Application of berberine in the preparation of drugs for treating asthma

By targeting Ezrin protein with berberine, airway smooth muscle is relaxed, which solves the problem of insufficient regulation of airway smooth muscle cell function in existing asthma treatments, and achieves effective relief of asthma symptoms and improvement of ventilation function.

CN122124043APending Publication Date: 2026-06-02SHANGHAI HOSPITAL OF TRADITIONAL CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing asthma treatments have failed to adequately target the functional regulation of airway smooth muscle cells, particularly with insufficient intervention in their cytoskeleton remodeling and contractile protein activation. This results in some patients having poor symptom control, a high risk of acute exacerbations, and limited efficacy in treating refractory asthma.

Method used

Berberrubine chloride is used to target actin-binding protein Ezrin, relax airway smooth muscle, relieve airway resistance in asthma patients, and improve ventilation function.

Benefits of technology

Berberine can effectively target Ezrin, inhibit the contraction of airway smooth muscle cells, significantly relax airway smooth muscle, and improve asthma symptoms, showing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124043A_ABST
    Figure CN122124043A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical technology, and specifically relates to the application of berberine in the preparation of drugs for treating asthma. This invention, through experimental demonstration, reveals for the first time that berberine can effectively target the actin-binding protein Ezrin and has a significant function in relaxing airway smooth muscle, making it suitable for the preparation of drugs for treating asthma and possessing broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of berberine in the preparation of drugs for treating asthma. Background Technology

[0002] Airway smooth muscle cells, as key effector cells in the pathological process of asthma, directly participate in the pathophysiological processes of acute asthma exacerbations and chronic airway obstruction by mediating airway hyperresponsiveness and hyperconstriction. Promoting their relaxation and reducing their abnormal tension is one of the classic treatment strategies for relieving airway resistance and improving ventilation in asthma patients.

[0003] Significant progress has been made in the treatment of asthma, with some treatment regimens becoming quite mature. Inhaled corticosteroids are a common medication for treating asthma. Biologics targeting specific inflammatory pathways (such as IgE, IL-4 / IL-13, and IL-5) such as omalizumab and dupilumab also have some effect in treating asthma. Their mechanisms of action mainly focus on inhibiting inflammatory responses, reducing inflammatory cell infiltration, or blocking specific immune mediators.

[0004] While these therapies can effectively control symptoms in some patients, they fail to fully and directly target the functional regulation mechanisms of airway smooth muscle cells themselves, particularly lacking precise intervention in the regulation of their cytoskeleton remodeling, contractile protein activation, and mechanobiological behavior. This limitation in treatment results in a significant proportion of patients still experiencing unsatisfactory symptom control, a persistent risk of acute exacerbations, and limited efficacy for refractory asthma characterized by airway remodeling.

[0005] Against this backdrop, Ezrin, a highly conserved actin-binding protein, has attracted increasing attention for its potential therapeutic value. Ezrin belongs to the Ezrin / Radixin / Moesin (ERM) protein family and is one of the most extensively studied members within this family. It is a key multi-domain cytoskeleton regulator with distinctive molecular structural features: one end consists of an N-terminal B4.1 (band 4.1) homolog and an ERM domain (i.e., the FERM domain), which is primarily responsible for specifically binding to various transmembrane proteins (such as adhesion molecules and receptors) and phospholipid molecules on the cell membrane, thereby anchoring the protein to the inner side of the cell membrane; the middle part is an extended central α-helical domain, which has coiled-coil properties and can interact intramolecularly with the C-terminal domain when the molecule is inactive, thus masking the key binding site; the other end is a C-terminal ERMAD domain (C-ERM association domain), which contains an actin binding site and can directly bind to the filamentous actin (F-actin) cytoplasmic skeletal network. Ezrin's core biological function lies in acting as a dynamic "molecular bridge." It binds to the plasma membrane through its FERM domain and connects to the cortical actin cytoskeleton through its C-ERMAD domain, thereby achieving physical coupling and signal transduction between the plasma membrane and the cytoskeleton. This connection is strictly regulated by post-translational modifications such as phosphorylation and lipid binding, determining cell morphological stability, membrane protrusion formation, cell polarity, and migration ability. Particularly in myogenic cells, it plays a crucial regulatory role in the generation and maintenance of cell contractile tension.

[0006] In recent years, a growing body of research has suggested that Ezrin plays a central role in regulating the mechanical properties and contractile function of airway smooth muscle cells. Airway smooth muscle contraction involves a series of complex events, including myosin light chain phosphorylation, actin-myosin cross-bridge cycling, and cytoskeleton remodeling. Ezrin is positioned at a critical juncture in integrating membrane receptor signaling and cytoskeleton remodeling. It may influence the contractile force and duration of smooth muscle cells by regulating the assembly of cortical actin, affecting the spatial organization of contractile units, or mediating the transmission of mechanical signals from the cell membrane to the cell interior.

[0007] Therefore, providing a drug that uses Ezrin as a receptor target protein and can relax airway smooth muscle and improve asthma may become a new treatment option for asthma. Summary of the Invention

[0008] To provide a new treatment option for asthma, this invention provides the use of berberine in the preparation of medicaments for treating asthma.

[0009] The objective of this invention can be achieved through the following technical solutions: The first objective of this invention is to provide the use of berberine in the preparation of a medicament for treating asthma, the chemical structural formula of which is shown in formula (I): Formula (I).

[0010] In this invention, berberine chloride (BRB, CID: 72703) has the molecular formula C 19 H 16 ClNO4, with a molecular weight of 357.79, is a yellow to reddish-brown powder, slightly soluble in water. Its name, as defined by the International Union of Pure and Applied Chemistry (IUPAC), is: 17-methoxy-5,7-dioxa-13-azoniapentacyclo[11.8.0.0 2,10 .0 4,8 .0 15,20 ]henicosa-1(13),2,4(8),9,14,16,18,20-octaen-16-ol;chloride.

[0011] The Chinese name of the berberine mentioned is: 17-Methoxy-5,7-dioxa-13-aza-onium pentacyclic [11.8.0.0] 2,10 .0 4,8 .0 15,20 ] Twenty-one carbon-1(13),2,4(8),9,14,16,18,20-octaen-16-ol; chlorination.

[0012] In some embodiments of the present invention, the drug is a drug capable of relaxing airway smooth muscle.

[0013] In some embodiments of the present invention, the berberine relaxes airway smooth muscle by targeting actin-binding protein Ezrin.

[0014] In some embodiments of the present invention, the drug is a drug that relieves airway resistance and improves ventilation in asthma patients.

[0015] In some embodiments of the present invention, the drug contains pharmaceutically acceptable excipients.

[0016] In some embodiments of the present invention, the pharmaceutically acceptable excipients are various pharmaceutically commonly used excipients and / or excipients, including but not limited to sugars (such as lactose, glucose, and sucrose), starches (such as corn starch and potato starch), cellulose and its derivatives (such as sodium carboxymethyl cellulose, ethyl cellulose, and methyl cellulose), tragacanth powder, malt, gelatin, talc, solid lubricants (such as stearic acid and magnesium stearate), calcium sulfate, vegetable oils (such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter), polyols (such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol), alginic acid, emulsifiers (such as Tween and polyoxyethylene castor oil), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, tableting agents, stabilizers, antioxidants, preservatives, pyrogen-free water, isotonic salt solutions, physiological saline, or phosphate buffer solutions, etc.; the carrier can improve the stability, activity, and bioavailability of the formulation as needed.

[0017] In some embodiments of the present invention, pharmaceutically acceptable excipients are phosphate buffer or physiological saline. Preferably, the pH of the phosphate buffer solution is 7.2 to 7.4.

[0018] In some embodiments of the present invention, the medicament may also contain other drugs for treating asthma.

[0019] In some embodiments of the present invention, the dosage form of the drug is selected from oral dosage forms, injectable dosage forms, external dosage forms, or inhaled sprays.

[0020] Preferably, the dosage form of the drug is an inhalation spray.

[0021] In some embodiments of the present invention, the drug contains ester derivatives or phenolic derivatives of berberine.

[0022] Compared with the prior art, the present invention has the following beneficial effects: This invention reveals for the first time through experiments that berberine can effectively target actin-binding protein Ezrin and has significant functions in inhibiting airway smooth muscle cell contraction and relaxing airway smooth muscle. It can be used to prepare drugs for treating asthma and has broad application prospects. Attached Figure Description

[0023] Figure 1 A schematic diagram showing the screening results of natural products targeting the Ezrin protein; Figure 2 A schematic diagram illustrating the binding of berberine to Ezrin protein; Figure 3 A schematic diagram illustrating the effect of berberine on respiratory function in asthmatic mice; Figure 4A schematic diagram illustrating the effects of berberine on the contraction and relaxation of smooth muscle cells in the human airway; Figure 5 A schematic diagram illustrating the validation of berberine's specific targeting of Ezrin; Figure 6 A schematic diagram illustrating the regulatory mechanism of berberine on human airway smooth muscle cells; Figure 7 The fitted curve of the median effect concentration (EC50) of berberine on the relaxation effect of human airway smooth muscle cells; Figure 8 The figure shows the fitted curve of the median inhibition concentration (IC50) of berberine on the activity of human airway smooth muscle cells. Detailed Implementation

[0024] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0025] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention in the following embodiments all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; the series *METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATIN STRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0026] The berberine used in this embodiment of the invention: compound (CID: 72703), can be found and purchased directly from the TargetMol database (https: / / www.targetmol.cn / ) (https: / / www.targetmol.cn / compound / berberrubine%20chloride). For ease of description, berberine will be referred to as BRB below.

[0027] Example 1 This embodiment uses protein thermal migration experiments to screen compounds from a library of traditional Chinese medicine monomer compounds that have a strong binding ability to Ezrin.

[0028] The experimental materials and instruments involved in this embodiment are as follows: PTS dye (Protein Thermal Shift) TM Dye), 96-well plate, Applied Biosystems QuantStudio 6 Flex real-time fluorescence quantitative PCR instrument; The experimental procedure involved in this embodiment is as follows: (1) Take a 96-well plate and set up three blank control replicates. Each well contains 10 μM Ezrin, 5×SYPRO orange dye, and 200 μM DMSO. Adjust the volume to 20 μL with protein storage solution.

[0029] (2) Set up one experimental well for each compound. Each well contains 10 μM Ezrin, 5×SYPRO orange dye, and 200 μM compound. Adjust the volume to 20 μL with protein storage solution.

[0030] (3) After sealing the 96-well plate, centrifuge at 2000 rpm for 15 s using a floor centrifuge to mix the contents. Real-time fluorescence monitoring is performed using a quantitative real-time PCR instrument with programmed temperature rise. If the addition of the compound causes a change of more than 2 °C in the protein melting temperature (Tm), it indicates that the compound is bound to the protein.

[0031] The results showed that four natural products—berberrubine chloride (BRB), soyasaponin Bb, sanguinarine, and chelerythrine—bound to Ezrin, with thermal migration values ​​of 7.24, 4.89, 4.13, and 2.53 °C, respectively; and BRB exhibited the strongest binding affinity to Ezrin. Figure 1 ).

[0032] Example 2 This embodiment provides further investigation into the effective combination of BRB and Ezrin as initially screened in Example 1 (using surface plasmon resonance technology).

[0033] The experimental materials and instruments involved in this embodiment are as follows: Biacore (General Electric, X100), benchtop microcentrifuge (Beckman Coulter, Microfuge 22R), Sensor Chip CM5 (Cytiva, BR100530), HBS-EP buffer (Cytiva, BR1006-69), sodium acetate (Cytiva, BR-1003), amino coupling kit (Cytiva, BR100050), DMSO (Sigma, 20-139); The experimental procedure involved in this embodiment is as follows: (1) Using the standard amine coupling protocol provided by the manufacturer, the ligand protein Ezrin to be coupled was diluted to a final concentration of 50 ng / μL with sodium acetate at different pH values ​​(4.0, 4.5, 5.0, 5.5); (2) Dilute the small molecule compound (BRB) to be analyzed to five concentrations of 125 nM, 62.5 nM, 31.25 nM, 15.625 nM and 7.8125 nM respectively with HBS-EP working solution (1×) and place them on ice for later use; (3) Insert the CM5 chip into the microfluidic chamber, turn on the Biacore X100 and set the pre-enrichment parameters, inject for 120s, dissociate for 60s, and the flow rate is 10μL / min; (4) Place the ligand protein Ezrin and 50mM NaOH elution buffer sequentially on the sample rack to pre-enrich the ligand protein and determine the optimal coupling pH value of the CM5 chip. (5) Dilute the ligand protein Ezrin with sodium acetate at the optimal pH to a final concentration of 50 ng / μL for later use; (6) Add 120 μL of 0.4 M 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (C8H) 17 Mix N3 (EDC) and 120 μL of 0.1 M N-hydroxysuccinimide (C4H5NO3, NHS) and set aside. (7) Prepare 120 μL of 0.1 M ethanolamine (C2H7NO) for later use; (8) Set the coupling parameters, select amino coupling (Amine), set "flow1" as the reference channel, set "flow2" as the analytical protein channel, coupling time 1080s, injection flow rate 10μL / min; put the ligand protein Ezrin, EDC / NHS mixture and ethanolamine into the sample tray in sequence, and start coupling; after successful coupling, set the interaction parameters, binding 60s, dissociation 60s, flow rate 30μL / min; (9) Place the prepared small molecule compounds and regeneration solutions of different concentrations on the sample rack in sequence and start the experiment; analyze protein interactions using Kinetics.

[0034] The results showed that BRB and Ezrin could bind effectively, with an equilibrium dissociation constant KD of 5.1 μM. Figure 2 ).

[0035] Example 3 This embodiment provides an investigation into the ability of BRB to improve airway resistance in mice using a small animal lung function testing system.

[0036] The experimental subjects, reagents, and instruments involved in this embodiment are as follows: Experimental subjects: C57BL / 6J mice; Experimental reagents and instruments: Small animal lung function testing system (Data Sciences International, Buxco RC), ovalbumin (OVA, Sigma, A5503), aluminum hydroxide gel (Thermo Fisher, 77161), isoflurane for animals (Reward, R510-22), physiological saline (Huayu Pharmaceutical, 0.9%), methacholine (Methacholine, MCh, Sigma, A2126), terbutaline (Terbutaline, TB, Chengdu Huayu Pharmaceutical Co., Ltd., H20010703); The experimental procedure involved in this embodiment is as follows: (1) Animal grouping C57BL / 6J mice were randomly divided into 4 groups (n=8): Normal control group (NC): Normal mice were injected intraperitoneally with an equal volume of physiological saline; Asthma model group (AS): Asthma mouse model was established by intraperitoneal injection of OVA sensitization solution, and asthma was induced by gradient MCh nebulization (no treatment). Within 24 hours after the establishment of the asthma mouse model, asthma was induced by nebulization with gradient MCh (concentrations of 0 mg / mL, 1.5 mg / mL, 3 mg / mL, 6 mg / mL, 12 mg / mL, and 24 mg / mL, respectively). TB group (Asthma model group with terbutaline treatment, TB): MCh nebulization to induce asthma while inhaling 100 μg / kg TB for treatment; BRB group (Asthma model group with BRB treatment): MCh nebulization to induce asthma while inhaling 100 ng / kg BRB for treatment.

[0037] (2) Modeling protocol: Mice were sensitized by intraperitoneal injection of a mixture of physiological saline containing OVA (100 μg / mouse) and aluminum hydroxide (1 mg / mouse) (200 μL) on day 0 and day 7 respectively. Starting from day 14, asthma was induced by nebulized inhalation of 1% OVA for 30 min for 4 consecutive days to complete the asthma mouse model. (3) Respiratory function testing protocol: The respiratory function indicators of mice, including changes in airway resistance (RL), were recorded using a small animal respiratory function testing system (Pulmonary Resistance and Compliance system, RC).

[0038] The results showed that the airway resistance (RL) in the asthma model group was significantly higher than that in the blank control group; the RL in the positive control group (100 μg / kg TB) was significantly lower than that in the asthma model group; and the RL in the group (100 ng / kg BRB) was significantly lower than that in the asthma model group. This suggests that BRB can reduce airway resistance in asthmatic mice and improve asthma (…). Figure 3 ).

[0039] Example 4 This embodiment provides an investigation into the anticontractile capacity of BRB smooth muscle cells using real-time label-free cell analysis technology.

[0040] The experimental subjects, reagents, and instruments involved in this embodiment are as follows: Experimental subject: Human airway smooth muscle cells; Experimental reagents and instruments: Real-time label-free cell analyzer (Agilent, RTCA DP), laminar flow hood (Suzhou Purification Equipment Co., Ltd., HD201806324), CO2 incubator (Esco, CCL-170B-8), benchtop microcentrifuge (Beckman Coulter, Microfuge 22R), cell culture dishes (Corning, 10cm), E-Plate 16-well plates (Agilent, 3000600890), DMEM high-glucose liquid culture medium (Cytiva, SH30022.01), fetal bovine serum (Corning, 35-081-CV), penicillin-streptomycin Vetec TM(Sigma, V900929), trypsin (Sigma, T4049), acetylcholine chloride (Acetylcholine Chloride, ACh, Sigma, A6625); The experimental procedure involved in this embodiment is as follows: (1) Add 80 μL of total culture medium to each well of the E-Plate 16-well plate, connect the RTCA instrument, and check if the message connection is incorrect. If it indicates that the connection of individual wells has failed, remove the E-Plate 16-well plate and gently blow the bottom of the well with a dust blower. Reconnect the plate to the RTCA instrument. Set the layout (enter the cell type, cell number, and plate layout information) and schedule (add experimental processes Step 1-4). Click Start to run Step 1 to perform baseline detection. (2) Take out the culture dish of human airway smooth muscle cells from the CO2 incubator and observe the cell growth status with an inverted microscope (the cell density reaches about 80%). Then spray with 75% alcohol, put it in a clean bench, discard the original culture medium, add 3mL PBS (1×) along the wall of the culture dish and gently wash twice in a cross-shaped manner. Add 2mL trypsin along the wall of the culture dish, put it in a 37℃ constant temperature incubator for 2min to digest, and gently tap the culture dish to observe under the microscope that a large number of floating airway smooth muscle cells are visible. Then add 4mL of DMEM full culture medium, gently pipette and transfer the cell suspension into a 15mL centrifuge tube, centrifuge at 1000rpm for 5min. After centrifugation, remove the DMEM full culture medium, add 1mL of DMEM full culture medium back into the centrifuge tube, and gently pipette to mix.

[0041] (3) Take 10 μL of cell suspension and mix it with 90 μL of PBS (1×) (dilute the cell suspension 10 times), take 10 μL and add it to the cell counting plate for counting; seed 3000 human airway smooth muscle cells in each well; prepare 100 wells according to 100 μL of suspension per well, for a total of 10 mL; add 100 μL of cell suspension to each well, let stand at room temperature for 25 min, and put the plate back into the RTCA instrument; (4) Start step 2, record cell growth, run for about 24-36 hours; when the cell index (CI) value reaches about 1.0, prepare to administer the drug; All drugs must be prepared using sterilized PBS (1×), with a final concentration of 20 mM for ACh, 10 nM, 100 nM, and 1000 nM for BRB, and a final concentration of 10 μM for the positive control terbutaline (TB). (5) Terminate step 2, remove the RTCA instrument from the CO2 incubator, replace the E-Plate 16-well plate cover with a metal plate for drug addition, and equilibrate in the room for 10 minutes; start step 3, add drug after 5-10 minutes of detection, add 10 μL of drug to each well and incubate for 30 minutes; terminate step 3, start step 4, add 10 μL of ACh to each well and continue detection; after homogenization, observe and compare the decrease value of CI in each group.

[0042] The results showed that real-time label-free cell analysis indicated that BRB could reduce the contraction of ACh-stimulated human airway smooth muscle cells, significantly relax airway smooth muscle cells, and this effect was concentration-dependent. Figure 4 ).

[0043] Example 5 This embodiment provides an investigation into the specificity of BRB by knocking down Ezrin in airway smooth muscle cells using siRNA interference technology.

[0044] The experimental reagents and instruments involved in this embodiment are as follows: PowerPac TM Basic electrophoresis apparatus (Bio-Rad, 1645050), eBlot TM L1 rapid wet transfer system (Genescript, L00686C), Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075), anti-Ezrin antibody (Santa, sc-58758), real-time label-free cell analyzer (Agilent, RTCA DP), clean bench (Suzhou Purification Equipment Co., Ltd., HD201806324), CO2 incubator (Esco, CCL-170B-8), benchtop microcentrifuge (Beckman Coulter, Microfuge 22R), cell culture dishes (Corning, 10cm), E-Plate 16-well plates (Agilent, 3000600890), DMEM high-glucose liquid culture medium (Cytiva, SH30022.01), fetal bovine serum (Corning, 35-081-CV), penicillin-streptomycin Vetec TM (Sigma, V900929), trypsin (Sigma, T4049), acetylcholine chloride, Ezrin stealth RNAi (Thermo Fisher Scientific, RSS367469), Lipofectamine TMRNAiMAX transfection reagent (Invitrogen, 13778030); The experimental procedure involved in this embodiment is as follows: 1) Small interfering RNA transfection technology was used to construct human airway smooth muscle cells with low Ezrin expression. A) Routinely culture human airway smooth muscle cells until the cell density grows to 85%, digest with trypsin, centrifuge, add 1 ml of DMEM medium containing 10% FBS to resuspend, and mix by pipetting to obtain cell resuspension. 100 μL of cell resuspension was added to each well of a 6-well plate and divided into two groups: a Scramble stealth siRNA control group (disordered siRNA, non-functional, serving as a control) and an Ezrin stealth siRNA group.

[0045] B) Reagent premixing: Add 12 μL of RNAi Max transfection reagent to 400 μL of DMEM medium without serum and antibiotics to obtain the transfection reagent mixture; Add 3 μL of Scrambled stealth siRNA interference reagent to 100 μL of DMEM medium without serum and antibiotics to obtain a mixture containing Scrambled stealth siRNA interference reagent; Add 3 μL of Ezrin stealth siRNA interference reagent to 100 μL of DMEM medium without serum and antibiotics to obtain a mixture containing Ezrin stealth siRNA interference reagent; Mix the mixture containing Scrambled stealth siRNA interference reagent with the transfection reagent mixture at a volume ratio of 1:1, mix gently, and let stand at room temperature for 15 minutes to obtain the premixed transfection reagent containing Scrambled stealth siRNA. Mix the Ezrin stealth siRNA interference reagent with the transfection reagent at a volume ratio of 1:1, gently mix, and let stand at room temperature for 15 min to obtain the premixed transfection reagent containing Ezrin stealth siRNA.

[0046] The Ezrin stealth siRNA sequence (Thermo Fisher, RSS367469) is as follows: Chain of Justice (SEQ ID NO.1, 5'-3'): CGAGAAGAAGAGGAGAGAAACUGUA; Antisense chain (SEQ ID NO.2, 5'-3'): UACAGUUUCUCUCCUCUUCUUCUCG.

[0047] C) Take 200 μL of the premixed transfection reagent containing Scrambled stealth siRNA prepared in step B) and add it to the target well group of the 6-well plate in step A), and add DMEM medium containing 10% FBS to 2 mL, and incubate for 36 h; Take 200 μL of the premixed transfection reagent containing Ezrin stealth siRNA prepared in step B) and add it to the target well group of the 6-well plate in step A), and add DMEM medium containing 10% FBS to 2 mL, and incubate for 36 h; 2) The effects of Ezrin knockdown-induced BRB on the contraction and relaxation of human airway smooth muscle cells were detected using real-time label-free cell analysis technology.

[0048] Except for the following, everything else is the same as in Example 4: The group treated with scrambled stealth siRNA was designated as the Control group, and the group treated with specific siRNA (Ezrin stealth siRNA interference reagent) was designated as the Ezrin-deficient group. Once the cell index (CI) value reaches approximately 1.0, prepare to administer the drug. All medications must be prepared using sterilized PBS (1×), with a final concentration of acetylcholine chloride (ACh) of 20 mM and a final concentration of BRB of 100 nM. Among them, the Control group: the first group was given only ACh, and the second group was given ACh and BRB co-administered; Ezrin-deficient group: Group 1 was given only ACh, and Group 2 was given ACh and BRB together.

[0049] The results showed that, compared with the non-knockdown group, the airway smooth muscle cell BRB relaxation effect disappeared in the Ezrin knockdown group; suggesting that the airway smooth muscle relaxation effect of BRB is specifically dependent on Ezrin. Figure 5 ).

[0050] Example 6 This embodiment provides an investigation into the effect of BRB on the activity of Ezrin and its downstream RhoA using Western blot.

[0051] The experimental reagents and instruments involved in this embodiment are as follows: PowerPac TMBasic electrophoresis apparatus (Bio-Rad, 1645050), eBlot TM L1 rapid wet transfer system (Genescript, L00686C), Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075), anti-Ezrin antibody (Santa, sc-58758), RhoA Pull-down activation kit (Cytoskeleton, BK036). The experimental procedure involved in this embodiment is as follows: Human airway smooth muscle cells were cultured in 6-well plates until the cell density reached about 80%, then replaced with serum-free DMEM medium and starved overnight. They were then incubated with 100 nM BRB for 30 min. Some samples were retained for detecting Ezrin and its phosphorylation changes, and some samples were used for the active RhoA pulldown experiment. After determining the protein concentration of the pre-treated sample using the BCA method, mix the sample with the loading buffer at an appropriate ratio and place it in a dry thermostat at 60°C for 5 minutes. Fix the pre-cast gel in the clamps and pour fresh electrophoresis working solution into the electrophoresis tank. Electrophore at 80V for 40 minutes to flatten the bands, then electrophore at 120V until the bromophenol blue reaches the bottom of the gel. Activate the PVDF membrane by soaking it in methanol for 1 minute. Lay the sponge pad, PVDF membrane, and pre-cast gel in sequence on the clamps. Gently press with rollers to remove air bubbles between the gel and the PVDF membrane, then place another layer of sponge pad on top. Clamp the membrane into the rapid wet transfer apparatus for 11 min; remove the PVDF membrane and quickly cut it according to the molecular weight position of the target protein. Place the PVDF membrane in an incubation box containing 3 mL of 5% BSA blocking solution, shake at 80 rpm, and incubate at room temperature for 1 h; prepare the primary antibody (1:1000) according to the antibody instructions or pre-experimental parameters, shake at 80 rpm, and incubate overnight at 4°C; wash the membrane 5 times with TBST working solution (1×), 5 min each time, shake at 80 rpm; prepare the secondary antibody (1:2000) according to the antibody instructions, shake at 80 rpm, and incubate at room temperature for 1 h; wash the membrane 5 times with TBST working solution (1×), 5 min each time, shake at 80 rpm; according to the instructions, take an appropriate amount of colorimetric solution A (hydrogen peroxide): B (luminol) = 1:1, mix thoroughly, and store in the dark.

[0052] After fully immersing the PVDF film in the developing solution, place it on the developing disk and then expose the developing disk in a chemiluminescence imaging instrument.

[0053] The results showed that, under the premise of consistent internal control β-actin, there was no significant difference in Ezrin basal protein after BRB intervention in human airway smooth muscle cells, but phosphorylation expression of Ezrin at Tyr478 was significantly upregulated, and downstream RhoA-GTP expression decreased. Figure 6 The results suggest that BRB inhibits the activity of RhoA by inducing phosphorylation at Ezrin Tyr478, thus regulating the contraction and relaxation signaling pathway.

[0054] Example 7 This embodiment provides an investigation into the median effect concentration (EC50) of BRB on the relaxation effect of human airway smooth muscle cells and the median inhibition concentration (IC50) on the activity of human airway smooth muscle cells.

[0055] The experimental reagents and instruments involved in this embodiment are as follows: Real-time label-free cell analyzer (Agilent, RTCA DP), laminar flow hood (Suzhou Purification Equipment Co., Ltd., HD201806324), CO2 incubator (Esco, CCL-170B-8), benchtop microcentrifuge (Beckman Coulter, Microfuge 22R), cell culture dishes (Corning, 10cm), E-Plate 16-well plates (Agilent, 3000600890), DMEM high-glucose liquid culture medium (Cytiva, SH30022.01), fetal bovine serum (Corning, 35-081-CV), penicillin-streptomycin Vetec TM (Sigma, V900929), trypsin (Sigma, T4049), WST-1 cell proliferation and cytotoxicity assay kit (Beyotime, C0036), microplate reader (BioTek, Synergy H1); The experimental procedure involved in this embodiment is as follows: 1) The half-maximal effective concentration (EC50) of BRB on the relaxing effect of human airway smooth muscle cells was detected using real-time label-free cell analysis technology.

[0056] Except for the following, everything else is the same as in Example 4: Once the cell index (CI) value reaches approximately 1.0, prepare to administer the drug. All drugs must be prepared using sterilized PBS (1×) at high temperature. The final concentration of acetylcholine chloride (ACh) is 20mM, and the final concentrations of BRB are 0nM, 5nM, 10nM, 50nM, 500nM, and 1000nM, respectively. 2) The half-maximal inhibitory concentration (IC50) of BRB on the activity of human airway smooth muscle cells was detected using the WST-1 cell proliferation and cytotoxicity assay kit.

[0057] Human airway smooth muscle cells (5000 cells / well) were cultured in 96-well plates and incubated overnight. The final concentrations of BRB were 0 nM, 10 nM, 50 nM, 100 nM, 500 nM, 1000 nM, 5000 nM, 10000 nM, 50000 nM, and 100000 nM, with a final volume of 200 μL for all wells. After incubation in a CO2 incubator for 48 h, 20 μL of WST-1 reagent was added to each well, and the plates were incubated at 37 °C for 2 h. The 96-well plates were then shaken on a shaker for 1 min to thoroughly mix the test system. The absorbance was measured at 450 nm using a microplate reader.

[0058] The results showed that the half-maximal effective concentration (EC50) of BRB-treated airway smooth muscle cells was 11.4 nM. Figure 7 The half-maximal inhibitory concentration (IC50) of BRB on the activity of human airway smooth muscle cells was 139.7 μM. Figure 8 ).

[0059] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. The application of berberine in the preparation of drugs for treating asthma, characterized in that, The chemical structural formula of berberine is shown in formula (I): Formula (I).

2. The application according to claim 1, characterized in that, The drug is one that can relax airway smooth muscle.

3. The application according to claim 1, characterized in that, The berberine relaxes airway smooth muscle by targeting actin-binding protein Ezrin.

4. The application according to claim 1, characterized in that, The medication is used to relieve airway resistance and improve ventilation in asthma patients.

5. The application according to claim 1, characterized in that, The drug contains pharmaceutically acceptable excipients.

6. The application according to claim 1, characterized in that, The medication contains other drugs used to treat asthma.

7. The application according to claim 1, characterized in that, The dosage form of the drug is selected from oral dosage forms, injectable dosage forms, external dosage forms, or inhaled sprays.

8. The application according to claim 7, characterized in that, The drug is in the form of an inhalation spray.

9. The application according to claim 1, characterized in that, The drug contains ester derivatives or phenolic derivatives of berberine.