRAS / MTAP gene can be detected using, for example, probes or primers. As used herein, the term "probe" refers to an oligonucleotide, polynucleotide, or nucleic acid, RNA or DNA, whether naturally occurring in purified restriction endonuclease digests or synthetically produced, capable of annealing or specifically hybridizing with a nucleic acid having a sequence complementary to the probe. Probes can be single-stranded or double-stranded. The precise length of a probe will depend on many factors, including temperature, probe source, and the method used. For example, for diagnostic applications, oligonucleotide probes typically contain 15–25 or more nucleotides, depending on the complexity of the target sequence, although they can contain fewer nucleotides.
[0299] In some implementations, the biological sample contains a small number of cells, or even a single cell. Methods for amplifying cDNA and analyzing mRNA expression levels in small numbers of cells (e.g., 1000 to 1000 cells) and single cells are well known in the art. Such methods may include, for example, semi-random priming PCR and phi29-based cDNA amplification steps.
[0300] These and other suitable methods for binding (specific) mRNA are well known in the art and are described, for example, in Sambrook and Russell (2001, loc. cit.). Those skilled in the art can determine the amount of a component, particularly the amount of the gene product, by utilizing the correlation, preferably a linear correlation, between the intensity of the detection signal and the amount of the gene product to be determined.
[0301] To detect KRAS / MTAP protein expression in cell or tissue samples, any known method for measuring protein levels in cell or tissue samples can be used in this invention.
[0302] Methods for measuring the expression of KRAS / MTAP proteins in a sample include, for example, immunoassays, ligand binding assays, mass spectrometry, or high-performance liquid chromatography (HPLC). Some methods include immunoassays in which antibodies that specifically react with KRAS / MTAP proteins are contacted with a cell or tissue sample under conditions that allow for an immune reaction with KRAS / MTAP proteins in the sample, and the amount of bound antibody is measured. Exemplary immunoassays include, but are not limited to, radioimmunoassays, ELISA, immunoprecipitation assays, proteoblotting, fluorescence immunoassays and immunohistochemistry, flow cytometry, protein arrays, multiplex bead arrays, magnetic trapping, in vivo imaging, fluorescence resonance energy transfer (FRET), and fluorescence recovery / localization after photobleaching (FRAP / FLAP). In other preferred embodiments, the presence or absence of KRAS in the cell or tissue sample is determined by IHC.
[0303] It should be understood that some immunoassays, such as ELISA, may require two different biomarker-specific antibodies or ligands (e.g., a capture ligand or antibody, and a detection ligand or antibody). In some embodiments, the KRAS is captured by a ligand or antibody on its surface, and the protein biomarker is labeled with an enzyme. In one example, a detection antibody conjugated to biotin or streptavidin establishes a biotin-streptavidin link with an enzyme containing biotin or streptavidin. A signal is generated by converting the enzyme substrate into a colored molecule, and the color intensity of the solution is quantified by measuring the absorbance with a light sensor. The envisioned assay could utilize a chromogenic reporter and a substrate that produces an observable color change to indicate the presence of a protein biomarker. It is also envisioned to use fluorescent, electrochemiluminescent, and real-time PCR reporter substances to generate quantifiable signals.
[0304] Some assays optionally involve immobilizing one or more antibodies on a solid support to facilitate washing and subsequent separation of the complex before the antibody comes into contact with the sample. Examples of solid supports include glass or plastic in the form of, for example, microtiter plates, rods, beads, or microbeads. Antibodies may also be attached to probes, substrates, or ProteinChip® arrays.
[0305] Flow cytometry is a laser-based technique that can be used to count, sort, and detect protein biomarkers by suspending particles in a fluid stream and passing them through an electronic detection device. Flow cytometers have the ability to distinguish different particles based on color. Different staining of particles with different dyes that emit light at two or more different wavelengths allows the particles to be differentiated. Multiplex analysis, such as FLOWMETRIX™, is discussed in Fulton et al., Clinical Chemistry, 43(9): 1749-1756 (1997), which allows for multiple separation analyses to be performed simultaneously with the same sample in a single tube.
[0306] In another preferred embodiment, the expression of KRAS and / or MTAP of the present invention is detected by mass spectrometry. Multidimensional HPLC (high-performance liquid chromatography) can be coupled with mass spectrometry to separate KRAS.
[0307] Furthermore, the presence, absence, or expression level of KRAS and / or MTAP genes or peptides in a patient's cancer can be detected in vivo or in vitro. In some embodiments, expression is detected in vitro in a biological sample containing genetic material isolated from the patient. In other embodiments, the expression of the biomarker gene can be performed in vivo, for example using techniques such as "QuantumDot" labeling or CT scans.
[0308] KRAS activity can be determined not only by measuring expression levels, but also, for example, by measuring the GTPase activity of KRAS or by measuring the activation of downstream signaling pathway members, such as, in the case of KRAS, by determining the levels of phosphate-Akt or phosphate-Erk. The means and methods for determining the activity of said proteins are well known in the art and can be derived, for example, from Lottspeich (Spektrum Akademischer Verlag, 1998). KRAS activation assay kits for detecting cellular Ras-GTP are well known in the art, such as Jena Bioscience's Ras Activation Kit and Cell Biolabs, Inc.'s K-Ras Activation Assay Kit.
[0309] MTAP activity can be determined not only by measuring expression levels, but also by, for example, measuring cellular outflow of methylthioadenosine (MTA).
[0310] Suitablely, according to the invention, MTA can be used as a biomarker. In one embodiment, the methods and uses associated with MTAP can be replaced by MTA, in which the correlation between MTA and the “responsiveness” or “sensitivity” to treatment using i) a diet substantially lacking serine and / or ii) a diet limited to cysteine is inverse. Enhanced efflux of MTA indicates responsiveness or sensitivity to such treatment.
[0311] As used herein, the term “activity” refers to the activity of a protein (e.g., KRAS), while the term “expression level” refers to expression at the protein level (e.g., determined by protein imprinting) or the transcriptional level (e.g., spliced, unspliced, or partially spliced mRNA, which can be determined by RNA imprinting, real-time PCR, etc.).
[0312] As used herein, the term "increase" can refer to an increase of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more in the level of a biomarker (e.g., expression or activity) detected by the methods described herein compared to the same biomarker level from a control or reference level. In some embodiments, the term "increase" refers to an increase in the level of a biomarker, wherein the increase is 0.1, 0.5, 1, 2, 3, 4, 5, or more compared to the biomarker level in a control or reference level.
[0313] As used herein, the term "reduction" can refer to a reduction of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more in the level of a biomarker (e.g., expression or activity) detected by the methods described herein compared to the same biomarker level from a control or reference level. In some embodiments, the term "reduction" refers to a reduction in the level of a biomarker, wherein the reduction is 0.1, 0.5, 1, 2, 3, 4, 5, or less compared to the biomarker level in a control or reference level.
[0314] As used herein, the phrase "substantially similar" means that there is a sufficiently high degree of similarity between two values (e.g., one relating to KRAS expression or activity in a test biological sample and the other relating to KRAS expression or activity in a control sample) such that a person skilled in the art would consider the difference between the two values to be small or not biologically and / or statistically significant within the context of the biological characteristic measured by said values. As a function of reference / comparison values, the difference between said two values is, for example, less than about 50%, less than about 40%, less than about 30%, less than about 20%, and / or less than about 10%.
[0315] The methods disclosed herein involve comparing the levels of biomarkers (e.g., KRAS and / or MTAP) detected in samples isolated from subjects with control or predetermined reference levels.
[0316] As used herein, "control" refers to a sample with normal levels of biomarker expression, such as a sample from a healthy subject who does not have or is not suspected of having cancer, or, in the case of KRAS, a sample that does not have or is not suspected of having a KRAS mutation. Preferably, the control sample is a normal (e.g., disease-free) cell or tissue sample. Preferably, when the biomarker to be measured is KRAS, the control sample is positive for wild-type KRAS. The control sample may be of the same tissue or cell type as the sample isolated from the subject.
[0317] As used herein, the term "reference level" refers to the same biomarker level (i.e., KRAS level) as detected in a control sample using the methods described herein. Alternatively, the reference level may include the expression level of a biomarker (e.g., KRAS) from a reference database, which may be used to generate a predetermined cutoff value—a diagnostic score that statistically predicts the symptoms or disease or its absence—or a predetermined reference level based on a standard population sample, or optionally, a predetermined reference level based on the subject's baseline expression level (i.e., prior to organ transplantation). Preferably, the biological samples isolated from the subject are analyzed using the same testing platform (e.g., mRNA analysis via RT-PCT, protein analysis via immunoassay, etc.) to obtain the reference value.
[0318] Optionally, predictions can be based on the normalized expression levels of biomarkers (e.g., KRAS). Expression levels are normalized by comparing the expression of biomarkers (e.g., KRAS) in a sample with the expression of a non-marker reference nucleic acid (e.g., mRNA, such as constitutively expressed mRNA).
[0319] This standardization allows for comparison of expression levels between one sample and another, or between samples from different sources. This standardized expression can then optionally be compared to a reference level or control.
[0320] In one aspect, the present invention provides a method for treating a subject suffering from cancer, the method comprising: a) Determine whether the level of Kras expression or activity in biological samples isolated from subjects indicates responsiveness or sensitivity to cancer treatments consisting of a diet substantially lacking serine; and b) Administering cancer treatment to a subject, wherein the expression or activity level of Kras in a biological sample indicates responsiveness or sensitivity to the cancer treatment.
[0321] In some implementations, a diet substantially deficient in serine includes or consists of dietary products. As used herein, the term "dietary product" refers to a composition containing one or more essential amino acids or their salts or esters, used in, or consumed with food products to provide a subject consuming a supplement with the required levels of amino acids or their salts or esters. Dietary components in these products may include: vitamins, minerals, herbs or other plant materials, amino acids, and substances such as enzymes, organ tissues, glands, and metabolites.
[0322] Dietary products may be provided in the form of powders, gels, solutions, suspensions, pastes, solids, liquids, liquid concentrates, reconfigurable powders, shake flasks, concentrates, pills, strips, tablets, capsules, or ready-to-use products. Conversely, dietary products may also be pharmaceutical compositions when the supplement is in the form of tablets, pills, capsules, liquids, aerosols, injectable solutions, or other pharmaceutically acceptable formulations.
[0323] As used herein, “substantially deficient” means completely or almost entirely lacking in serine. In various implementations, diets or dietary products are substantially deficient in serine.
[0324] In one implementation, the cancer treatment comprises a diet that is substantially deficient in serine and glycine.
[0325] In some embodiments, the cancer treatment includes administering a diet substantially lacking serine to the cancer patient during chemotherapy or radiotherapy regimens. Preferably, the cancer treatment further comprises administering a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0326] As used in this article, cancer cell growth inhibitors, radiotherapy agents and chemotherapy agents and / or radiation therapy.
[0327] This type of chemotherapy may include one or more of the following classes of anticancer agents: (i) Antiproliferative / antitumor drugs and combinations thereof, such as alkylating agents (e.g., cisplatin, oxaliplatin, carboplatin, cyclophosphamide, nitrogen mustard, uracil mustard, bendamustine, melphalan, chlorambucil, nitrogen mustard hydrochloride, busulfan, temozolomide, nitrosourea, ifosfamide, melphalan, piperobromane, triethylene melamine, triethylenethiophoporamine, carmustine, lomustine, strepzotocin, and dacarbazine); antimetabolites (e.g., gemcitabine and folic acid antagonists such as...). Fluoropyrimidines such as 5-fluorouracil and tegafur, raltitrexed, methotrexate, pemetrexed, cytosine arabinoside, fluorouracil, vidarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatin, gemcitabine, and hydroxyurea; antibiotics (e.g., anthracyclines such as doxorubicin, bleomycin, doxorubicin, daunorubicin, epirubicin, idarubicin, mitomycin-C, styromycin, and sclerotinib); antimitotic agents (e.g., vinblastine alkaloids such as vincristine, vinblastine, vinorelbine, and vinorelbine, and... Taxanes such as paclitaxel and doxorubicin, and polo kinase inhibitors; proteasome inhibitors such as carfilzomib and bortezomib; interferon therapy; and topoisomerase inhibitors (e.g., epipodophyllotoxins such as etoposide and teniposide, acridine, topotecan, irinotecan, mitoxantrone, and camptothecin); bleomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, ara-C, paclitaxel (Taxol™), albumin-bound paclitaxel, docetaxel, photomycin, deoxymyopicrin, mitoxantrone ... Mitomycin-C, L-asparaginase, interferon (especially IFN-α), etoposide, teniposide, DNA demethylating agents (e.g., azacitidine or decitabine); and histone deacetylase (HDAC) inhibitors (e.g., vorinostat, MS-275, panobinostat, romidepsin, valproic acid, moxetine (MGCD0103), and prasinostat SB939). (ii) Cell growth inhibitors such as anti-estrogens (e.g., tamoxifen, fulvestrant, toremifene, raloxifene, droloxifene, and iodoxyfene), anti-androgens (e.g., bicalutamide, flutamide, nilumet, and cyproterone acetate), LHRH antagonists or LHRH agonists (e.g., goserelin, leuprorelin, and buserelin), progestins (e.g., megestrol acetate), aromatase inhibitors (e.g., anastrozole, letrozole, vorazole, and exemestane), and 5* reductase inhibitors such as finasteride; and avelbene, CPT-II, anastrozole, letrozole, capecitabine, reloxafme, cyclophosphamide, ifosfamide, and droloxifene; (iii) Anti-invasive agents such as dasatinib and bosutinib (SKI-606), as well as inhibitors of metalloproteinases, inhibitors of urokinase plasminogen activator receptor function, or antibodies against heparanase. (iv) Inhibitors of growth factor function: For example, such inhibitors include growth factor antibodies and growth factor receptor antibodies such as anti-erbB2 antibody trastuzumab [Herceptin™], anti-EGFR antibody panitumumab, anti-erbB1 antibody cetuximab, and tyrosine kinase inhibitors such as inhibitors of the epidermal growth factor family (e.g., EGFR family tyrosine kinase inhibitors such as gefitinib, erlotinib, and 6-acrylamido-N-(3-chloro-4-fluorophenyl)-7-(3-morpholinopropoxy)-quinazoline-4-amine (CI). 1033), afatinib, van der Tani, osimertinib, and rochiglitinib; erbB2 tyrosine kinase inhibitors such as lapatinib; and antibodies against co-stimulatory molecules such as CTLA-4, 4-lBB, and PD-1, or cytokine antibodies (IL-10, TGF-β); inhibitors of the hepatocyte growth factor family; inhibitors of the insulin-like growth factor family; regulators of apoptosis protein regulators (e.g., Bcl-2 inhibitors); inhibitors of the platelet-derived growth factor family, such as imatinib and / or nilotinib (AMN107); inhibitors of serine / threonine kinases (e.g., Ras / Raf signaling inhibitors such as farnesyltransferase). Inhibitors (such as sorafenib, tipirafenib, and lonafanib), inhibitors of cell signaling via MEK and / or AKT kinases, c-kit inhibitors, abl kinase inhibitors, PI3 kinase inhibitors, Plt3 kinase inhibitors, CSF-1R kinase inhibitors, IGF receptor kinase inhibitors; aurora kinase inhibitors and cyclin-dependent kinase inhibitors such as CDK2 inhibitors and / or CDK4 inhibitors; CCR2, CCR4, or CCR6 antagonists; and RAF kinase inhibitors, such as those described in WO2006043090, WO2009077766, WO2011092469, or WO2015075483.
[0328] (v) Anti-angiogenic agents, such as those that inhibit the effects of vascular endothelial growth factor, [e.g., anti-vascular endothelial growth factor antibody bevacizumab (Avastin™); thalidomide; lenalidomide; and VEGF receptor tyrosine kinase inhibitors such as vandetanib, vastarani, sunitinib, axitinib, and pazopanib; (vi) Gene therapy methods, including, for example, methods of replacing aberrant genes such as aberrant p53 or aberrant BRCA1 or BRCA2; (vii) Immunotherapy approaches, including, for example, antibody therapies such as alemtuzumab, rituximab, teimomab (Zevalin®), and oframumab; interferons such as interferon-alpha; interleukins such as IL-2 (aldeleukin); interleukin inhibitors such as IRAK4 inhibitors; cancer vaccines, including prophylactic and therapeutic vaccines, such as HPV vaccines such as Gardex, Cervarix, Oncophage, and Sipuleucel-T (Provenge); gp100; dendritic cell-based vaccines (such as Ad.p53). DC); Toll-like receptor modulators such as TLR-7 or TLR-9 antagonists; PD-1, PD-L1, PD-L2 and CTL4-A modulators (e.g., nifroma), antibodies and vaccines; other IDO inhibitors (such as indomethacin); anti-PD-1 monoclonal antibodies (such as MK-3475 and nifroma); anti-PDL1 monoclonal antibodies (such as MEDI-4736 and RG-7446); anti-PDL2 monoclonal antibodies; and anti-CTLA-4 antibodies (such as ipilimumab); and (viii) Cytotoxic agents such as fludaribine (fludara), cladribine, and pentostatin (Nipent™); (ix) Targeted therapies, such as PI3K inhibitors, like idelalisib and perifosine; SMAC (second mitochondrial-driven activator of caspase) mimics, also known as inhibitors of apoptosis proteins (IAP) antagonists. These agents inhibit IAPs such as XIAP, clAP1, and clAP2, thereby reconstructing the apoptotic pathway. Specific SMAC mimics include Birinapant (TL32711, TetraLogic Pharmaceuticals), LCL161 (Novartis), AEG40730 (Aegera Therapeutics), SM-164 (University of Michigan), LBW242 (Novartis), ML101 (Sanford-Burnham Medical Research Institute), AT-406 (Ascenta Therapeutics / University of Michigan), GDC-0917 (Genentech), AEG35156 (Aegera Therapeutic), and HGS1029 (Human Genome Sciences); and agents targeting the ubiquitin-proteasome system (UPS), such as bortezomib, carfizzomib, marizomib (NPI-0052), and MLN9708; and (xii) Chimeric antigen receptors, anticancer vaccines, and arginase inhibitors.
[0329] The therapeutic agent used in the method of the present invention can be a single agent or a combination of agents. Preferred combinations will include agents with different mechanisms of action.
[0330] As used herein, the term "administered in combination with" and the grammatical equivalents are equally intended to cover the administration of selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered via the same or different routes of administration or at the same or different times. In some embodiments, the compounds described herein will be administered in combination with other agents. These terms cover the administration of two or more agents to an animal such that both the agent and / or its metabolites are present in the animal. This includes simultaneous administration in separate compositions, administration in separate compositions at different times, and / or administration in a composition in which both agents are present. Thus, in some embodiments, the compounds and other agents of the present invention are administered in a single composition.
[0331] The agents disclosed herein can be administered via any route, including intradermal, subcutaneous, oral, intra-arterial, or intravenous administration. Preferably, administration will be via intravenous route. Preferably, parenteral administration can be provided by bolus injection or by infusion.
[0332] According to the invention, the concentration of the therapeutic agent to be administered will vary depending on several factors, including the dose of the compound to be administered, the pharmacokinetic characteristics of the compound used, and the route of administration. The agent may be administered as a single dose or repeated doses. Treatment may be administered daily or more frequently, depending on many factors, including the patient's overall health condition, and the formulation and route of administration of the selected compound.
[0333] Preferably, the cancer treatment further comprises administering a therapeutically effective amount of the therapeutic agent. As used herein, the term "therapeuticly effective amount" refers to the amount of at least one agent or compound administered that is sufficient to treat or prevent a particular disease or condition. The result may be a reduction and / or relief of the signs, symptoms, or causes of the disease, or any other desired alteration of the biological system. For example, an "effective amount" for therapeutic use is the amount required for a composition comprising compounds as disclosed herein to provide a clinically significant reduction in the disease. In the case of any individual, techniques such as doseescalation studies may be used to determine the appropriate "effective" amount.
[0334] In some implementations, the diet is administered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, at least 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, or until a treatment endpoint is observed (e.g., tumor shrinkage is observed).
[0335] When a diet that is essentially deficient in serine includes or consists of dietary products, the dietary products are applied 1 to 10 times daily.
[0336] This invention also includes kits for detecting the presence of KRAS and / or MTAP in samples. The kits of this invention are particularly useful in identifying subjects who will benefit from cancer treatments including diets that are substantially serine-deficient. For example, the kits may include compounds or agents capable of detecting the expression or activity of KRAS peptides or nucleic acids in biological samples. The kits may include compounds or agents capable of detecting the expression or activity of MTAP peptides or nucleic acids in biological samples. The compounds or agents may be packaged in suitable containers. The kits may also include instructions for using the kit to detect KRAS and / or MTAP protein or nucleic acid molecules.
[0337] In one aspect, the present invention provides a kit for use in identifying subjects who will benefit from cancer treatment comprising a diet substantially lacking serine, the kit comprising: a. Agents used to determine the expression or activity of Kras; and b. Reagents used for assays.
[0338] The kit may further include agents for determining the expression or activity of MTAP.
[0339] On the other hand, the present invention provides a kit for use in identifying subjects who will benefit from cancer treatment comprising: i) a diet substantially deficient in serine, and / or ii) a diet limited in cysteine, the kit comprising: a. Agents used to determine the expression or activity of MTAP; and b. Reagents used for the determination.
[0340] In the kit of the present invention, the agent may be an antibody or a nucleic acid molecule.
[0341] For antibody-based kits, the kit may include: (1) a first antibody (e.g., attached to a solid support) that specifically binds to the polypeptide marker of the present invention (e.g., KRAS or MTAP); and optionally, (2) a second different antibody that binds to the polypeptide marker or the first antibody and is conjugated to a detectable agent.
[0342] For oligonucleotide-based kits, the kit may include: (1) nucleotide probes, such as detectable labeled primers, which hybridize with a biomarker (e.g., KRAS or MTAP) nucleic acid molecule, or (2) a pair of primers or amplified biomarker nucleic acid molecule.
[0343] The kit may also include components (e.g., enzymes or substrates) necessary for detecting the detectable reagent. The kit may also contain control samples or a series of control samples that can be measured and compared with the included test samples.
[0344] The kit may also include instructions for use.
[0345] In one embodiment, when the kit determines KRAS expression or activity, the kit includes a description indicating that an increase in the level of Kras expression or activity in a biological sample compared to a control sample or a predetermined reference level indicates a subject's non-responsiveness or insensitivity to the cancer treatment, and wherein a decrease in the level of Kras expression or activity in a biological sample compared to a control sample or a predetermined reference level, or a Kras expression or activity level substantially the same as that of a control sample or a predetermined reference level, indicates a subject's responsiveness or sensitivity to the cancer treatment.
[0346] In one implementation, when the kit determines MTAP expression or activity, the kit includes a description of the level at which MTAP expression or activity in the biological sample is reduced compared to a control sample or a predetermined reference level, or the level of MTAP expression or activity is substantially the same as that in a control sample or a predetermined reference level, indicating the subject's responsiveness or sensitivity to the cancer treatment. Example
[0347] Example 1 ( Figure 1 , Figure 2 , Figure 3 , Figure 4 , Figure 18 , Figure 19 , Figure 20 , Figure 21 , Figure 22 and Figure 23 ) method Cell lines and cell cultures.
[0348] DLD1 and SW480 cells were obtained from ATCC and validated using Promega GenePrint 10. iKRAS cells (iKRAS1, iKRAS3, AK196) were amicably supplied by Ron DePinho (Ying et al., Cell, 2012), (The University of Texas MD Anderson Cancer Center). Cell culture media were purchased from GIBCO, product numbers are shown in parentheses. SW480 and iKRAS (DMEM-21969) and DLD1 (RPMI-1640-31870) were maintained in the medium supplemented with 10% FBS (10270), penicillin-streptomycin, and amphotericin B to a final concentration of 2 mM L-glutamine. Reserve iKRAS cells were grown for experiments in the presence of doxycycline 2 μg / ml (KRAS-ON) and in media with / without doxycycline (KRAS-ON / OFF). Cells were kept in an incubator at 37°C and humidified with 5% CO2. Routine mycoplasma testing was performed on the cultured cells using the Mycoalert assay kit (Lonza).
[0349] Proliferation assay. iKRas cells were seeded in complete DMEM medium plus 2 μg / ml doxycycline in 24-well plates and allowed to adhere overnight. Cells were then washed with PBS and subjected to assay medium with or without serine and glycine, and with or without 2 μg / ml doxycycline. Cells were counted in triplicate at 48 h and 96 h (using a Casy TT cell counter, Innovatis, Roche Applied Science), and the relative cell number from the time of medium change was calculated using a “time = 0” plate. Data presented are from three independent experiments.
[0350] Metformin in vitro assay DLD1 and SW480 cells were seeded into 24-well plates and allowed to adhere overnight. Cells were washed with PBS and treated with assay medium containing or without serine and glycine, and with or without metformin, and allowed to grow for three days. Representative wells were photographed using an optical microscope, and cell counts were performed using a Casy TT cell counter. Figure 19 d). For dose response experiments ( Figure 23 e) The cells were seeded in the same manner in assay medium without serine and glycine, or in assay medium containing low serine and glycine (10 uM), and the cells were counted in three wells after three days.
[0351] Organoid cultures. ADF (Advanced DMEM F / 12) containing 2 mM glutamine, 1% penicillin / streptomycin solution, 0.1% AlbuMAX I BSA, and 10 mM HEPES (all from Gibco / Life Technologies). Adenomas were removed from the small intestine of mice, cut into small pieces, and washed five times with ice-cold PBS. The pieces were incubated at 4°C in 5 mM EDTA on a roller for 10 minutes. The crypt filtrate was washed twice with ice-cold PBS to remove EDTA and incubated at 37°C for 30 minutes with 10x trypsin. The supernatant enriched with the crypt filtrate was collected and washed approximately five times with 5 ml of ADF by mechanical pipetting. The crypt filtrate was precipitated by centrifugation at 1200 rpm for 5 minutes. The crypt filtrate was resuspended in growth factor-depleted matrix gel (BDBiosciences) and seeded 20 μl per well in 12-well plates. Allow the matrix gel to cure in a 37°C incubator for 30 minutes, then add appropriate supplementation with ADF (1 ml total volume per well) containing 0.05 μg / ml EGF and 0.1 μg / ml head protein. Separate the follicular glands by harvesting in ice-cold PBS and allowing them to settle at 600 rpm for 3 minutes. Aspirate the supernatant and mechanically pipette the precipitate with 100 μl of ice-cold PBS. Add 5 ml of PBS to the tube and allow it to settle at 600 rpm for 3 minutes, repeating until no debris remains in the supernatant. Resuspend the final follicular gland precipitate in growth factor-depleted matrix gel and plate as previously described. For serine / glycine starvation, construct an assay medium for organoids containing or without serine and glycine, but containing all other amino acids, using amino acid-free AdvancedDMEM F / 12 (Gibco / Life Technologies).
[0352] diet. From weaning, mice were given an arbitrary "normal diet" (Rat and Mouse Breeder and Grower, 801730, Special Diet Services, SDS, UK) and water. Under normal diet conditions, dietary amino acids were derived from the total protein in the raw materials (wheat, bran, barley, hulled roasted soybeans, corn, and fishmeal), supplemented with a small amount of purified lysine. Two experimental diets were used, both based on the Baker Purified Amino Acid Diet from TestDiet (Richmond, IN) (Hirakawa et al.). Nutr. Res.(1984): "Diet 1 - Control" contains all essential amino acids plus serine, glycine, glutamine, arginine, cysteine, and tyrosine; "Diet 1 - No Ser, No Gly" is the same as Diet 1 - Control, but lacks serine and glycine, with the levels of other amino acids increased proportionally to achieve the same total amino acid content. These "Diet 1" formulations have been previously used (Maddocks et al., 1984). Nature 2013, and see “Xenotransplantation” below). “Diet 2-Control” contains all essential amino acids plus serine, glycine, glutamine, arginine, cysteine, tyrosine, alanine, proline, glutamic acid, and asparagine; “Diet 2-No Ser, No Gly / Diet 2-No SG” is the same as Diet 2-Control, but omits serine and glycine, with other amino acid levels increased proportionally to achieve the same total amino acid content. The “Diet 2” formulation is used for Eμ-Myc-Tigar - / - Group use ( Figure 19 f). All other groups received the previously announced "Diet 1" formulation.
[0353] Mice. All animal studies were conducted in accordance with the Animals (Scientific Procedures) Act 1986 and the EU Directive 2010, and were approved by the local ethics review procedure (University of Glasgow). Mus musculus populations were housed in a fenced facility with active environmental enrichment. Eμ-Myc11, ApcMin / +, Lgr5creER; Apcfl / fl and Pdx1cre; KrasG12D; Trp53fl / + or Trp53R172H / + mice / models have been previously described. Mixed male and female populations were used for each genotype. The number of mice (or the number of samples from individual mice) is shown in each figure / legend. Eμ-Myc and ApcMin / + mice were at least 20 generations of C57BL / 6J. Eμ-Myc;Tigarfl / fl mice were at least 50% C57BL / 6J. Mice were initiated with an appropriate diet at the following times: 60 days after birth for Eμ-Myc purebreds, 55 days after birth for Eμ-Myc;Tigarfl / fl mice, 80 days after birth for ApcMin / + mice, 7 days after induction for Lgr5creER; and 60 days after induction for Pdxlcre;KrasG12D;Trp53fl / + or Trp53R172H / + mice. Tamoxifen induction via Lgr5creER was performed twice intraperitoneally, with a one-day rest between injections. For the phenformin assay, Eμ-Myc mice were administered 100 mg / kg body weight daily by gavage starting on the same day as the dietary change. For the metformin assay, ApcMin / + mice were administered 200 mg / kg / day in their drinking water starting 4 days after the dietary change. All mice were carried to the clinical endpoint. Intestinal tissue from ApcMin / + mice was fixed in methacarn (methanol, chloroform, and acetic acid in a 4:2:1 ratio) to facilitate scoring of tumor number and area (width x length).
[0354] The sample size used for mouse studies was estimated based on experience with previous use of these models, which tested for potential differences in survival using Mantel-Cox (log-rank) analysis. Subsequent groups were scaled down after data were collected for the first experimental group (e.g., only the Eμ-Myc and APCMin / + groups placed on the diet) to minimize the number of animals used (e.g., phenformin and metformin treatment groups). In all experiments, only mice with a distinct phenotype at the time of study participation were excluded (i.e., not participating): for example, signs of enlarged lymph nodes or an enlarged thymus in the Eμ-Myc group, or anemia in the APCMin / + group. Animals that died from diseases unrelated to the tumor were included for censored observation. Mice were assigned to experimental groups according to a randomized block design: as mice became available through breeding, they were divided into multiple blocks based on sex and then randomly assigned to treatment. Care was taken to maintain a similar male / female ratio to eliminate sex as a potential source of variability. The researchers assigning mice to experimental groups and collecting endpoint data were not blinded.
[0355] Liquid chromatography-mass spectrometry (LCMS).
[0356] Samples were prepared in a cold (-20°C) lysis solvent (LS) consisting of methanol, acetonitrile, and H₂O (50:30:20). 10 μl of serum sample was added to 490 μl of LS and vortexed; protein precipitate was removed by centrifugation. Organoid extracts were prepared by washing wells with PBS, then adding 250 μl of LS to each well and vortexing at 4°C for 10 min. LS was removed from the wells, and protein was then removed by centrifugation. Tissue samples were rapidly frozen and stored at -80°C. Before lysis, frozen samples were weighed and homogenized in 1 ml of cold LS using a Precellys homogenizer (Bertin Technologies). Proteins in the lysates were removed by centrifugation, and the lysate concentration was normalized to weight-based LS after homogenization. Extracts were analyzed on an LCMS platform consisting of an Accela 600 LC system and a precision mass spectrometer (Thermo Scientific). Metabolites were separated using a SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 μl) (Merck). The mobile phase consisted of a mixture of A = 20 mM ammonium carbonate (adjusted to pH 9.4) and B = acetonitrile. A gradient program was used, starting with 20% A and increasing linearly after 2 minutes, reaching 80% at 17 minutes, followed by washing and reequilibration steps. The total run time was 25 minutes. The LC stream was desolvated and ionized in a HESI probe. A precision mass spectrometer was operated in full scan mode with a resolution of 50,000 m / s in the mass range of 75–1,000 m / s and polarity switching. The raw data were analyzed for the identification and quantification of metabolites using LCquan (Thermo Scientific) and MZMine 2.10.
[0357] Protein blotting. Western blotting of cells was performed as previously described (Maddocks et al.). Nature , 2013; Labuschagne et al., Cell Rep. , 2014; Maddocks et al., Mol. CellIn short, whole-cell protein lysates were prepared in RIPA buffer supplemented with a complete protease inhibitor (Roche), sodium orthovanadate, and sodium fluoride (both Sigma). Tissue samples were lysed using a TissueLyser II (Qiagen) in RIPA buffer supplemented with a mixture of protease and phosphatase inhibitors (Pierce / Thermo Scientific). Lysates were removed by centrifugation, separated using pre-made 4–12% NuPAGE or Bolt gels (Invitrogen, Life Technologies), and transferred to nitrocellulose membranes. Proteins were detected and quantified using a Li-Cor Odyssey infrared scanner and software (Li-Cor Biosciences). Secondary antibodies for relevant substances were IRDye680 and conjugated IRDye800 (Li-Cor Biosciences). The primary antibodies used were: PHGDH (Sigma Life Science, HPA 021241), PSAT1 (Novus Biologicals, NBP1-32920), PSPH (Santa Cruz, sc-98683), actin I-19-R (Santa-Cruz, sc-1616-R), pERK [phosphate-p44 / p42 MAPK (Erk 1 / 2) (Thr202 / Tyr204)] (Cell Signalling Technology 9101), AMPKa1 (R&D Systems, AF3197), and phosphate-AMPK T172 (Cell Signalling Technology 2535).
[0358] qRT-PCR. RNA was extracted using a DNase-based RNeasy kit (both Qiagen kits) to remove DNA. As previously described (Maddocks et al., NatureqRT-PCR was performed using an Applied Biosystems 7500 Fast Real-Time PCR system with SYBR Green master mix (Applied Biosystems, 2013). Primers (5'-3'): mouse PHGDH forward TGGCCTCGGCAGAATTGGAAG; mouse PHGDH reverse TGTCATTCAGCAAGCCTGTGGT; mouse PSAT1 forward GATGAAACATCCCATTTCGCATTGG; mouse PSAT1 reverse GCGTTATACAGAGAGGCACGAATG; mouse PSPH forward GATGATGGAGCTACGGACATGGAAG; mouse PSPH reverse CTCCTCCAGTTCTCCCAGCAGCTC. Mouse Actin B was purchased from PrimerDesign (HK-SY-mo-900 ACTB). The sequence was synthesized and purified by Eurofins MWG Operon.
[0359] Statistical data. Statistical comparisons of survival data were calculated using the Mantel-Cox (log-rank) test and Graphpad Prism (v6) software. T-tests were performed using Microsoft Excel (v14.6.1) or Graphpad Prism (v7). Type 1 / paired (samples from the same animal) and type 2 / unpaired (samples from different animals) T-tests were used. In cases where no potential difference direction prediction was made, a two-tailed / two-tailed T-test was used (e.g., across all amino acid levels in serum samples). Figure 21 When pre-existing data supports predictions of the direction of differences between samples, a one-sided / one-tailed T-test is used (e.g., de novo serine synthesis). Figure 2 d) When the presented data is the mean of a single data point, the error bar is STDEV; when the data is the mean of means, the error bar is SEM. In each case, the type of T-test or error bar is indicated in the legend. When the T-test is performed using multiple comparisons, the p-value is corrected using the Holm-Sidak method with Graphpad Prism (v7) software.
[0360] xenografts Eight-week-old female CD-1-Foxn1nu mice (Charles River) were administered bilateral subcutaneous injections of 3 × 10⁶ HCT116 cells; the right side received p53+ / +, and the left side received p53- / - (1ex). Immediately after injection, the mice were placed in either a control diet (n=10) (containing serine and glycine as part of an amino acid mixture) or a diet lacking serine and glycine (n=10) (Test Diet, International Product Supplies) – formulations as follows: The control diet consisted of: sucrose (25.9%), corn starch (41.8%), corn oil (5.0%), Baker's amino acid vitamin mixture (0.2%), Baker's amino acid mineral mixture (10.0%), sodium bicarbonate (1.0%), DL-α-tocopherol acetate (0.004%), ethoxyquin (preservative, 0.019%), choline chloride (0.1%), and amino acid premix (16.0%). Amino acid premix: L-arginine-HCl (1.60%), L-cysteine (0.64%), L-glutamine (1.60%), glycine (1.33%), L-histidine-HCl (0.80%), L-isoleucine (1.07%), L-leucine (1.60%), L-lysine-HCl (1.87%), L-methionine (0.80%), L-phenylalanine (1.07%), L-serine (1.33%), L-threonine (1.07%), L-tryptophan (0.27%), L-tyrosine (0.53%), L-valine (1.07%). The diet lacking serine and glycine has the same basic formulation as the control diet, but the amino acid mixture is deficient in serine and glycine. Dietary components without serine and glycine: sucrose (25.9%), corn starch (41.8%), corn oil (5.0%), Baker amino acid vitamin blend (0.2%), Baker amino acid mineral blend (10.0%), sodium bicarbonate (1.0%), DL-α-tocopherol acetate (0.004%), ethoxyquin (preservative, 0.019%), choline chloride (0.1%), and amino acid premix (16.0%). Amino acid premix: L-arginine-HCl (1.60%), L-cysteine (0.64%), L-glutamine (1.60%), L-histidine-HCl (0.96%), L-isoleucine (1.28%), L-leucine (1.92%), L-lysine-HCl (2.24%), L-methionine (0.96%), L-phenylalanine (1.28%), L-threonine (1.28%), L-tryptophan (0.32%), L-tyrosine (0.64%), L-valine (1.28%).
[0361] These diets had equal caloric value and equal total amino acid content. Animals were housed in sterile IVC cages, monitored three times a week, and humanely euthanized when tumors reached a predetermined size (volume = (length x width²) / 2) or ulceration reached the clinical endpoint. All animal studies were approved through the Ethical Review Process (University of Glasgow) and conducted in accordance with the UK Animals (Scientific Procedures) Act of 1986 (PPL 60 / 4181) and the 2010 EU Directive.
[0362] result We tested two methods involving KRas activation and p53 deletion (KRas activation and p53 deletion). G12D p53 + / - ) or mutation (Kras) G12D p53 R172H A mouse model of pancreatic cancer was developed. Surprisingly, despite a significant decrease in serum serine and glycine levels (…),… Figure 3 a and Figure 3 b), but in both models, no significant change in survival rate was observed in response to a serine / glycine-free diet. Figure 1 a and Figure 1 b) Intravenous injection 13 C- 15 N-labeled serine revealed that serine uptake was comparable in normal and tumor pancreatic tissues, while intestinal tumors in the APCmin model absorbed significantly more serine compared to normal tissue (as measured by labeling of serine and glycine derived from serine). Figure 1 c). These results are consistent with the increased demand for exogenous serine in APCmin tumors and their consequent sensitivity to dietary serine restriction. However, pancreatic tumors exhibit less dependence on exogenous serine, which explains their resistance to diet.
[0363] A key difference between lymphoma / intestinal tumor models and pancreatic models is the presence of activated KRas in the latter. Activated Ras has been shown to enhance cellular access to extracellular proteins via macropinocytosis, a mechanism that reduces cellular dependence on free circulating serine levels. However, overexpression of SSP pathway enzymes can also remove dependence on extracellular serine. This prompted us to examine KRas G12D The effect of expression on the ability of these cells to perform de novo serine synthesis was investigated. A doxycycline-inducible Krass formulation was used. G12D In pancreatic cells, we found that downregulating KRasG12D Subsequently, the expression of SSP enzymes decreased consistently at both the RNA and protein levels. Figure 1 d and Figure 1 e). Expressing Kras G12D The cells are completely resistant to serine and glycine starvation. Kras G12D Inactivation slowed the proliferation rate of these cells in complete culture medium, and importantly, without Kras... G12D The cells regained sensitivity to serine starvation, showing a further decrease in proliferation in media lacking both serine and glycine. Figure 1 f).
[0364] We also tested Kras using organoid culture models. G12D Whether expression can confer resistance to serine-sensitive intestinal tumor cells. APCmin intestinal organoids grew into spheroids in vitro, and consistent with our in vivo studies, the growth of these organoids was inhibited by the removal of serine and glycine. Figure 2 a). In comparison, APCmin / Kras G12D Organoids are much less affected by serine starvation. Figure 2 a). Furthermore, growth for five days in conditions lacking serine and glycine severely impaired the recovery ability of APCmin organoids after re-inoculation into complete culture medium, while expression of Kras... G12D The organoids recovered rapidly. Figure 2 b and Figure 28 These phenotypic changes are caused by the expression of Kras. G12D The higher basal expression of SSP enzyme in intestinal cells reflects ( Figure 2 c). SSP utilizes glycolytic intermediates to produce serine; therefore, to test SSP activity in these cells, we used [a specific assay / treatment] to [previous assay / treatment]. 13 Organoids were grown in a medium containing C-labeled glucose, and the levels of labeled glucose and serine (synthesized from glucose) were measured. Figure 2 d). Although in APCmin and APCmin Kras G12D The levels of glucose labeled in the cells were comparable, indicating that these cells had equal capacity to absorb glucose, but in the expression of Kras... G12D The levels of marked serine in these cells were significantly higher, supporting an increased rate of serine synthesis in these cells. Figure 2 d).
[0365] Analysis of serum amino acid levels in PDAC within the GEM model showed that diet significantly reduced systemic levels of serine and glycine in both models. Figure 3 a and Figure 3(b) , while other amino acid levels either remained unchanged or showed minor / inconsistent changes. Despite this systemic decrease in serine and glycine, PDAC tumors are resistant to serine / glycine starvation because they are able to upregulate de novo serine synthesis as described above. Figure 1 and Figure 2 In contrast, tumors formed from xenografted human colorectal cancer cell line (HCT116) in nude mice were sensitive to dietary serine / glycine starvation. In the xenograft model, a serine / glycine-free diet resulted in a significant reduction in tumor volume. Figure 4 a) and significantly increased the survival rate of mice. Figure 4 b).
[0366] To assess whether observations made in xenograft models translate into autochthonous tumors, we used well-established models for lymphoma (based on εμ-Myc expression) and intestinal tumors (based on defective APC expression). From 60–80 days postnatal, during the development of precancerous lesions (adenomas initiating at APC),... Min / + A few days after birth, Eμ-Myc mice (which developed pretumor lesions within 28-42 days of birth) were switched from a normal diet to an experimental diet to mimic a therapeutic (rather than preventative) intervention. In both genotypes, a diet lacking serine and glycine significantly prolonged survival. Figure 18 a and Figure 18 b). In APC Min / + Tumor area in mice indicated a trend toward smaller but significant tumor size reduction at clinical endpoints in mice on a serine / glycine-free diet, but no significant difference in tumor number was observed at clinical endpoints in mice on a serine / glycine-free diet. Figure 20 ).
[0367] Liquid chromatography-mass spectrometry (LCMS) analysis of serum samples showed that diet repeatedly led to significant decreases in serine and glycine levels, with little or no effect on other amino acids. Figure 18 c and Figure 18 d、 Figure 21 a and Figure 21 b). These changes translated into a decrease in serum serine and glycine levels from approximately 150 μM in the control diet to 65 μM in a diet lacking serine and glycine. Figure 18 e). We used an inducible intestinal tumor model (Lgr5-creER APC). fl / flThe survival effect of the diet was further verified; in this case, mice were switched to this diet one week after tumor induction began. Similarly, compared to the control diet (containing purified amino acids) or normal food (containing whole protein as an amino acid source), the diet resulted in a significant increase in survival. Figure 18 f).
[0368] Serine starvation activates de novo serine synthesis, diverting glycolytic intermediates from energy production. Cells respond by increasing OXPHOS to maintain ATP levels, and inhibition of OXPHOS enhances the antiproliferative effect of serine starvation. To test whether these observations translate into an in situ tumor model, we combined serine and glycine starvation with biguanide phenformin (a complex I inhibitor) in Eμ-Myc mice. Mice on a normal diet tolerated the maximum dose of phenformin (100 mg / kg / day), but experienced significant toxicity (symptoms similar to constipation) in mice on a diet lacking serine and glycine. While this forced us to reduce recruitment for this study, mice that were recruited and did not succumb to the toxicity (7 / 14) did not suffer further adverse effects. These mice maintained on a diet with phenformin and showed a trend toward improved survival compared to animals on a diet lacking only serine and glycine. However, due to the initial toxicity, too few mice survived, making the effect statistically insignificant. Figure 19 a). These results are consistent with previous studies, demonstrating a synergy between serine deprivation and biguanide therapy in tumor allogeneic transplantation systems.
[0369] To further explore the potential synergistic effect between biguanide therapy and serine starvation, we turned to metformin, which has low toxicity, is widely used clinically as an antidiabetic agent, and is being investigated as an anticancer agent. Although the systemic availability of oral metformin is generally poor, some tissues (including the intestine) express the OCT1 transporter, which facilitates metformin uptake, enabling APC… Min / + Mice were selected as a viable model. Guided by previous research, we chose a mouse metformin dose (200 mg / kg / day) equivalent to a human daily dose of 1 g / day (calculated by body surface area). Doses ranging from 0.5–1 g / day have been used in multiple clinical trials of metformin in colorectal cancer, so we chose a clinically relevant dose, but a submaximal dose, to avoid the toxicity associated with phenformin use. However, we were unable to detect any adverse effects of metformin on APC. Min / + Significant impact on mouse survival – despite the persistent beneficial effects of serine starvation ( Figure 19 b and Figure 22a and Figure 22 b). Interestingly, metformin actually increased the number of tumors present in both diet groups (statistically significant for the diet group lacking serine and glycine). Figure 19 c), while the average tumor area did not change substantially. Figure 22 c). Although given that it originated from Villin creER APC fl / fl The synergistic effect of metformin (1000 μM) and serine starvation in mouse intestinal tumor organoids was surprising. Figure 19 d) Tumor organoid data also showed that low-dose metformin antagonized starvation by serine and glycine, protecting tumor cells from starvation. Figure 19 d). These dose-dependent effects of metformin (the protective effect against serine and glycine starvation or the enhancement of the effect against serine and glycine starvation) may be related to metformin's effect on reactive oxygen species (ROS) levels, which decrease with low doses of metformin but increase with high doses. Figure 19 e).
[0370] To investigate why metformin treatment was not effective in serine / glycine-deficient mice, we analyzed serum and tissues by mass spectrometry. Analysis of serum and tissues from metformin-treated mice ( Figure 23 a, Figure 23 b and Figure 23 c) showed relatively low metformin levels, and within the range expected to antagonize (rather than enhance) the antiproliferative effects of serine and glycine starvation. Analysis of serum glucose and lactate levels showed that these low levels of metformin had minimal effect on systemic metabolism. Figure 23 d). At these concentrations, in APC-deficient organoids (as described above, Figure 19 In d) or APC truncated colorectal cancer cell lines, metformin did not have a synergistic effect with serine / glycine starvation, showing a trend toward increased cell number at 20 μM. Figure 23 e). Metformin has long-established antioxidant properties, including upregulation of thioredoxin, and we have shown that antioxidants improve cell survival during serine and glycine starvation by protecting cells from ROS. Therefore, this study suggests that metformin levels are too low to inhibit tumor growth, despite clinically relevant doses and tissue penetration. This contrasts with previous studies that showed APC Min / + Mice treated with metformin showed a moderate reduction in tumor area (no change in tumor number) despite a high dose.
[0371] We have previously shown that serine depletion makes cells in cultures more sensitive to ROS. Therefore, to directly test whether increasing ROS levels in vivo can enhance the antitumor effects of a serine-depleted diet, we used... Tigar Mice lacking Eμ-Myc. It has been shown that the TIGAR protein supports tumor development by limiting ROS. Although expression of Eμ-Myc in this mixed strain background led to faster death from lymphoma (e.g., BI6 Eμ-Myc) in mice compared to pure BI6 Eμ-Myc mice. Figure 18 As shown in a), as expected, we found Tigar Increased survival after deletion ( Figure 19 f). Importantly, Tigar The combination of diets lacking serine and glycine had a beneficial effect, resulting in a significant increase in overall survival. Figure 19 f). These data support the concept that increased tumor ROS levels, when combined with a diet lacking serine and glycine, will lead to improved survival. Since many chemotherapy agents and radiotherapy induce ROS, combining this diet with standard anticancer treatments has excellent potential.
[0372] Example 2 ( Figure 5 (and Table 1) method HCT116 (6,000 cells per well), DLD1 (6,000 cells per well), and SW480 (10,000 cells per well) cells were seeded in 96-well plates in medium containing or lacking serine and glycine (but containing all other amino acids). After 6 hours, the drug was added to the plates at the stated dose (range 0.1–10 μM), and the cells were incubated for another 48 hours. Subsequently, the cells were fixed in formalin (4%) solution and stained with DAPI nuclear stain. Cell counting was performed using the Operetta system. Results are shown in… Figure 5 middle.
[0373] Human cell lines HCT116, DLD1, and SW480 were seeded into 96-well plates in either complete medium containing all other amino acids and 100 μM of serine, glycine, and cysteine, or in low serine, glycine, and cysteine (17–23 μM) medium containing all other amino acids. After 6 hours, the chemotherapeutic agents (at doses of 0.01, 0.1, and 1 μM) were added to the wells, and the cells were incubated for another 48 hours. Subsequently, the cells were fixed in formalin and stained with fluorescent nuclear stain for cell counting on an automated (Operetta) plate reader. Cell count data were used to derive synergistic scores to calculate which drugs had a synergistic effect (i.e., greater than additive effect) when administered in combination with low serine / glycine / cysteine (see below). The results are shown in Table 1.
[0374] Figure 5 The data presented indicate that when combined with serine and glycine starvation, various anticancer chemotherapeutic agents (from multiple drug classes) exhibit enhanced antiproliferative activity in human cancer cells. Therefore, this data suggests that combining a serine and glycine-free diet with conventional chemotherapy in cancer patients may enhance the antitumor activity of chemotherapy and / or allow for its use at lower doses.
[0375] Table 1 shows the average synergistic effect scores of specific drugs combined with reductions in serine, glycine, and cysteine in the culture medium on three colorectal cancer cell lines.
[0376] Table 1
[0377]
[0378] The data shown in Table 1 demonstrate that human cancer cells exposed to low concentrations of serine, glycine, and cysteine (as is the case when consuming a diet lacking serine and glycine or a diet lacking serine, glycine, and cysteine) are more sensitive to the antiproliferative effects of various chemotherapeutic agents. For the chemotherapeutic agents listed in Table 1, there is a synergistic effect of antiproliferative activity when combined with a low-serine, glycine, and cysteine diet; that is, the antiproliferative effect of each agent combined with amino acid restriction is greater than the sum of the antiproliferative effects of the individual agents or the effects of amino acid restriction alone. Therefore, these data suggest that combining a serine and glycine / serine, glycine, and cysteine-free diet with conventional chemotherapy in cancer patients can enhance the antitumor activity of chemotherapy and / or allow them to be used at lower doses.
[0379] Example 3 ( Figure 6 , Figure 7 , Figure 10 and Figure 11 ) method C57BI6 mice (n=3 per diet group) were fed either a control diet (see “Diet 2 - Control” above) or a diet lacking serine and glycine (“Diet 2 - No Ser, No Gly” above) for six weeks. Terminal serum samples were analyzed by LCMS as described above, showing the relative amounts of all non-essential amino acids. *P<0.05 unpaired t-test. Results are shown in... Figure 6 middle.
[0380] Cell culture HCT116 and RKO cells were a gift from Professor Bert Vogelstein. SW480, A549, MDA-MB-231, MDA-MB-468, and MCF7 cells were obtained from ATCC. Unless otherwise noted, cell culture products were obtained from Gibco; catalog numbers are shown in parentheses. Cells were grown at 37°C in a humidified environment with 5% CO2 in air. Stock cells were held in McCoy's 5A medium (26600) supplemented with 10% fetal bovine serum (FBS; 10270) and penicillin-streptomycin, or in DMEM (21969) supplemented with 10% FBS (G10270), 2 mM L-glutamine, and penicillin-streptomycin. For the starvation experiment, a “test medium” deficient in serine and glycine was prepared using MEM (21090), supplemented with dialyzed FBS (HyClone, Thermo Scientific), 2 mM L-glutamine, D-glucose (Sigma-Aldrich; final concentration 17 mM), MEM vitamins (11120), and penicillin-streptomycin.
[0381] Intake / Release Assay The cells were seeded in complete culture medium in 6-well plates (at an appropriate seeding density, ~90% confluence at the end of the assay) and allowed to grow for 48 hours (the medium was refreshed after 24 hours). At the start of the assay, the cells were washed with PBS and each well was given 1.5 ml of assay medium supplemented with serine and glycine (0.4 mM). At the stated time point, 10 μl of the medium was removed and added to 490 μl of ice-cold methanol / acetonitrile / H2O (50:30:20). These samples were prepared for LC-MS as described below.
[0382] Liquid Chromatography-Mass Spectrometry The sample was shaken at 4°C for 10 minutes, and then at 16,000x gCentrifugation was performed for 15 minutes, and the supernatant was collected and analyzed by LC-MS. Analytes were separated using hydrophilic interaction liquid chromatography on a SeQuant ZIC-pHILIC column (2.1 x 150 mm, 5 μl) (Merck) and detected using high-resolution, precision mass spectrometry with an Orbitrap Exactive compliant with an Accela autosampler and Accela 600 pump (Thermo Scientific). Elution buffers were: acetonitrile for buffer A and 20 mM (NH4)2CO3 in H2O and 0.1% NH4OH for buffer B. A linear gradient was programmed, starting at 80% buffer A and ending at 20% buffer A after 20 minutes, followed by washing (20% buffer A) and reequilibration (80% buffer A) steps at a flow rate of 100 μl / min. The mass spectrometer was equipped with an electrospray ionization probe and operated in full scan and polarity-switching modes with a positive voltage of 4.5 kV and a negative voltage of 3.5 kV. The levels of serine and glycine were quantified using a five-point calibration curve inserted into cell lysates and culture medium. Metabolite identification and data analysis were performed using LCQUAN software (Thermo Scientific). Results are shown in... Figure 7 middle.
[0383] result Figure 7 The data shown indicate that even when dietary cysteine / cystine is present, removing serine and glycine from the diet leads to depletion of cysteine / cystine levels in the body. This effect is likely to occur because serine is used to synthesize cysteine de novo (see [link to study]). Figure 10 and Figure 11 The data also suggests that dietary restriction of methionine (an essential amino acid and a precursor to cysteine in the body) may further deplete systemic cysteine levels. Figure 7 The data shown in the figure indicate that cancer cell lines in various forms of cancer voraciously consume exogenous cysteine / cystine, suggesting that cancer cells require exogenous cysteine to grow and that de novo cysteine synthesis may be defective (see [reference]). Figure 10 and Figure 11 ).
[0384] Example 4 ( Figure 8 , Figure 9 , Figure 12 and Figure 13 ) method Cells were seeded at 2 × 10⁴ M to 1 × 10⁵ cells per well in 24-well plates and allowed to adhere overnight. Cells were then washed once with PBS and experimental growth medium was added. The medium was a complete (+SGC) medium containing serine, glycine, cysteine, and all other amino acids, or lacking only serine and glycine (-SG), or lacking only cysteine (-C). Initial cell counts were recorded using a separate "time zero" counting chamber. The medium was changed every 24 hours, and counting was performed after 2 and 4 days. Relative cell counts were calculated by comparing the counts to the cell count at "time zero." For counting, cells were trypsinized, resuspended in PBS-EDTA, and counted using a CASY-model TT cell counter (Innovatis, Roche Applied Science). Data are the mean of three wells, and error bars represent the standard deviation. Results are shown in [Table data would be inserted here]. Figure 8 middle.
[0385] The cells were seeded in 24-well plates (2 x 10⁴ to 1 x 10⁵ cells per well) with the concentrations (ranging from 500 μM to 0.16 μM) of serine, glycine, and cysteine (but enriched with all other amino acids) and counted after 48 h. For counting, the cells were trypsinized, resuspended in PBS-EDTA, and counted using a CASY-model TT cell counter (Innovatis, Roche Applied Science). Results are shown in... Figure 9 middle.
[0386] The cells were seeded into 24-well plates at a rate of 2 × 10⁴ M to 1 × 10⁵ cells per well and allowed to adhere overnight. The cells were then washed once with PBS and experimental growth medium was added. The medium was either complete (+all AA) containing all amino acids, or lacking only serine and glycine (-Ser Gly), or lacking serine, glycine, asparagine, aspartic acid, proline, and glutamate (-Ser Gly Asn Asp Pro Glu), or lacking serine, glycine, and tyrosine (-Ser GlyTyr), or lacking serine, glycine, and cysteine (-Ser Gly Cys), or lacking serine, glycine, and arginine (-Ser Gly Arg). The initial cell count was recorded using a separate "time zero" counting chamber. The medium was changed every 24 hours, and the counting chamber was checked after 2 and 3 days. The relative cell count was calculated by comparing it to the cell count at "time zero". For counting, cells were trypsinized, resuspended in PBS-EDTA, and counted using a CASY-model TT cell counter (Innovatis, Roche Applied Science). Data are the mean of three wells, and error bars represent the standard deviation. Results are shown in... Figure 12 middle.
[0387] HCT116 cells were seeded at 4 × 10⁴ cells per well in 24-well plates and allowed to adhere overnight. The cells were then washed once with PBS and experimental growth medium was added. The medium was either complete containing all 20 amino acids, or lacking a single amino acid (tyrosine / arginine / cysteine), or a combination of amino acids (tyrosine / arginine / cysteine / serine / glycine). The initial cell count was recorded using a separate "time zero" counting chamber. The medium was changed every 24 hours, and the counting chamber was used after 4 days. The change in cell count was calculated as a percentage (time zero = 100%) by comparing it to the cell count at "time zero". For example, for cells in complete medium, the cell count after four days was 1400% compared to time zero. Cells with a negative percentage change from time zero were considered dead and are shown below the x-axis. For counting, the cells were trypsinized, resuspended in PBS-EDTA, and counted using a CASY-model TT cell counter (Innovatis, Roche Applied Science). The data is the average of three wells, and the error bars represent the standard deviation. The results are shown below. Figure 13 middle.
[0388] result Figure 8 and Figure 9Data showed that the removal of exogenous cysteine inhibited the growth of cancer cells from multiple types of cancer, and that in vitro removal of cysteine was highly effective in inhibiting cancer cell proliferation, achieving greater inhibition than starvation with serine and glycine alone. Figure 12 The study showed that specific combinations of exogenous non-essential amino acids removed (i.e., cells starved) determine the degree to which cancer cell proliferation is inhibited. The anti-proliferative effect was minimally enhanced by removing aspartic acid, asparagine, proline, and glutamate, with the removal of serine and glycine alone. However, additional removal of tyrosine, arginine, or cysteine alone in combination with serine and glycine had a more significant effect on proliferation. Figure 13 It is further shown that cytotoxic effects (i.e., not just antiproliferative activity) can be obtained when specific combinations of cysteine or non-essential amino acids are removed from cancer cells, and this effect is greatest when multiple non-essential amino acids are removed.
[0389] Example 5 ( Figure 14 ) method Expression of serine synthesis pathway enzymes (PHGDH, PSAT1, and PSPH) was determined by proteoblotting (as described above) in the cancer cell lines (top left panel) with or without serine and glycine for 48 hours of growth. Cells were seeded at 2 × 10⁴ to 1 × 10⁵ cells per well in 24-well plates and allowed to adhere overnight. Cells were then washed once with PBS and growth medium with or without serine and glycine was added (both media contained all essential amino acids and cysteine, arginine, glutamine, and tyrosine). Initial cell counts were recorded using a separate "time zero" counting chamber. The medium was changed every 24 hours, and counting chambers were performed after 2 and 4 days. Relative cell counts were calculated by comparing to the cell count at "time zero." For counting, cells were trypsinized, resuspended in PBS-EDTA, and counted using a CASY-model TT cell counter (Innovatis, Roche Applied Science). Data are the average of three wells, and error bars represent the standard error of the average. The results are shown in Figure 14 middle.
[0390] result Figure 14 The data showed that cancer cells expressed enzymes that perform de novo serine synthesis at different levels, and that the expression of these proteins affected the cells' sensitivity to serine and glycine starvation. Therefore, cells expressing high levels of serine synthases were resistant to the antiproliferative effects of serine and glycine starvation, while those expressing low levels were sensitive.
[0391] Example 6 ( Figure 15 , Figure 16 and Figure 17 ) method The cells were seeded in complete medium in 6-well plates (at an appropriate seeding density, ~90% confluence at the end of the assay) and allowed to grow for 48 hours (the medium was refreshed after 24 hours). At the start of the assay, the cells were washed with PBS and each well was given 1.5 ml of assay medium supplemented with both serine and glycine (0.4 mM) or serine only (0.4 mM) (containing all essential amino acids, glutamine, arginine, tyrosine, and cysteine). At the stated time point, 10 μl of the medium was removed and added to 490 μl of ice-cold methanol / acetonitrile / H2O (50:30:20). These samples were prepared for LC-MS and analyzed by LC-MS as described above. The results are shown in... Figure 16 and Figure 17 middle.
[0392] result Figure 15 , Figure 16 and Figure 17 Data shows that cancer cells exhibit a net efflux (i.e., release) of precursors for de novo cysteine synthesis. Homocysteine is derived from methionine and is crucial for de novo cysteine synthesis in mammalian cells (see also...). Figure 10 and Figure 11 Homocysteine is lost from these cancer cells in various forms, which may promote their inability to produce cysteine and thus make them sensitive to cysteine starvation. It can be detected by mass spectrometry as an unaltered molecule (homocysteine) or a homodimer (homocysteine) and a heterodimer (a dimer with cysteine).
[0393] Example 7 ( Figure 24 , Figure 25 , Figure 26 , Figure 27 , Figure 28 , Figure 29 , Figure 30 , Figure 31 ) Cell lines and cell cultures HCT116 cells were obtained from ATCC and validated using Promega GenePrint 10. iKRAS cells (iKRAS1, iKRAS3, AK196) were amicably provided by Professor Ronald DePinho (Ying et al., Cell, 2012), (The University of Texas MD Anderson Cancer Center). Cell culture media were purchased from GIBCO, product numbers are shown in parentheses. iKRAS (DMEM-21969) and HCT116 cells (RPMI-1640-31870) were maintained in the medium supplemented with 10% FBS (10270), penicillin-streptomycin, and amphotericin B to a final concentration of 2 mM L-glutamine. Reserve iKRAS cells were grown in the presence of doxycycline 2 μg / ml (KRAS-ON) and in media with / without doxycycline (KRAS-ON / OFF) for experiments. Cells were kept in an incubator at 37°C and humidified with 5% CO2. Routine mycoplasma testing was performed on the cultured cells using the Mycoalert assay kit (Lonza).
[0394] Proliferation assay HCT116 cells (2.5 × 10⁴ cells per well) were seeded in complete RPMI medium in 24-well plates and allowed to adhere overnight. Cells were then washed with PBS and subjected to modified MEM medium supplemented with varying concentrations of serine and glycine. 2 Replace the culture medium with fresh medium every 24 hours. Count the wells at the stated time points (using a Casy TT cell counter, Innovatis, Roche Applied Science), and calculate the relative cell count from the time of the medium change using a "time = 0" plate.
[0395] Tumor organoid cultures ADF=Advanced DMEM / F-12, containing 2 mM glutamine, 1% penicillin / streptomycin solution, 0.1% AlbuMAX I BSA, and 10 mM HEPES (all from Gibco / Life Technologies). Adenomatous small intestinal tissue was excised and cut into small pieces, which were then washed five times with ice-cold PBS. The pieces were incubated at 4°C in 5 mM EDTA on a roller for 10 minutes. The follicular glands were washed twice with ice-cold PBS to remove EDTA and incubated at 37°C for 30 minutes with 10x trypsin. The supernatant enriched with follicular glands was collected and washed approximately five times with 5 ml of ADF via mechanical pipetting. The follicular glands were precipitated by centrifugation at 1200 rpm for 5 minutes. The follicular glands were resuspended in growth factor-depleted matrix gel (BDBiosciences) and seeded 20 μl per well in 12-well plates. Allow the matrix gel to cure in a 37°C incubator for 30 minutes, then add appropriate supplementation with ADF (1 ml total volume per well) containing 0.05 μg / ml EGF and 0.1 μg / ml head protein. Separate the follicular glands by harvesting in ice-cold PBS and allowing them to settle at 600 rpm for 3 minutes. Aspirate the supernatant and mechanically pipette the precipitate with 100 μl of ice-cold PBS. Add 5 ml of PBS to the tube and allow it to settle at 600 rpm for 3 minutes, repeating until no debris remains in the supernatant. Resuspend the final follicular gland precipitate in growth factor-reduced matrix gel and plate as previously described. For SG starvation, construct assay media for organoids with or without serine and glycine (0.2 mM) and containing all other amino acids using amino acid-free Advanced DMEM / F-12 (Gibco / Life Technologies). For LCMS analysis, grow the organoids in 12-well plates in complete medium for three days. Aspirate the medium and wash the organoids with PBS. The culture medium was supplemented with 15 mM glucose-free solution. 13 C6-glucose (CK-Gas / Cambridge Isotopes) was replaced with Advanced DMEM / F-12 (Gibco / LifeTechnologies). After 5 hours, the culture medium was aspirated, the organoids were briefly washed in PBS, and metabolites were extracted as described below.
[0396] Organoid imaging Organoids were seeded in the medium with or without metformin / daunorubicin (both from Sigma) and allowed to grow for two days. Images for size quantification were captured using an optical microscope (ImageJ software), and the organoids were then fixed in 4% paraformaldehyde. ROS damage was assessed using the Alexa Fluor 594 secondary antibody (Thermo Fisher Scientific) by immunostaining the organoids with anti-malondialdehyde (MDA) (Abeam, ab6463). Images were captured on an Olympus FV1000 inverted laser scanning confocal microscope, and MDA staining was quantified using ImageJ software.
[0397] Liquid chromatography-mass spectrometry (LCMS) Samples were prepared in a cold (-20°C) lysis solvent (LS) consisting of methanol, acetonitrile, and H₂O (50:30:20). 10 μl of serum sample (isolated from terminal bleeding and stored at -80°C) was added to 490 μl of LS and vortexed. Protein precipitates were removed by centrifugation (15,000 rpm for 10 min at 4°C). Organoid extracts were prepared by briefly washing wells with excess PBS, then adding 250 μl of LS to each well and placing the well on a rocking shaker at 4°C for 10 min. LS was removed from the wells (without mechanical damage to the organoids / Matrix gel) and then vortexed and removed by centrifugation. Tissue samples were rapidly frozen and stored at -80°C. Frozen samples were weighed before lysis. The tissues were then homogenized in 1 ml of cold LS using a Precellys homogenizer (Bertin Technologies) or TissueLyser II (Qiagen). Proteins in the lysate were removed by centrifugation, and the concentration of the lysate was normalized to 10 mg / ml by LS based on the original tissue weight after homogenization.
[0398] Extracts were analyzed on an LCMS platform consisting of an Accela 600 LC system and a precision mass spectrometer (Thermo Scientific). Two LC methods were used for metabolite separation prior to MS detection. Method 1 employed a SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 μm) (Merck), with a mobile phase consisting of A = 20 mM ammonium carbonate (adjusted to pH 9.4) and B = acetonitrile. A gradient program was used, starting at 20% A and linearly increasing after 2 minutes to 80% at 17 minutes, followed by washing and reequilibration steps. The total run time for Method 1 was 25 minutes. Method 2 employed a ZIC-HILIC column (4.6 mm x 150 mm, 3.5 μm) (Merck), with a mobile phase consisting of A = water with 0.1% formic acid (v / v) and B = acetonitrile with 0.1% formic acid. A gradient program was used, starting at 20% A and linearly increasing to 80% at 30 minutes, followed by washing and reequilibration steps. The total run time for Method 2 was 46 minutes. The LC stream was desolvated and ionized in a HESI probe. A precision mass spectrometer was operated in full scan mode with a resolution of 50,000 in the mass range of 75–1,000 m / z, featuring polarity switching. Diluted in a relevant matrix matched to the analyte sample was used. 13 C- 15 N-labeled amino acids (Sigma) were used to quantify serine and glycine by LCMS using a 6-point standard curve. The raw data were analyzed using LCquan (Thermo Scientific) and MZMine 2.10 for the identification and quantification of metabolites.
[0399] Unbiased metabolomics The raw LCMS data was converted to mzML files using ProteoWizard and imported into MZMine 2.10 for peak extraction and sample alignment. The generated .CSV file was imported into an internal macro (Microsoft Excel 2010) for metabolite identification and background signal removal. Detailed procedures and setup parameters have been previously described (Zhang et al.). PLoS One (2013). SIMCA 14 (Umetrics) was used for multivariate analysis. S-plots were generated in the OPLS-DA (Orthogonal Partial Least Squares Discriminant Analysis) model to target the most influential metabolites.
[0400] diet From weaning, mice were given an arbitrary "normal diet" (Rat and Mouse Breeder and Grower, 801730, Special Diet Services, SDS, UK) and water. Under normal diet conditions, dietary amino acids were derived from the total protein in the raw materials (wheat, bran, barley, hulled roasted soybeans, corn, and fishmeal), supplemented with a small amount of purified lysine. Two experimental diets were used, both based on the Baker Purified Amino Acid Diet from TestDiet (Richmond, IN) (Hirakawa et al.). Nutr. Res. 1984): "Diet 1 - Control" contains all essential amino acids plus serine, glycine, glutamine, arginine, cysteine, and tyrosine; "Diet 1 - SG-Free" is the same as Diet 1 - Control, but excludes serine and glycine, with the levels of other amino acids increased proportionally to achieve the same total amino acid content. These "Diet 1" formulations have been previously used (Maddocks et al., Nature (2013). "Diet 2 - Control" contains all essential amino acids plus serine, glycine, glutamine, arginine, cysteine, tyrosine, alanine, proline, glutamic acid, and asparagine; "Diet 2 - SG-Free" is the same as Diet 2 - Control, but excludes serine and glycine, with other amino acid levels increased proportionally to achieve the same total amino acid content. The "Diet 2" formulation is used for Eμ-Myc;Tigar - / - Group use ( Figure 2 f). All other groups received the previously announced "Diet 1" formulation.
[0401] Mouse-GEM model All animal studies were conducted in accordance with the Animals (Scientific Procedures) Act 1986 and EU Directives 2010 (PPLs 60 / 4181, PPLs 70 / 8645 & 70 / 8646) and were approved by the local ethics review process (University of Glasgow). House mice were housed in a fenced facility with active environmental enrichment. Eμ-Myc (Adams et al.) were previously described. Nature 1985), Apc Min / + (Moser et al.) Science , 1990; Su et al., Science (1992) Lgr5creER Apc fl / fl (Barker et al.) Nature (1990) and Pdx1 cre Kras G12D / + Trp53 fl / + or Pdx1 cre Kras G12D / + Trp53 R172H / + (Hingorani et al.) Cancer Cell , 2005; Morten et al., Proc. Natl. Acad. Sci. USA (2010) Mice / models. Mixed male and female populations were used for each genotype. The number of mice (or the number of samples from individual mice) is shown in each figure / legend. Eμ-Myc and Apc Min / + The mice were at least 20 generations of C57BL / 6J (BI6). Eμ-Myc; Tigar - / - The strains were mixed, but at least 50% C57BL / 6J. The pancreas (PDAC) group was in a mixed strain background, but all cohorts were compromised by litter-matched controls. Mice were introduced to an appropriate diet at the following times: 60 days after birth for Eμ-Myc (BI6), Eμ-Myc; Tigar - / - 55 days after birth, Apc Min / + 80 days after birth, Lgr5 creER Apc fl / fl 7 days after induction, Pdx1 cre Kras G12D Trp53 fl / + or Pdx1 cre Kras G12D Trp53 R172H / + Sixty days after birth, mice were induced to recombinant via Lgr5creER by two intraperitoneal injections of 120 mg / kg tamoxifen, with a one-day rest between the two injections. For the phenformin experiment, Eμ-Myc mice were administered 100 mg / kg body weight via gavage daily starting on the same day as the dietary change. For the metformin experiment, Apc... Min / + Mice were given 200 mg / kg / day in their drinking water, starting four days after the dietary change. Villin was then added. creER APC fl / + Kras G12D / +Mice [C57BI / 6J N10] were placed on an experimental diet at 6–8 weeks of age and maintained on the diet for two weeks, followed by induction with a single intraperitoneal injection of tamoxifen (80 mg / kg). The intestines were fixed in methoxyacetanilide (methanol, chloroform, acetic acid in a 4:2:1 ratio) for scoring of tumor number and area (width x length). Except for n = 6 APCs used for BrdU and caspase staining. min / + Apart from mice, all other GEM mice were brought to the humane clinical endpoint.
[0402] The sample size used for mouse studies was estimated based on experience with previous use of these models, which were tested for potential differences in survival using Mantel-Cox (log-rank) analysis. After collecting data from the first experimental group (e.g., Eμ-Myc and APC placed only in the diet), Min / + Group, Figure 18 a and Figure 18 (b) Subsequent groups were scaled down to minimize the number of animals used (e.g., the phenformin and metformin treatment groups). Figure 19 a and Figure 19 b). In all experiments, mice exhibiting a distinct phenotype at the time of study were excluded (i.e., not participating): for example, signs of enlarged lymph nodes or enlarged thymus in the Eμ-Myc group, and in APC. Min / + Anemia in the group. Animals that died from diseases unrelated to the tumor were included in censored observation. Mice were assigned to the experimental group according to a randomized block design: as mice became available through breeding, they were divided into multiple blocks based on sex and then randomly assigned to the treatment arm. Care was taken to maintain a similar male / female ratio to eliminate sex as a potential source of variability. The researchers assigning mice to the experimental group and collecting endpoint data were not blinded.
[0403] Mouse xenograft / allogeneic transplantation HCT116 cells were implanted into CD1- cells via bilateral subcutaneous injection (3 × 10^6 cells per side). Foxn1 nu (CD1-naked) female mice (Charles River, UK). Mice were fed a normal diet and monitored daily until a visible, measurable tumor developed. Mice carrying tumors were placed in either a control (n=8 mice) or a non-SG diet (n=8 mice), and tumors were measured three times weekly using calipers. Any opposing flank tumors that developed after dietary changes were excluded from the analysis. Mean tumor volume was plotted for the first five weeks of feeding. Tumor volume was calculated using the formula: Volume = (Length x Width) 2 ) / 2.
[0404] EMU-Myc lymphoma cells were isolated from tumor-bearing lymph nodes of EMU-Myc mice with a mixed background using FACS. These cells were initially expanded and passaged in cell culture medium containing irradiated mouse embryonic fibroblasts (MEFs) until they were able to grow independently. The culture medium was DMEM / F-12 (Gibco / Life Technologies) supplemented with 10% FBS, 50 μM β-mercaptoethanol, penicillin, streptomycin, gentamicin, and amphotericin B. Cells were implanted into CD1- cells via bilateral subcutaneous injection (5 × 10^5 cells per side). Foxn1 nu Female mice (Charles River, UK). Mice were kept on a normal diet and monitored daily until visible, measurable tumors formed.
[0405] Mice carrying tumors were placed in either a control or a non-SG diet, and the tumors were measured with calipers every 2 / 3 days. Once the first mouse in the group reached the clinical endpoint (maximum permissible tumor volume), all mice in the group were killed and the tumors were removed (this occurred 6 days after being placed in the diet). The tumors were fixed in formalin, embedded in paraffin, and sectioned for histological examination.
[0406] BrdU and cysteine staining and necrosis quantification Two hours prior to sacrifice, mice were injected with 250 μL of a cell proliferation marker reagent containing BrdU (RPN201, Amersham / GE Heathcare). Antibodies used included cleaved caspase 3 ASP-175 (Cell Signaling Technology, 9661), anti-BrdU (BD Biosciences, 347580), and EnVision anti-rabbit (Dako, K4003). Tissue sections were counterstained with hematoxylin Z (CellPath). Stained slides were scanned using a Leica SCN400F scanner and analyzed using HALO image analysis software (Indica Labs). For Eμ-Myc tumor cell counts and BrdU and caspase staining, quantification was performed across the entire tumor, excluding necrotic areas. For APC... min / + In mice, single cross-sections of the entire small intestine were analyzed. Adenomas were manually identified, and the number of cells, caspase, and BrdU staining in each adenoma were quantified. Averages were taken for each mouse. Necrosis was quantified using H&E-stained cross-sections of the entire tumor. Necrotic areas were manually defined using HALO software, and the total necrotic surface area was calculated against the non-necrotic surface area.
[0407] Quantitative analysis of glucose and lactate According to the manufacturer's instructions, the Agilent 2100 Bioanalyser (Agilent Technologies) was used to analyze glucose and lactate levels in serum (from terminal blood samples) from a mouse population.
[0408] Determination of the effects of macrophage The analysis of the effects of macrocytic glycolysis was based on the previously described protocol (Commisso et al., Nature (2013). Initially, iKRAS cells were grown for 48 hours with or without doxycycline (KRas-on) or doxycycline-free (KRas-off). Cells were then seeded onto glass coverslips in medium with + / - doxycycline and + / - SG. After 24 hours, the medium was replaced with matched medium lacking FBS and incubated for another 16 hours. Finally, the medium was replaced with matched medium containing 10% FBS and tetramethylrhodamine-labeled dextran (TMR-dextran, Thermo Fisher Scientific) particles (0.5 mg / ml). After 30 minutes with dextran, cells were washed with PBS and fixed in 4% formaldehyde. Cells were counterstained with DAPI and green Whole Cell Stain (Thermo Scientific) and mounted in Vectasheild Hardset (Vector Laboratories). Images were captured on an Olympus FV1000 inverted laser scanning confocal microscope and dextran uptake was quantified using ImageJ / Fiji image analysis software.
[0409] Western blotting Western blotting of cells was performed as previously described (Maddocks et al.). Nature , 2013; Labuschagne et al., Cell Rep. , 2014; Maddocks et al., Mol. CellIn short, whole-cell protein lysates were prepared in RIPA buffer supplemented with a complete protease inhibitor (Roche), sodium orthovanadate, and sodium fluoride (both Sigma). Tissue samples were lysed using a TissueLyser II (Qiagen) in RIPA buffer supplemented with a mixture of protease and phosphatase inhibitors (Pierce / Thermo Scientific). Lysates were removed by centrifugation, separated using pre-made 4–12% NuPAGE or Bolt gels (Invitrogen, Life Technologies), and transferred to nitrocellulose membranes. Proteins were detected and quantified using a Li-Cor Odyssey infrared scanner and software (Li-Cor Biosciences). Secondary antibodies for relevant substances were IRDye680 and conjugated IRDye800 (Li-Cor Biosciences). The primary antibodies used were: PHGDH (Sigma Life Science, HPA 021241), PSAT1 (Novus Biologicals, NBP1-32920), PSPH (Santa Cruz, sc-98683), actin I-19-R (Santa-Cruz, sc-1616-R), pERK [phosphate-p44 / p42 MAPK (Erk 1 / 2) (Thr202 / Tyr204)] (Cell Signalling Technology 9101), AMPKa1 (R&D Systems, AF3197), and phosphate-AMPK T172 (Cell Signalling Technology 2535).
[0410] Statistical data Statistical comparisons of survival data were calculated using the Mantel-Cox (log-rank) test and Graphpad Prism (v6) software. T-tests were performed using Microsoft Excel (v14.6.1) or Graphpad Prism (v7). Type 1 / paired (e.g., samples from the same animal) and type 2 / unpaired (e.g., samples from different animals) T-tests were used. In cases where no potential difference direction prediction was made, two-tailed / two-tailed T-tests were used (e.g., across all amino acid levels in serum samples). Figure 1 c / Extended data Figure 2 a). When pre-existing data supports the prediction of the direction of differences between samples, use a one-sided / one-tailed T-test (e.g., de novo serine synthesis). Figure 4c) When the presented data is the mean of a single data point, the error bar is STDEV; when the data is the mean of means, the error bar is SEM. In each case, the type of T-test or error bar is indicated in the legend. When the T-test is performed using multiple comparisons, the p-value is corrected using the Holm-Sidak method with Graphpad Prism (v7) software.
[0411] result Unbiased metabolomics revealed that the most significantly reduced metabolites in Eμ-Myc tumor tissue (spleen with tumor) placed on a -SG diet were serine and glycine, suggesting that this diet specifically reduced tumor levels of serine and glycine. Figure 24 ).
[0412] The effects of the -SG diet on Eμ-myc tumor cells in vivo have been shown to include increased apoptosis (as indicated by increased cleavage of cysteine-3 (CC3)) in some tumors and increased necrosis in others, both of which lead to inhibition or slowing of tumor growth. Figure 25 ).
[0413] The expression of SSP enzyme in tumor tissues from PDAC and Eu-myc models was also analyzed when tumors were grown under control and SG diets. These results indicate that Kras controls SSP in vivo. Figure 26 Furthermore, tumor organoids expressing Kras (3D cell cultures) were observed to be more resistant to serine and glycine starvation, indicating that Kras controls SSP ( Figure 28 ).
[0414] Furthermore, the -SG diet resulted in decreased serine and glycine levels, as well as a reduced GSH / GSSG ratio (a sign of oxidative stress) in Eu-myc tumors (which are sensitive to the -SG diet). However, in PDAC tumors (which carry Kras mutations and are resistant to the diet), the -SG diet did not reduce glycine levels or the GSH / GSSG ratio ( Figure 27 ).
[0415] - The SG diet reduced the growth of xenografted HCT116 tumors that had already formed in the body. Figure 29 a) reduced intratumoral serine and glycine levels ( Figure 29 b). Lower levels of serine and glycine in tumors translated into lower in vitro cancer cell proliferation ( Figure 29 c and Figure 29 d).
[0416] Figure 30The data showed that the ability of Kras (in iKRAS1, iKRAS3, and AK196 cell lines) to acquire serine and glycine could not be explained by micropinocytosis (a form of nutrient clearance), further supporting the idea that Kras-expressing cells acquire additional serine and glycine through de novo serine and glycine synthesis. Macropinocytosis allows cells to capture and utilize extracellular nutrients by phagocytizing extracellular molecules such as proteins, which can be broken down into amino acids. In cultured cells, upregulation of macropinocytosis corresponded to an increase in the uptake of labeled dextran and an increase in dextran staining area % (cells). In all three Kras-inducible cell lines, there was no increase in labeled dextran uptake during serine and glycine starvation, indicating that serine and glycine starvation did not lead to an increase in macropinocytosis.
[0417] Figure 31 a and Figure 31 The data shown in b indicate that daunorubicin (a conventional anticancer agent) works in conjunction with serine and glycine starvation to increase the level of reactive oxygen species in tumor organoids and reduce tumor organoid growth.
[0418] Example 7 ( Figure 32 , Figure 33 , Figure 34 , Figure 35 , Figure 36 , Figure 37 , Figure 38 , Figure 39 , Figure 40 ) method Cell lines and cell cultures HCT116, SW480, MDA-MB-231, Panc10.05, CFPAC-1, SW1990, BxPC-3, AsPC-1, PANC-1, MIA, and PaCa-2 cells were originally obtained from ATCC and subsequently validated using Promega GenePrint 10. Breast cancer and colorectal cancer cells were grown in DMEM (Gibco-21969) supplemented with 10% FBS (10270) to a final concentration of 2 mM, containing L-glutamine-containing penicillin-streptomycin and amphotericin B. Pancreatic cancer cell lines were grown in RPMI-1640 (Gibco-31870) medium supplemented with 10% FBS (10270) to a final concentration of 2 mM, containing L-glutamine-containing penicillin-streptomycin and amphotericin B, and insulin-transferrin selenium solution (Gibco) 1:500. Cells were kept in an incubator at 37°C and humidified with 5% CO2. Routine mycoplasma testing was performed on the cultured cells using the Mycoalert assay kit (Lonza).
[0419] Guide RNA for missing MTAP and non-targeted controls MTAP_gRNA_1F sequence - CACCGGTTTTGCCCCAAAACGAGAG MTAP_gRNA_1R sequence - AAACCTCTCGTTTTGGGGCAAAACC MTAP_gRNA_2F sequence II CACCGGCCTGGTAGTTGACCTTTGA MTAP_gRNA_2R sequence II AAACTCAAAGGTCAACTACCAGGCC NTC_gRNA_1F CACCGAAAATAGCAGTAAACTCAAC NTC_gRNA_1R AAACGTTGAGTTTACTGCTATTTTC According to Ran et al. (2013), gRNA sequences are used together with scaffold RNA to prepare sgRNA.
[0420] Proliferation assay Cells (4 x 10^4 - 1 x 10^5) were seeded in complete RPMI or DMEM medium in 24-well plates and allowed to adhere overnight. Cells were then washed with PBS and subjected to assay medium supplemented with the stated amino acids / metabolites / drugs. Assay medium was prepared based on RPMI-1640 medium but lacking amino acids, which were added separately according to the assay. The assay medium was also supplemented with... Additional vitamin B6 (20 uM) is provided, which is a cofactor for cysteine synthesis. Cells were counted at the stated time points (using a Casy TT cell counter, Innovatis, Roche Applied Science), and the relative cell number since the change in culture medium was calculated using a "time = 0" plate.
[0421] Microscopy The images were captured using a Zeiss optical microscope at 20x magnification, coupled with a Zeiss Axiocam digital camera with Zeiss Zen software.
[0422] Liquid chromatography-mass spectrometry (LCMS) Cells were grown in assay medium supplemented with the stated amino acids / metabolites. Universally labeled C-13 methionine was purchased from Cambridge Isotopes / CKGas. Cell extracts and medium samples were prepared in a cold (-20°C) lysis solvent (LS) consisting of methanol, acetonitrile, and H₂O (50:30:20). Lysates were equilibrated based on cell number by counting replicate wells prior to lysis. Protein precipitation was allowed after the addition of LS to the cell / medium samples and removed by centrifugation. Extracts were analyzed on an LCMS platform consisting of an Accela 600 LC system and a precision mass spectrometer (Thermo Scientific). Chromatography employed a ZIC-HILIC column (4.6 mm x 150 mm, 3.5 μm) (Merck), with the mobile phase consisting of A = water with 0.1% formic acid (v / v) and B = acetonitrile with 0.1% formic acid. A gradient program was used, starting at 20% A and linearly increasing to 80% at 30 min, followed by washing and reequilibration steps. Method 2 had a total run time of 46 minutes. The LC stream was desolvated and ionized in a HESI probe. A precision mass spectrometer was operated in full scan mode with a resolution of 50,000 m / s in the mass range of 75–1,000 m / s and polarity switching. The raw data were analyzed for the identification and quantification of metabolites using LCquan (Thermo Scientific) and MZMine 2.10.
[0423] Western blotting Whole-cell protein lysates were prepared in RIPA buffer (Pierce / Thermo Scientific) supplemented with a mixture of protease and phosphate inhibitors. Lysates were removed by centrifugation, separated using pre-prepared 4–12% "Bolt" gels (Invitrogen, Life Technologies), and transferred to nitrocellulose membranes. Proteins were detected and quantified using a Li-Cor Odyssey infrared scanner and software (Li-Cor Biosciences). Secondary antibodies for relevant substances were IRDye680 and conjugated IRDye800 (Li-Cor Biosciences). The primary antibody used was rabbit anti-MTAP (Abcam).
[0424] Data Display The data is plotted as an average, accompanied by error bars showing the standard deviation.
[0425] Overview of cysteine synthesis ( Figure 32 ) Cysteine synthesis begins with the essential amino acid methionine, which is converted to cysteine via multiple enzymatic steps. Polyamines are key molecules for cell growth and proliferation, and polyamine synthesis has been found to be upregulated in cancer. Polyamine synthesis requires the methionine-derived metabolite dcSAM, which is converted to MTA during polyamine (spermine and spermidine) synthesis. MTA can be recycled back to methionine via a multi-step enzymatic pathway involving methylthioadenosine phosphorylase (MTAP). When MTAP is present, the recycling of MTA produced during polyamine synthesis provides efficient utilization of methionine. However, when MTAP is absent (as often occurs in cancer), MTA cannot be recycled back to methionine and is released from the cell. This means that a constant supply of methionine is converted to MTA and expelled from the cell. This continuous shift of methionine to polyamine synthesis prevents methionine from being utilized for other purposes, such as cysteine synthesis.
[0426] result We have found that all the cancer cell lines we have tested are sensitive to cysteine deprivation to some extent. Notably, certain cell lines, such as MDA-MB-231, have been found to be extremely sensitive to cysteine starvation, which leads to rapid cell death. Figure 33 , Figure 40 Nutrient deprivation (such as amino acid starvation) usually slows proliferation but does not necessarily lead to severe cell death, so we investigated why certain cell lines are highly sensitive to it.
[0427] Although cysteine starvation has been previously reported to be detrimental to cancer cells, and this sensitivity may be due to the inactivation of genes involved in cysteine synthesis (e.g., methylation of the CBS gene), our results surprisingly show that supplementing cells with a metabolic precursor (homocysteine) upstream of CBS achieves a significant rescue from cysteine starvation. Figure 39 This indicates that the enzymes used for cysteine synthesis are present and active, but there is a problem regarding the supply of upstream precursors (such as homocysteine) for cysteine synthesis.
[0428] Although it has been proposed that the expression of enzymes involved in de novo cysteine synthesis, particularly CBS and CTH, can determine sensitivity to cysteine starvation, we surprisingly found that the cells most sensitive to cysteine starvation were those that effluxed the methionine-derived metabolite MTA. Figure 33 , Figure 34 , Figure 36 , Figure 32 MTA efflux is strongly correlated with severe sensitivity to cysteine starvation. Figure 33 , Figure 39 , Figure 36MTA efflux is caused by the inactivation or deletion of the gene encoding the enzyme MTAP. Figure 37 The function of MTAP is to recycle MTA back to methionine, thereby providing efficient methionine metabolism. Figure 34 , Figure 35 In the absence of MTA, a large amount of methionine is diverted to the polyamine pathway, and not to the cysteine synthesis pathway. Figure 34 Consistent with this finding, inhibition of AMD1 (an enzyme that diverts methionine-derived SAM to the polyamine synthesis pathway) protects cells from severe sensitivity to cysteine starvation (i.e., cell death). Figure 40 ).
[0429] In the context of dietary therapy for cancer; according to our in vitro studies, most cancer cell lines are sensitive to cysteine starvation, but a subset is particularly sensitive ( Figure 33 Our study shows that loss of MTAP expression is strongly associated with severe sensitivity to cysteine starvation. Figure 33 Cells lacking MTAP exhibit a diversion of metabolic precursors upstream of cysteine synthesis. Figure 34 MTAP is typically absent or inactivated in cancer / tumor cells (Bertino et al., 2011). Our findings suggest that tumors lacking MTAP expression will be particularly sensitive to cysteine starvation.
[0430] Throughout the description and claims of this specification, the words “comprising” and “including”, and variations thereof, mean “including but not limited to,” and they are not intended (and do not) exclude other parts, additions, components, integers, or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. Specifically, when using indefinite articles, it should be understood that this specification contemplates both multiples and single entities unless the context requires otherwise.
[0431] The features, integers, properties, compounds, chemical parts, or groups described in connection with a particular aspect, embodiment, or example of the invention should be understood to be applicable to any other aspect, embodiment, or example described herein, unless incompatible with that aspect, embodiment, or example. All features disclosed in this specification (including any appended claims, abstract, and drawings) and / or all steps of any method or process thus disclosed may be combined in any combination, except for at least some mutually exclusive combinations of such features and / or steps. The invention is not limited to the details of any of the foregoing embodiments. The invention extends to any novel feature or any novel combination of features disclosed in this specification (including any appended claims, abstract, and drawings), or any novel step or any novel combination of steps of any method or process thus disclosed.
[0432] The reader’s attention is directed to all papers and documents related to this application that were submitted concurrently with or prior to this specification and that are publicly available for consultation, and the contents of all such papers and documents are incorporated herein by reference.
[0433] This application also involves the following items: 1. A dietary product comprising a plurality of amino acids, wherein the dietary product contains all essential amino acids, and wherein the dietary product is substantially deficient in at least two non-essential amino acids.
[0434] 2. The dietary product according to Project 1, wherein the dietary product contains at least 12 amino acids.
[0435] 3. The dietary products according to items 1 to 2, wherein at least one of the substantially lacking non-essential amino acids is selected from the group consisting of glycine, serine, cysteine, tyrosine and arginine.
[0436] 4. The dietary product according to any one of items 1 to 3, wherein the at least two substantially deficient non-essential amino acids comprise two or more of the following amino acids: glycine, serine, cysteine, tyrosine, and arginine.
[0437] 5. The dietary product according to any one of the foregoing items, wherein the dietary product substantially lacks: a. Glycine, serine, and cysteine; b. Glycine, serine, and arginine; c. Glycine, serine, and tyrosine; d. Glycine, serine, arginine, and cysteine; e. Glycine, serine, tyrosine, and cysteine; f. Cysteine and arginine; g. Cysteine and tyrosine; h. Cysteine and glycine; i. Cysteine, tyrosine, and arginine; or j. Glycine, serine, arginine, tyrosine, and cysteine.
[0438] 6. The dietary product according to any one of the preceding items, wherein the dietary product further comprises one or more macronutrients and / or one or more micronutrients.
[0439] 7. The dietary product according to any one of the preceding items, wherein the dietary product further contains methionine at a level of less than 25 mg / kg / day.
[0440] 8. The dietary product according to any one of the preceding items, wherein the product is formulated to provide at least the recommended daily intake of essential amino acids based on average daily total protein consumption.
[0441] 9. The dietary product according to any one of the preceding items, wherein the dietary product is in the form of a solid or beverage.
[0442] 10. A process for preparing a dietary product according to any one of the preceding items, wherein the components are dissolved or dispersed in water and spray-dried.
[0443] 11. A pharmaceutical composition comprising a dietary product according to any one of items 1 to 9 or a dietary product produced according to item 10, and a pharmaceutically acceptable carrier, excipient, or diluent.
[0444] 12. The pharmaceutical composition according to item 11, wherein the composition further comprises a therapeutic agent selected from the group consisting of cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0445] 13. The pharmaceutical composition according to item 11 or 12, wherein the therapeutic agent inhibits OXPHOS and / or increases reactive oxygen species and / or reduces antioxidant defense.
[0446] 14. The dietary product according to any one of items 1 to 9, or the dietary product produced according to item 10, or the composition according to any one of items 11 to 13, for use in a therapeutic manner.
[0447] 15. A dietary product according to any one of items 1 to 9, or a dietary product produced according to item 10, or a composition according to any one of items 11 to 13, for use in cancer treatment.
[0448] 16. The dietary product for use according to Item 15, wherein the cancer is selected from the group consisting of colorectal cancer, liver cancer, osteosarcoma, lung cancer, lymphoma and breast cancer.
[0449] 17. A dietary product for use according to item 15 or item 16, wherein the cancer is positive for wild-type KRAS.
[0450] 18. A dietary product for use according to any one of items 15 to 17, wherein the cancer has deregulated cMyc expression.
[0451] 19. A dietary product for use according to any one of items 15 to 18, wherein MTAP expression has been downregulated in the cancer.
[0452] 20. A dietary product for use according to any one of items 15 to 19, wherein the dietary product is substantially deficient in serine and / or glycine.
[0453] 21. A dietary product for use according to any one of items 15 to 20, wherein the dietary product is used in combination with a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0454] 22. The dietary product for use according to item 21, wherein the therapeutic agent inhibits OXPHOS and / or increases reactive oxygen species and / or reduces antioxidant defense.
[0455] 23. Use of the dietary product according to any one of items 1 to 9, or the dietary product produced according to item 10, or the composition according to any one of items 11 to 13, in the preparation of a medicament for the treatment of cancer.
[0456] 24. According to the use described in item 23, the cancer is selected from the group consisting of colorectal cancer, liver cancer, lung cancer, lymphoma, osteosarcoma and breast cancer.
[0457] 25. As described in item 22 or item 23, wherein the cancer is positive for wild-type KRAS.
[0458] 26. The use according to any one of items 22 to 24, wherein the cancer has deregulated cMyc expression.
[0459] 27. The use according to any one of items 22 to 26, wherein the dietary product is substantially deficient in serine and / or glycine.
[0460] 28. The use according to any one of items 22 to 27, wherein the dietary product is used in combination with a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents and chemotherapy agents.
[0461] 29. The use as described in item 28, wherein the therapeutic agent inhibits OXPHOS and / or increases reactive oxygen species and / or reduces antioxidant defense.
[0462] 30. A method of treating cancer in a subject, comprising administering a therapeutically effective amount of a dietary product according to any one of items 1 to 9, or a dietary product produced according to item 10, or a composition according to any one of items 11 to 13.
[0463] 31. The method according to Item 30, wherein the cancer is selected from the group consisting of colorectal cancer, liver cancer, lung cancer, osteosarcoma, lymphoma and breast cancer.
[0464] 32. The method according to item 30, wherein the cancer is positive for wild-type KRAS.
[0465] 33. The method described in Project 30, wherein the cancer has deregulated cMyc expression.
[0466] 34. The method described in Project 30, wherein the cancer has downregulated MTAP expression.
[0467] 35. The method according to item 30, wherein the dietary product is substantially deficient in serine and / or glycine.
[0468] 36. The method of claim 30, wherein the dietary product is used in combination with a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and chemotherapy agents.
[0469] 37. The method according to item 36, wherein the therapeutic agent inhibits OXPHOS and / or increases reactive oxygen species.
[0470] 38. The method according to Project 30, wherein the dietary product is the sole source of nutrition for the subject.
[0471] 39. The method according to item 30, wherein the treatment is administered over a period of at least 24 hours or until the treatment endpoint is observed.
[0472] 40. The method according to item 30, wherein the dietary product is applied between once and six times a day.
[0473] 41. The method according to item 40, wherein the recommended daily amount of essential amino acids is met by a daily administration regimen.
[0474] 42. Use of KRAS or MTAP as biomarkers to identify patients or patient populations that respond to or are sensitive to cancer treatments, which include a diet that is substantially serine-deficient.
[0475] 43. According to the use described in item 42, the cancer treatment includes a diet that is substantially deficient in serine and glycine.
[0476] 44. The use as described in item 42 or item 43, wherein the cancer treatment further comprises administering a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and / or chemotherapy agents.
[0477] 45. A method for identifying subjects with a reduced likelihood of response or sensitivity to cancer treatment, said cancer treatment comprising a diet substantially deficient in serine, the method comprising: a) Determine the expression or activity level of Kras in biological samples isolated from the subject; b) Compare the expression or activity level of Kras in the biological sample with a control sample or a predetermined reference level of Kras expression or activity. The level of increased Kras expression or activity in the biological sample compared to the control sample or the predetermined reference level indicates non-responsiveness or insensitivity to the cancer treatment.
[0478] 46. A method for identifying subjects with an increased likelihood of response or sensitivity to cancer treatment, said cancer treatment comprising a diet substantially deficient in serine, said method comprising: a) Determine the level of Kras expression or activity in biological samples isolated from the subject; b) Compare the level of Kras expression or activity in the biological sample with a control sample or a predetermined reference level of Kras expression or activity. The level at which Kras expression or activity in the biological sample is reduced compared to the control sample or the predetermined reference level, or the level of Kras expression or activity is substantially the same as that in the control sample or the predetermined reference level, indicates the responsiveness or sensitivity to the cancer treatment.
[0479] 47. A method for identifying subjects who may benefit from cancer treatment, said cancer treatment comprising a diet substantially deficient in serine, said method comprising: a) Determine the level of Kras expression or activity in biological samples isolated from the subject; b) Compare the level of Kras expression or activity in the biological sample with a control sample or a predetermined reference level of Kras expression or activity. The level at which Kras expression or activity in the biological sample is reduced compared to the control sample or the predetermined reference level, or the level of Kras expression or activity is substantially the same as that in the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment.
[0480] 48. A method for identifying subjects with an increased likelihood of responsiveness or sensitivity to cancer treatment, said cancer treatment comprising i) a diet substantially deficient in serine and / or ii) having restrictive levels of cysteine, said method comprising: a) Determine the expression or activity level of MTAP in biological samples isolated from the subject; b) Compare the expression or activity level of MTAP in the biological sample with a control sample or a predetermined reference level of MTAP expression or activity. The level at which the expression or activity of MTAP in the biological sample is reduced compared to the control sample or the predetermined reference level, or the level of expression or activity of MTAP that is substantially the same as that in the control sample or the predetermined reference level, indicates the responsiveness or sensitivity to the cancer treatment.
[0481] 49. A method for identifying subjects who may benefit from cancer treatment comprising i) a diet substantially deficient in serine and / or ii) having restrictive levels of cysteine, the method comprising: a) Determine the level of expression or activity in biological samples isolated from the subject; b) Compare the expression or activity level of MTAP in the biological sample with a control sample or a predetermined reference level of MTAP expression or activity. The level at which the expression or activity of MTAP in the biological sample is reduced compared to the control sample or the predetermined reference level, or the level of expression or activity of MTAP that is substantially the same as that in the control sample or the predetermined reference level, indicates that the patient may benefit from the cancer treatment.
[0482] 50. The method according to items 45 to 49, wherein the biological sample is a cancer cell or cancerous tissue.
[0483] 51. The method according to item 50, wherein the control sample is a normal cell or tissue sample.
[0484] 52. The method according to item 51, wherein the normal cell or tissue sample is a cell or tissue of the same type as the cancer cell or cancerous tissue.
[0485] 53. A method for treating a subject with cancer, comprising: a) Determine whether the levels of Kras and / or MTAP expression or activity in biological samples isolated from the subjects indicate responsiveness or sensitivity to cancer treatments including diets that are substantially serine-deficient; and b) Administering cancer treatment to the subject, wherein the expression or activity levels of Kras and / or MTAP in the biological sample indicate responsiveness or sensitivity to the cancer treatment.
[0486] 54. The method described in Project 49, wherein the cancer treatment comprises a diet substantially lacking serine and glycine.
[0487] 55. The method according to item 53 or 54, wherein the cancer treatment further comprises administering a therapeutic agent selected from: cancer cell growth inhibitors, radiotherapy agents, and / or chemotherapy agents.
[0488] 56. The method according to any one of items 53 to 55, wherein determining whether the level of Kras expression or activity in a biological sample isolated from said subject indicates responsiveness or sensitivity to cancer treatment comprising a diet substantially lacking serine comprises: a) Determine the level of Kras expression or activity in biological samples isolated from the subject; b) Compare the level of Kras expression or activity in the biological sample with a control sample or a predetermined reference level of Kras expression or activity. The level of increased Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level indicates the subject's non-responsiveness or insensitivity to the cancer treatment, and the level of decreased Kras expression or activity in the biological sample compared to a control sample or a predetermined reference level, or the Kras expression or activity level being substantially the same as that of a control sample or a predetermined reference level, indicates the subject's responsiveness or sensitivity to the cancer treatment.
[0489] 57. The method according to any one of items 53 to 56, wherein determining whether the level of MTAP expression or activity in a biological sample isolated from said subject indicates responsiveness or sensitivity to cancer treatment comprising a diet substantially lacking serine comprises: a) Determine the expression or activity level of MTAP in biological samples isolated from the subject; b) Compare the expression or activity level of MTAP in the biological sample with a control sample or a predetermined reference level of MTAP expression or activity. The level at which the expression or activity of MTAP in the biological sample is reduced compared to a control sample or a predetermined reference level, or the level of expression or activity of MTAP is substantially the same as that in a control sample or a predetermined reference level, indicates the subject's responsiveness or sensitivity to the cancer treatment.
[0490] 58. A kit for use in identifying subjects who will benefit from cancer treatment comprising a diet substantially deficient in serine, the kit comprising: a. Agents used to determine the expression or activity of Kras; and b. Reagents used for the determination.
[0491] 59. The kit according to item 53, the kit further comprising the following description: that the level of increased expression or activity of Kras in the biological sample compared to a control sample or a predetermined reference level indicates the subject's non-responsiveness or insensitivity to the cancer treatment, and wherein the level of decreased expression or activity of Kras in the biological sample compared to the control sample or a predetermined reference level, or the level of Kras expression or activity substantially the same as that of the control sample or the predetermined reference level, indicates the subject's responsiveness or sensitivity to the cancer treatment.
[0492] 60. The kit according to item 58 or 59, wherein the kit contains an agent for determining the expression or activity of MTAP.
[0493] 61. A kit for use in identifying subjects who will benefit from cancer treatment comprising a diet substantially deficient in serine, the kit comprising: a. Agents used to determine the expression or activity of MTAP; and b. Reagents used for the determination.
[0494] 62. The dietary product according to Item 1, the dietary product being described in accordance with the instruction manual and accompanying drawings, and substantially as described herein.
[0495] 63. The pharmaceutical composition according to item 11, wherein the pharmaceutical composition is substantially as described herein with reference to the instructions and drawings.
[0496] 64. The dietary product for use according to item 15, or the use according to item 23, or the treatment method according to item 25 or item 53, with reference to the instructions and drawings, are substantially as described herein.
[0497] 65. The use of KRAS or MTAP as biomarkers is described herein in the reference instructions and figures.
[0498] References
[0499]
Claims
1. A dietary product comprising a plurality of amino acids, wherein the dietary product contains all essential amino acids, and wherein the dietary product is substantially deficient in at least two non-essential amino acids.
2. The dietary product according to claim 1, wherein the dietary product contains at least 12 amino acids.
3. The dietary product according to claims 1 to 2, wherein at least one of the substantially lacking non-essential amino acids is selected from the group consisting of glycine, serine, cysteine, tyrosine, and arginine.
4. The dietary product according to any one of claims 1 to 3, wherein the at least two substantially deficient non-essential amino acids comprise two or more of the following amino acids: glycine, serine, cysteine, tyrosine, and arginine.
5. The dietary product according to any one of the preceding claims, wherein the dietary product substantially lacks: a. Glycine, serine, and cysteine; b. Glycine, serine, and arginine; c. Glycine, serine, and tyrosine; d. Glycine, serine, arginine, and cysteine; e. Glycine, serine, tyrosine, and cysteine; f. Cysteine and arginine; g. Cysteine and tyrosine; h. Cysteine and glycine; i. Cysteine, tyrosine, and arginine; or j. Glycine, serine, arginine, tyrosine, and cysteine.
6. The dietary product according to any one of the preceding claims, wherein the dietary product further comprises one or more macronutrients and / or one or more micronutrients.
7. The dietary product according to any one of the preceding claims, wherein the dietary product further comprises methionine at a level of less than 25 mg / kg / day.
8. The dietary product according to any one of the preceding claims, wherein the product is formulated to provide at least the recommended daily intake of essential amino acids based on average daily total protein consumption.
9. The dietary product according to any one of the preceding claims, wherein the dietary product is in the form of a solid or a beverage.
10. A process for preparing a dietary product according to any one of the preceding claims, wherein the components are dissolved or dispersed in water and spray-dried.
Citation Information
Patent Citations
Materials and method for treating or preventing pathogenic fungal infection
WO1998002441A2
28-epirapalogs
WO2001014387A1
Imidazo[4,5-b]pyridin-2-one and oxazolo[4,5-b]pyridin-2-one compounds and analogs thereof as therapeutic compounds
WO2006043090A1
Pyrido[2,3-b]pyrazine-8-substituted compounds and their use
WO2009077766A1
1-(5-TERT-butyl-2-phenyl-2h-pyrazol-3-YL)-3-[2-fluoro-4-(1-methyl-2-OXO-2,3-dihydro-1h-imidazo[4,5-b]pyridin-7-yloxy)-phenyl]-urea and related compounds and their use in therapy
WO2011092469A1