A method for upregulating adiponectin in perivascular adipose tissue

By combining a sonosensitive agent with low-frequency, low-intensity ultrasound treatment, the pervascular adipose tissue is targeted to activate autophagy-related pathways, overcoming the shortcomings of adiponectin regulation in existing technologies. This achieves effective upregulation of adiponectin and reduction of pro-inflammatory factors in pervascular adipose tissue, reversing the inflammatory environment of atherosclerotic plaques.

CN122124237APending Publication Date: 2026-06-02HARBIN MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HARBIN MEDICAL UNIVERSITY
Filing Date
2026-01-19
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology to directly regulate adiponectin levels in perivascular adipose tissue, and systemic administration carries potential risks of tolerance and adverse reactions.

Method used

By using a sonosensitive agent for intravenous injection or in vitro incubation, combined with low-frequency, low-intensity ultrasound irradiation, the drug targets perivascular adipose tissue cells, activates autophagy-related pathways, and increases adiponectin expression and secretion.

Benefits of technology

In perivascular adipose tissue and adjacent atherosclerotic plaques, it promotes increased adiponectin expression, reduces pro-inflammatory factor expression, reverses the effects of a high-fat diet, and reduces the inflammatory environment of atherosclerotic plaques.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124237A_ABST
    Figure CN122124237A_ABST
Patent Text Reader

Abstract

The application discloses a method for up-regulating adiponectin of perivascular adipose tissue, and belongs to the technical field of molecular biology. The method is targeted at cells of perivascular adipose tissue, increases mRNA and protein expression of LRP1 of adipocytes, activates an autophagy-related pathway, and reduces expression of proinflammatory factors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a method for upregulating adiponectin in perivascular adipose tissue. Background Technology

[0002] Perivascular adipose tissue (PVAT) is tightly connected to the outermost layer of the blood vessel wall. It not only serves as an energy storage layer but also possesses significant endocrine and paracrine functions, making it an important source of inflammatory signals on the lateral side of the blood vessel wall. PVAT can synthesize and release various bioactive molecules locally. Under pathological conditions such as obesity, hyperlipidemia, and abnormal glucose metabolism, PVAT can shift from a relatively protective secretory phenotype to a pro-inflammatory phenotype. This is manifested by a decrease in the secretion of anti-inflammatory adipokines such as adiponectin (ADPN) and an increase in the expression of pro-inflammatory factors such as IL-6, IL-1β, and TNF-α, as well as chemokines such as MCP-1. These changes induce or aggravate endothelial dysfunction from the adventitia, promote immune cell infiltration and vascular smooth muscle cell migration and proliferation, thereby affecting the inflammatory environment and progression of adjacent atherosclerotic plaques. Interventions targeting PVAT function and inflammatory status are considered to have potential anti-atherosclerotic value.

[0003] Adiponectin (ADPN) is an adipokine secreted by adipocytes, also known as an adipocyte complement-associated protein. It is an adipocyte-specific secretory protein with a wide range of physiological functions. Previous studies have suggested that adiponectin plays a role in PVAT by inhibiting inflammatory responses and improving endothelial function, thus possessing anti-atherosclerotic functions. Therefore, increasing its expression or effect has high biological and translational value.

[0004] Existing research suggests that methods for upregulating adiponectin or enhancing its pathway mainly include: drug intervention, such as PPARγ agonists (e.g., pioglitazone, rosiglitazone), some ARBs (e.g., telmisartan), and statins, which can increase circulating adiponectin levels to some extent. However, most of these are systemic administrations, which exert their effects on multiple target organs after entering the bloodstream, indirectly regulating PVAT. Furthermore, long-term use carries potential risks of tolerance and adverse reactions (e.g., hypoglycemia, weight loss, liver damage), resulting in shortcomings in controllability and convertibility. Summary of the Invention

[0005] This invention addresses the lack of an effective method in the prior art for directly regulating adiponectin levels in perivascular adipose tissue by providing a method for upregulating adiponectin in perivascular adipose tissue.

[0006] One of the objectives of this invention is to provide a method for upregulating adiponectin in perivascular adipose tissue. The method includes the following steps: administering a sonosensitive agent to adipocytes to induce an absorption and conversion reaction; and after the reaction is completed, irradiating the periphery of the target vascular segment with low-frequency, low-intensity ultrasound.

[0007] Furthermore, the sound-sensitive agent is a drug with sound-sensitive properties or a precursor drug thereof.

[0008] Furthermore, the sound-sensitizing agent includes, but is not limited to, sodium porphyrin.

[0009] Furthermore, the sound-sensitizing agent is administered via intravenous injection or in vitro incubation.

[0010] Furthermore, when the sound sensitizer is administered via intravenous injection, the intravenous injection dose is 25 mg / kg, and irradiation treatment is performed 6 hours after the absorption and conversion reaction.

[0011] Furthermore, the irradiation treatment conditions are: a frequency of 1 MHz, a duty cycle of 30%, and an irradiation intensity of 0.4 W / cm². 2 The irradiation time is 15 minutes.

[0012] Furthermore, when the sound sensitizer is administered via in vitro incubation, the concentration of the added sound sensitizer is 0.4 μmol / L, and irradiation treatment is performed 12 hours after the absorption and conversion reaction.

[0013] Furthermore, the irradiation treatment conditions are: a frequency of 1 MHz, a duty cycle of 10%, and an irradiation intensity of 0.1 W / cm². 2 The irradiation time is 5 minutes.

[0014] Compared with the prior art, the beneficial effects of the present invention are: the present invention provides a method for upregulating adiponectin in perivascular adipose tissue. This method targets perivascular adipose tissue cells, upregulates adiponectin expression and secretion, increases the mRNA and protein expression of LRP1 in adipocytes, activates autophagy-related pathways, and reduces the expression of pro-inflammatory factors.

[0015] This invention utilizes ApoE - / -A mouse model of atherosclerosis was established using a high-fat diet. A combination of a sonosensitive agent and low-frequency, low-intensity ultrasound was used to intervene in the perivascular adipose tissue region of the aorta. Histopathological staining, immunohistochemical staining, and Western blot analysis confirmed that the treatment method provided in this invention resulted in decreased expression of pro-inflammatory factors and the M1 marker CD197 in the perivascular adipose tissue and atherosclerotic plaques of mice, while increasing expression of adiponectin and the M2 marker CD206. Simultaneously, LRP1 expression in the perivascular adipose tissue increased. This indicates that the sonosensitive agent combined with low-frequency, low-intensity ultrasound intervention can promote increased adiponectin expression in the perivascular adipose tissue and adjacent plaques, reversing the effects of a high-fat diet.

[0016] This invention demonstrates that in an in vitro cultured mature adipocyte model, intervention with a sound sensitizer combined with low-frequency, low-intensity ultrasound can increase the expression of adiponectin protein and mRNA in adipocytes, using Western blot, RT-PCR, and immunofluorescence staining. Attached Figure Description

[0017] Figure 1 For SDT to ApoE - / - The effect of adiponectin on perivascular adipose tissue in the mouse aorta; A is the Western blot result, B is the quantitative analysis statistical graph; n=5 cases / group, **** P <0.0001; Figure 2 For SDT to ApoE - / - The effect of adiponectin on atherosclerotic plaques in the aorta of mice; A is the immunohistochemical results, B is a statistical graph of adiponectin expression; n=5 cases / group, ** P <0.01; Figure 3 For SDT to ApoE - / - Effects of pro-inflammatory factors on perivascular adipose tissue in mouse aorta; A is the Western blot result, BD are the quantitative analysis statistics; n=5 cases / group, ** P <0.01, *** P <0.001, **** P <0.0001; Figure 4 For SDT to ApoE - / - The effect of LRP1 in perivascular adipose tissue of the mouse aorta; A is the result of Western blot detection, B is the statistical graph of quantitative analysis; n=5 cases / group, ** P <0.01; Figure 5 For SDT to ApoE - / -Effects of pro-inflammatory factors on atherosclerotic plaques in the aorta of mice; A is the immunohistochemical results, BD are statistical graphs of pro-inflammatory factor expression; n=5 cases / group, ** P <0.01, *** P <0.001; Figure 6 Figure showing the results of CCK-8 assay for the cytotoxicity of sodium porphyrin to adipocytes; n=5 cases / group, *** P <0.001, **** P <0.0001 compared to 0 μmol / L; Figure 7 A shows the time-varying metabolism of sodium porphyrin in adipocytes; A is the result of changes in cell fluorescence intensity with incubation time; B is the co-localization map of DVDMS and mitochondrial probes within cells; n=5 cases / group, *** P <0.001, **** P <0.0001 compared to 0 hours; Figure 8 The effect of SDT on LRP1 mRNA and protein expression in adipocytes; A is the RT-PCR detection result, B is the immunofluorescence detection result; n=3 cases / group, ** P <0.01, *** P <0.001, **** P <0.0001; Figure 9 The effect of SDT on the expression of adiponectin protein and mRNA, an anti-inflammatory factor in adipocytes; A is the result of Western blot detection, B is the statistical graph of quantitative analysis, and C is the result of RT-PCR detection; n=3 cases / group, * P <0.05,** P <0.01, **** P <0.0001; Figure 10 To observe the effect of SDT on ADPN expression in adipocytes using immunofluorescence staining. Detailed Implementation

[0018] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content and scope of this invention to implement and apply the technology of this invention.

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, and can be obtained commercially by those skilled in the art.

[0020] The adipocytes used in the following examples were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and were 6-8 week old male ApoE cells. - / - Mice were purchased from Beijing Vital River Laboratory Animal Co., Ltd.

[0021] In the following embodiments, the method for upregulating adiponectin in perivascular adipose tissue provided by the present invention will be referred to as SDT.

[0022] Example 1: 1. SDT targets perivascular adipose tissue (PVAT) to upregulate ApoE. - / - Adiponectin (ADPN) levels in atherosclerotic mice (1) In in vivo animal models, SDT upregulates PVAT and ADPN levels in plaques. In this embodiment, 10 male ApoE pharmacokinetic animals were selected. - / - Mice were isolated and fed a high-fat diet (1.5% cholesterol, 10% lard, 4% milk powder, and 0.5% sodium cholate) for 12 weeks to establish an atherosclerotic plaque model. The animal room temperature was 20-26℃, the humidity was 50%-60%, and the light / dark cycle was alternated for 12 hours each. The bedding was changed according to the standard procedure.

[0023] The mice with the above-mentioned atherosclerotic plaque model were randomly divided into two groups: the control group (simulated sound sensitizer combined with low-frequency low-intensity ultrasound) and the SDT group (sound sensitizer combined with low-frequency low-intensity ultrasound). SDT treatment procedure: Mice with atherosclerotic plaque model were anesthetized by intravenous injection of the sonostatin sodium (DVDMS) 25 mg / kg via tail vein, followed by intraperitoneal injection of aflutidine (0.01 mL / g) 6 hours later. The neck and chest skin were thoroughly exposed after hair removal, and coupling gel was evenly applied before placing the device on an ultrasound probe. Treatment was administered using a combination of sonostatin and low-frequency, low-intensity ultrasound (the irradiation conditions were: frequency 1 MHz, 30% duty cycle, irradiation intensity 0.4 W / cm²). 2 The irradiation time was 15 minutes. The mice were kept away from light for the first three days after treatment and returned to the animal room after they were fully awake. Seven days after the intervention, the mice were sacrificed and the aortic root and aortic PVAT were collected for histopathological staining and Western blot experiments.

[0024] Histological preparation: After the aorta was removed, it was rinsed with PBS, fixed at 4°C and 4% paraformaldehyde for 24-48 h; dehydrated with 10% and 20% sucrose for 4 h each, and overnight with 30% sucrose, embedded in OCT and frozen at -80°C. Frozen sections were 7 μm thick and stored at -80°C for later use. Key steps of Western blot included PVDF transfer (300 mA, according to the principle of 1 kDa ≈ 1 min), 5% skim milk blocking, primary antibody incubation at 4°C overnight, HRP secondary antibody incubation, ECL chemiluminescence staining, and Image Lab analysis. Immunohistochemical analysis steps included 3% H2O2 blocking, serum blocking, primary antibody incubation at 4°C overnight, secondary antibody incubation, DAB staining, and hematoxylin counterstaining. The anti-inflammatory factor ADPN in PVAT was detected, and the positive area ratio of ADPN in aortic atherosclerotic plaques was evaluated by immunohistochemistry (IHC).

[0025] The steps for immunohistochemical (IHC) staining of animal tissues are as follows: After thawing frozen sections of mouse aorta from a -80°C freezer, wash three times with PBS buffer for 5 minutes each time. Add 100 μL of 3% H2O2 to the tissue surface and incubate at room temperature for 20 minutes. Wash three more times with PBS buffer for 5 minutes each time. Add 100 μL of goat serum to the tissue surface and block for 30 minutes. Add 100 μL of primary antibody prepared with 1% BSA to the tissue surface and incubate overnight at 4°C in a humidified chamber. The next day, incubate at room temperature for 2 hours. Wash three times with PBS buffer for 5 minutes each time. Add 100 μL of secondary antibody working solution to the tissue surface and incubate at room temperature for 1 hour. Wash three times with PBS buffer for 5 minutes each time. Add 100 μL of DAB working solution to the tissue surface, stop with tap water after 1-5 minutes, and wash with deionized water. Add 100 μL of DAB working solution to the tissue surface. Apply μL of hematoxylin staining solution to the tissue surface and stain for 3 minutes; rinse with tap water for 5 minutes, then soak in deionized water; immerse in 75%, 80%, 85%, 90%, 95%, 100%, and 100% ethanol sequentially for 5 minutes each time; immerse twice in xylene for 5 minutes each time; add 30 μL of neutral resin to the tissue surface and mount with a clean coverslip; place the sections in a 60℃ constant temperature drying oven for 24-48 hours; acquire images using an optical microscope and analyze using Image-Pro Plus 8.0 software.

[0026] Western blot results are as follows Figure 1 As shown, the ADPN protein level in PVAT of the SDT group was higher than that of the Control group ( Figure 1 ).

[0027] Immunohistochemical results as follows Figure 2As shown, the proportion of ADPN-positive areas within atherosclerotic plaques increases, indicating that ADPN upregulated by PVAT can influence the microenvironment of adjacent plaques through paracrine effects.

[0028] (2) In in vivo animal models, SDT affects the expression of pro-inflammatory factors and LRP1. Low-density lipoprotein receptor-associated protein 1 (LRP1) is expressed in adipocytes, especially in perivascular adipose tissue, and plays a dual role as a "scavenger" and "signal regulator" in vascular homeostasis, playing a key role in the development of atherosclerosis.

[0029] Pro-inflammatory factors (TNF-α, IL-1β, IL-6) and LRP1 protein in PVAT were detected, and the positive area ratio of TNF-α, IL-1β, and IL-6 in aortic atherosclerotic plaques was evaluated by IHC method. The specific steps were the same as (1).

[0030] Western blot results are as follows Figure 3-4 As shown, compared with the control group, the expression of pro-inflammatory factors TNF-α, IL-1β, and IL-6 proteins in PVAT was reduced in the SDT group, suggesting that SDT effectively downregulates the secretion level of pro-inflammatory factors in PVAT. Figure 3 LRP1 protein expression in PVAT was increased in the SDT group compared to the Control group. Figure 4 ).

[0031] IHC was used to label pro-inflammatory factors in mouse aortic atherosclerotic plaques, and the results were as follows: Figure 5 As shown, compared with the Control group, the percentage of TNF-α, IL-1β, and IL-6 positive areas in the aortic atherosclerotic plaques was significantly reduced in the SDT group. This indicates that in vivo experiments, the combination of a sonosensitive agent and low-frequency, low-intensity ultrasound can reduce the secretion of pro-inflammatory factors in atherosclerotic plaques.

[0032] 2. SDT promotes ADPN expression in in vitro adipocytes. (1) Determination of the optimal concentration of DVDMS in 3T3-L1 induced adipocytes To avoid the direct death of mature adipocytes due to drug toxicity caused by excessively high concentrations of DVDMS, while allowing cells to take up as much of the sound-sensitizing agent DVDMS as possible. First, mouse 3T3-L1 adipocyte precursor cells were cultured under standard conditions until two days after confluence (day 0 of differentiation). Then, an induction medium containing IBMX, dexamethasone, and insulin (composition: 0.5 mmol / L IBMX, 1.0 µmol / L dexamethasone, 10 mg / L Insulin, 10% FBS high-glucose DMEM medium) was added for 48 hours of induction. Subsequently, the medium was changed to insulin-only medium (composition: 10 mg / L Insulin, 10% FBS high-glucose DMEM medium) for another 48 hours of induction. On day 4 of differentiation, the medium was changed to 10% FBS high-glucose DMEM medium for further culture, with the medium changed every 2-3 days. Mature adipocytes with 90%-95% differentiation were obtained in approximately 6-9 days. Oil Red O staining of these mature adipocytes revealed intracellular lipid droplet formation, indicating successful model establishment.

[0033] The adipocytes were incubated with culture media containing 0.1 μmol / L–25 μmol / L of the sound-sensitive agent DVDMS, respectively. The toxicity of DVDMS to adipocytes was then detected using the CCK-8 assay. The results are as follows: Figure 6 As shown, cell activity was significantly inhibited when the concentration of DVDMS was ≥4 μmol / L. Without affecting adipocyte activity and simulating in vivo intervention conditions, 0.4 μmol / L was subsequently selected as the in vitro intervention concentration.

[0034] (2) Determination of the optimal time for applying DVDMS to 3T3-L1 induced adipocytes To further clarify the metabolic patterns of DVDMS in adipocytes, adipocytes were incubated with 0.4 μmol / L DVDMS, and the intracellular autofluorescence intensity was detected by a fluorescence microplate reader at immediate, 1, 2, 3, 4, 5, 6, 8, 10, 12, 24, 36, and 48 h.

[0035] The results are as follows Figure 7 As shown in Part A, detection using a fluorescence microplate reader revealed that the fluorescence intensity of DVDMS in adipocytes increased with prolonged incubation time. After 12 hours, the fluorescence intensity reached a relatively stable level and no significant decay was observed. Therefore, the incubation time for mature adipocytes with DVDMS was determined to be 12 hours.

[0036] Furthermore, the localization of DVDMS in adipocytes was detected using mitochondrial fluorescent probe staining and fluorescence microscopy. The results are as follows: Figure 7As shown in Part B, after incubating adipocytes with 0.4 μmol / L DVDMS for 12 hours, DVDMS-specific red fluorescence was observed within the adipocytes. Co-localization with mitochondrial fluorescent probes and nuclear fluorescent dyes (DAPI) under microscopy revealed that DVDMS could enter adipocytes, accumulate in the cytoplasm, and partially co-localize with mitochondria. Therefore, in subsequent experiments, adipocytes were incubated with DVDMS for 12 hours before ultrasound intervention.

[0037] (3) SDT upregulates 3T3-L1-induced LRP1 protein and mRNA expression in adipocytes This invention divides mature adipocytes into: a control group (Control group), an ultrasound-only group (Ultrasound group), a sound-sensitizing agent-only group (DVDMS group), and a sound-sensitizing agent combined with low-frequency, low-intensity ultrasound intervention group (SDT group). Adipocytes in the DVDMS and SDT groups were incubated with 0.4 μmol / L DVDMS for 12 hours. Adipocytes in the SDT group were irradiated with ultrasound once after DVDMS incubation, while adipocytes in the Ultrasound group were irradiated with ultrasound of the same intensity and duration only once.

[0038] Real-time quantitative PCR detection of LRP1 was performed on the Control group, Ultrasound group, DVDMS group, and SDT group. The operation steps are as follows: Cell culture dishes were removed and placed on ice, cell supernatant was discarded, and cellular RNA was extracted using the Trizol method; the RNA concentration of each sample was measured sequentially, and the RNA concentration was adjusted to 2 μg / 20 μL. The RNA was reverse transcribed into cDNA using a TOYOBO reverse transcription kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.); the LRP1 primers used for the first time were centrifuged at 12000 rpm for 2-3 minutes, and DEPC water was added to prepare a 100 μM stock solution, which was diluted 10-fold before use; the following were added to the reaction wells for amplification: 10 μL SYBR Green, 6 μL DEPC water, 1 μL forward and reverse primers, and 2 μL of 2 μg / 20 μL of SYBR Green. PCR amplification was performed using μL of cDNA. The reaction program was as follows: pre-denaturation at 95℃ for 1 minute, 40 cycles; 95℃ for 15 seconds; 60℃ for 15 seconds; 72℃ for 45 seconds; melting curve: 95℃ for 15 seconds; 60℃ for 60 seconds; 95℃ for 30 seconds; 60℃ for 15 seconds; data were collected after PCR.

[0039] The detection targets involved in qPCR in this embodiment include LRP1 and ACTIN (internal control). The upstream primer sequence used for RT-PCR detection of LRP1 is shown in SEQ ID NO.1 (ACTATGGATGCCCCTAAAACTTG), and the downstream primer sequence is shown in SEQ ID NO.2 (GCAATCTCTTTCACCGTCACA). The upstream primer sequence used for RT-PCR detection of ACTIN (internal control) is shown in SEQ ID NO.3 (CCGTAAAGACCTCTATGCCAACA), and the downstream primer sequence is shown in SEQ ID NO.4 (GGGGCCGACTCATCGTA).

[0040] Real-time quantitative PCR results are as follows Figure 8 As shown in Part A, compared with the Control group, the mRNA level of LRP1 in mature adipocytes of the SDT group was significantly increased, while the Ultrasound group and DVDMS group had no significant effect.

[0041] The procedure for detecting LRP1 protein expression in mature adipocytes using immunofluorescence is as follows: Mature adipocytes were washed three times with PBS buffer, then fixed with 4% paraformaldehyde for 10 minutes. The cells were washed twice more with PBS buffer and permeabilized with 0.1% Triton for 2 minutes. The cells were washed twice more with PBS buffer and then blocked with goat serum blocking solution at room temperature for 30 minutes. The cells were incubated overnight at 4°C with a primary antibody working solution prepared with 1% BSA. The next day, the cells were washed three times with PBS buffer and then incubated with a fluorescent secondary antibody working solution at room temperature in the dark for 90 minutes. After washing the cells with PBS buffer, DAPI staining was performed for 10 minutes. Antifluorescence quencher was added to the cell slides, which were then inverted onto a glass slide, and images were acquired using a fluorescence microscope.

[0042] Immunofluorescence results as follows Figure 8 As shown in Part B, compared with the Control group, the green fluorescence of LRP1 protein was significantly enhanced 12 hours after treatment with the sonosensitive agent combined with low-frequency, low-intensity ultrasound. This demonstrates that the sonosensitive agent combined with low-frequency, low-intensity ultrasound provided in this invention can increase LRP1 protein expression.

[0043] (4) SDT upregulates 3T3-L1-induced expression of ADPN protein and mRNA in adipocytes. This invention divides mature adipocytes into: a control group (Control group), an ultrasound-only group (Ultrasound group), a sound-sensitizing agent-only group (DVDMS group), and a sound-sensitizing agent combined with low-frequency, low-intensity ultrasound intervention group (SDT group). Adipocytes in the DVDMS and SDT groups were incubated with 0.4 μmol / L DVDMS for 12 hours. Adipocytes in the SDT group were irradiated with ultrasound once after DVDMS incubation, while adipocytes in the Ultrasound group were irradiated with ultrasound of the same intensity and duration only once.

[0044] Real-time quantitative PCR detection of ADPN was performed on the Control group, Ultrasound group, DVDMS group, and SDT group. The operation steps are as follows: Cell culture dishes were removed and placed on ice, cell supernatant was discarded, and cellular RNA was extracted using the Trizol method; the RNA concentration of each sample was measured sequentially, and the RNA concentration was adjusted to 2 μg / 20 μL. The RNA was reverse transcribed into cDNA using a TOYOBO reverse transcription kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.); the ADPN primers used for the first time were centrifuged at 12000 rpm for 2-3 minutes, and DEPC water was added to prepare a 100 μM stock solution, which was diluted 10-fold before use; the following were added to the reaction wells for amplification: 10 μL of SYBR Green, 6 μL of DEPC water, 1 μL of forward and reverse primers, and 2 μL of... PCR amplification was performed using μL of cDNA. The reaction program was as follows: pre-denaturation at 95℃ for 1 minute, 40 cycles; 95℃ for 15 seconds; 60℃ for 15 seconds; 72℃ for 45 seconds; melting curve: 95℃ for 15 seconds; 60℃ for 60 seconds; 95℃ for 30 seconds; 60℃ for 15 seconds; data were collected after PCR.

[0045] The detection targets involved in this embodiment of qPCR include ADPN and ACTIN (internal reference). The upstream primer sequence used for RT-PCR detection of ADPN is shown in SEQ ID NO.5 (GTCAGTGGATCTGACGACACCAA), and the downstream primer sequence is shown in SEQ ID NO.6 (GTCAGTGGATCTGACGACACCAA).

[0046] Western blot and real-time quantitative PCR results are as follows: Figure 9 As shown, compared with the Control group, DVDMS group and Ultrasound group, the SDT group showed a significant increase in the levels of ADPN protein and mRNA in adipocytes, while the simple sound sensitizer (DVDMS group) and the simple ultrasound group (Ultrasound group) had no significant effect.

[0047] The localization and relative expression intensity of ADPN in adipocytes were observed by immunofluorescence staining. The procedure was as follows: Cell-specific climbing slides were autoclaved and placed in 35 mm culture dishes. One drop of culture medium was added to cover the slides, and an equal volume of cells were added for adherent culture. The cells were then subjected to the appropriate intervention according to the experimental protocol. After intervention, the culture medium was aspirated, and the cells were washed three times (5 minutes each) with pre-cooled PBST. After aspirating the remaining PBST, 4% paraformaldehyde fixative was slowly added along the edge of the dish to immerse the bottom for 30 minutes. Then, 0.1% Triton X-100 was added for permeation for 30 minutes, followed by three washes with PBST. The cells were blocked with room temperature serum for 30 minutes, and then incubated overnight at 4°C with primary antibody. The next day, the climbing slides were removed, washed three times with PBST, and incubated with fluorescent secondary antibody at room temperature for 60 minutes, followed by three washes with PBST. The nuclei were then stained with DAPI for 10 minutes, followed by three washes with PBST. Finally, images were acquired under a fluorescence microscope and analyzed using ImageLab software.

[0048] Immunofluorescence results as follows Figure 10 As shown, compared with the Control, DVDMS, and Ultrasound groups, the expression level of ADPN in the cytoplasm of the SDT group was significantly increased, which is corroborated by the increased ADPN transcription level detected by RT-PCR. Therefore, the method for upregulating adiponectin in perivascular adipose tissue provided by this invention can increase the expression of ADPN protein and mRNA.

[0049] The specific embodiments of the present invention disclosed above are merely illustrative of the invention. These embodiments do not exhaustively describe all details, nor do they limit the invention to the specific embodiments described. Many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.

Claims

1. A method for upregulating adiponectin in perivascular adipose tissue, characterized in that, The method includes the following steps: administering a sonosensitive agent to adipocytes to induce an absorption and transformation reaction; and after the reaction is complete, irradiating the periphery of the target vascular segment with low-frequency, low-intensity ultrasound.

2. The method according to claim 1, characterized in that, The sonosensitive agent is a sonosensitive drug or its precursor drug.

3. The method according to claim 2, characterized in that, The sound-sensitizing agents include, but are not limited to, sodium porphyrin.

4. The method according to claim 1, characterized in that, The sound-sensitive agent is administered via intravenous injection or in vitro incubation.

5. The method according to claim 4, characterized in that, When the acoustic sensitizer is administered intravenously, the intravenous injection dose is 25 mg / kg, and irradiation treatment is performed 6 hours after the absorption and conversion reaction.

6. The method according to claim 5, characterized in that, The irradiation treatment conditions were: frequency of 1 MHz, duty cycle of 30%, and irradiation intensity of 0.4 W / cm². 2 The irradiation time is 15 minutes.

7. The method according to claim 4, characterized in that, When the acoustic sensitizer is administered via in vitro incubation, the concentration of the acoustic sensitizer is 0.4 μmol / L, and irradiation treatment is performed 12 hours after the absorption and conversion reaction.

8. The method according to claim 7, characterized in that, The irradiation treatment conditions were: frequency of 1 MHz, duty cycle of 10%, and irradiation intensity of 0.1 W / cm². 2 The irradiation time is 5 minutes.