A strain of Auricularia auricula-judae HN-7 and its application

The application of the Auricularia auricula strain HN-7 has solved the problems of insufficient growth performance and nutritional value of Auricularia auricula var. ...

CN122128105APending Publication Date: 2026-06-02SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610171698.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing varieties of hairy black fungus have shortcomings in terms of growth performance, nutritional value, and stress resistance, resulting in long production cycles, high pollution risks, and insufficient nutritional components, which affect planting efficiency.

Method used

A strain of Auricularia sp., HN-7, is provided. It has rapid mycelial growth, strong stress resistance and high nutritional value, and is suitable for cultivation and hybridization breeding of Auricularia sp. The preferred formula for the spawn bag is 35% sawdust, 30% corn cob, 20% rice bran, 10% cottonseed hull, 4% lime and 1% gypsum.

Benefits of technology

Shorten the production cycle, increase the cultivation success rate, enhance the commercial form and nutritional value, reduce the risk of pollution, enrich the germplasm resource bank, and improve planting efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128105A_ABST
    Figure CN122128105A_ABST
Patent Text Reader

Abstract

This invention discloses a strain of Auricularia auricula-judae HN-7 ( Auricularia This strain (species name) and its applications belong to the field of edible fungi technology. It was deposited at the China Center for Type Culture Collection (CGMCC) on November 14, 2025, with accession number CGMCC No. 42368. The HN-7 strain exhibits rapid mycelial growth, strong resistance to mold, small auricle bases, large leaves, numerous folds on the ventral side, and a grayish-yellow dorsal surface with prominent villi. The polysaccharide and amino acid contents in its fruiting bodies are 28.9% and 39.5% higher than the control strain 781, respectively, indicating higher nutritional value and yield. This strain has significant application value in the cultivation of Auricularia auricula-judae. It enriches the germplasm resources of Auricularia auricula-judae and helps improve the economic benefits of the Auricularia auricula-judae industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, specifically to a strain of Auricularia auricula-judae HN-7 and its applications. Background Technology

[0002] hairy wood ear ( Auricularia cornea (Berk.) sing) belongs to the class Basidiomycetes in taxonomy ( Basidaiomycetes ), Agaricalales ( Agaricales ), Auriculariaceae ( Auriculariaceae ), Auricularia ( Auricularia It is widely cultivated, rich in nutrients, delicious in taste, and has high medicinal and economic value, making it a highly valuable medicinal and edible fungus.

[0003] Currently, there are many known varieties of Auricularia auricula-judae, such as Auricularia auricula-judae 781, Amber, Auricularia auricula-judae No. 1, Auricularia auricula-judae No. 2, Auricularia auricula-judae No. 7, Auricularia auricula-judae No. 10, Auricularia auricula-judae 213, Auricularia auricula-judae 237, Fu Mao No. 2, Gui Mao No. 7, Zhong Nong Er No. 3, Su Mao No. 3, and Auricularia auricula-judae No. 10. Different varieties exhibit variations in mushroom shape and nutritional content. Therefore, breeding high-yielding, high-nutritional-value strains of Auricularia auricula-judae can enrich the germplasm resource bank, help adjust the industrial structure of Auricularia auricula-judae, and improve planting efficiency.

[0004] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a high-quality Auricularia auricula strain, which can enrich the existing Auricularia auricula germplasm resource bank, help adjust the Auricularia auricula planting structure, and improve the planting efficiency of Auricularia auricula.

[0006] To achieve the above objectives, the present invention provides a strain of Auricularia auricula-judae, HN-7, which is taxonomically named... Auricularia sp., and was deposited on November 14, 2025 at the China Center for Type Culture Collection, located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42368.

[0007] The present invention also provides the fruiting body of the aforementioned Auricularia auricula strain HN-7.

[0008] The present invention also provides spores of the aforementioned Auricularia auricula strain HN-7.

[0009] The present invention also provides the mycelium of the aforementioned Auricularia auricula strain HN-7.

[0010] The Auricularia auricula strain HN-7 provided by this invention can be used in the cultivation of Auricularia auricula.

[0011] In the cultivation of Auricularia auricula-judae, the preferred formula for the spawn bags contains the following components by weight percentage: 35% sawdust, 30% corn cob, 20% rice bran, 10% cottonseed hulls, 4% lime, and 1% gypsum.

[0012] The Auricularia auricula-judae strain HN-7 provided by this invention can also be used in Auricularia auricula-judae hybridization breeding.

[0013] The present invention has the following advantages: This invention provides a novel Auricularia auricula strain with excellent characteristics. It exhibits superior growth performance, rapid mycelial growth (up to 4.07 mm / d in the cultivated strain), and dense, vigorous mycelium, which helps shorten the production cycle and improve production efficiency. Its fruiting bodies have smaller auricular bases and wider individual leaves (average width and length increased by 8.9% and 18.1% respectively compared to the control strain 781), resulting in better commercial morphology. Furthermore, it demonstrates strong resistance to *Trichoderma harzianum* (low inhibition rate, minimal inhibition of mycelial growth), reducing the risk of contamination and increasing the success rate of cultivation during production.

[0014] The Auricularia auricula-judae strain HN-7 provided by this invention has high nutritional value. The crude polysaccharide content in the fruiting body is 28.9% higher than that of the control strain 781, resulting in higher health benefits. The amino acid content is 39.5% higher than that of the control strain 781, making it more flavorful and nutritious. The fruiting body has a harder texture, which may make it more resistant to storage and transportation, and it has better marketability, making it worthy of promotion.

[0015] The high-yielding new variety of Auricularia auricula-judae selected in this invention can enrich the existing Auricularia auricula-judae germplasm resource bank, help adjust the planting structure of Auricularia auricula-judae, and improve the planting benefits of Auricularia auricula-judae. Attached Figure Description

[0016] Figure 1 The mycelial growth of HN-7 provided by this invention in test tubes and plates.

[0017] Figure 2 This invention provides a comparison of the HN-7 and control group mushroom logs and their fruiting conditions.

[0018] Figure 3 The HN-7 sub-entity morphology provided by this invention.

[0019] Figure 4 The back villous morphology of the HN-7 sub-entity provided by this invention.

[0020] Figure 5 The HN-7 phylogenetic tree provided by this invention.

[0021] Figure 6 The ISSR identification results of HN-7 provided by this invention.

[0022] Figure 7 The results of HN-7 genetic relationship clustering analysis provided by this invention. Detailed Implementation

[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0025] Example 1: Obtaining the Auricularia auricula-judae strain HN-7 More than 20 samples of wild black fungus resources were collected from Mianyang, Ganzi, Gansu, Panzhihua and other places.

[0026] The specific steps for selecting and breeding strains collected and domesticated from the wild are as follows: (1) Isolation of wild fruiting body tissues After thoroughly drying the collected wild wood ear mushrooms, soak them for 24 hours. Select fruiting bodies that are free from disease and pests, uniform in size, and conform to the characteristics of wood ear mushrooms for tissue isolation. Soak in 75% alcohol for 2-3 minutes, rinse repeatedly with sterile water, and then blot dry with filter paper. Cut the fruiting bodies into small pieces with scissors and use an inoculation needle to transfer them to PDA plates for incubation at 25°C. After approximately 20 days of incubation, select strains with well-developed and uniform mycelial growth around the tissue blocks as effective strains. Cut off the surface tissue blocks of these effective strains and transfer them to new PDA medium. Ultimately, 20 effective strains were isolated and screened, numbered SICAU1 to SICAU20.

[0027] (2) Identification of fungal strains The selected effective strains were transfected and cultured. Vigorous strains after purification were chosen for ITS full-sequence analysis and molecular biological identification. A phylogenetic tree was then constructed using bioinformatics methods to reveal the phylogenetic relationships and genetic diversity among the strains, providing a basis for subsequent classification, identification, breeding, and resource utilization.

[0028] (3) Screening of antifungal strains A plate confrontation study was conducted on *Trichoderma harzianum* and *Auricularia auricula-judae* strains. Circular *Auricularia auricula-judae* hyphae with a diameter of approximately 8 mm were inoculated at one end of each petri dish, 10 mm from the edge. The dishes were incubated at 25°C for 6 days. Then, an activated circular *Trichoderma harzianum* hyphae with a diameter of 8 mm was inoculated at the other end of one petri dish, 1 cm from the edge. The other petri dish was left uninoculated. This process was repeated three times. After 6 days, antagonistic lines were observed between the *Auricularia auricula-judae* hyphae and *Trichoderma harzianum* hyphae in the inoculated dish. The length of the hyphae in the uninoculated dish, minus the antagonistic line, was the length of *Auricularia auricula-judae* hyphae inhibited by *Trichoderma harzianum*. Inhibition rate = (*Auricularia auricula-judae* colony radius without *Trichoderma harzianum* - inhibition length / *Auricularia auricula-judae* colony radius) × 100%. The results for some dominant strains are shown in Table 1.

[0029] Table 1. Colony radius, growth rate, and inhibition rate of dominant strains Note: SICAU7 refers to the existing screened Auricularia auricula-judae variety HN-7; mushrooms with the SICAU number are all strains with good anti-mold effects and high yields selected in the first round of screening.

[0030] (4) Determination of enzyme activity in different siblings Under liquid nitrogen assistance, the mycelium of *Auricularia auricula-judae* was ground into powder in a mortar at low temperature and then placed in an ice box. Following the kit instructions, the activities of different intracellular enzymes in strain SICAU1-8 were measured. The results are shown in Table 2.

[0031] Table 2. Enzyme activities of different dominant strains (5) Further screening of dominant strains The spawn formulation consisted of 35% sawdust, 30% corn cob, 20% rice bran, 10% cottonseed hulls, 4% lime, and 1% gypsum. Further fruiting tests were conducted on the wild-type strains screened in the previous step, measuring the growth rate of the spawn. The target dominant strain, SICAU7, was subsequently identified as HN-7. The statistical results of the growth rates of each strain are shown in Table 3.

[0032] Table 3. Growth rate of cultivated varieties (mm / d) Example 2 Identification of the strain I. Morphological characteristics 1. Mycelial morphological characteristics The mycelium of strain HN-7, screened in this invention, is dense and vigorous, initially pure white, and turns slightly light brown after a period of culture. Its morphology on plates and in tubes is as follows: Figure 1 As shown.

[0033] 2. Morphological characteristics of sub-entities The selected strain HN-7 and the commonly used Auricularia auricula-judae cultivar 781 were planted separately. The resulting spawn and fruiting conditions are shown in the figure. Figure 2 As shown. It can be observed that the ear base of *Auricularia auricula-judae* HN-7 is smaller, the ventral surface is light brown, and the dorsal surface is grayish-yellow; the ventral surface and margins have more folds, and the single leaf blade is wider, with the average width and length increasing by 8.9% and 18.1% respectively compared to 781. The morphology of the fruiting body and its dorsal surface are shown below. Figure 3 , Figure 4 .

[0034] II. Molecular biological characteristics DNA was extracted and ITS amplified from the fruiting bodies of strain HN-7, obtained from wild-type strains, using a rapid fungal DNA extraction kit. ITS sequences were further determined for other Auricularia auricula-judae fungi screened initially, as well as commonly cultivated Auricularia auricula-judae strains Amber and 781. The ITS sequence of HN-7 is shown below and uploaded to the NCBI database (ID: PX600724). A phylogenetic tree was constructed based on the identification results, as follows: Figure 5 As shown.

[0035] The ITS sequence of HN-7 (SEQ ID NO.1): ggctaagatttgggcttttacccgatcgttcagctgtgcgcccttcaccgggctgcacgctggagcaagaccccacacctgtgcaccttttcggttgcggcttcggtcgctgccgctctcaaatgcaacaactcaattcccaatggtaaccaaaccctaaaaaataaccactttccac caacgaaccccttgctccccccttcattaaaaaacccaccaaatggcgaaaataaaggggatttgggaattccatggagcctccgatcctttaaaagaacctgggccccctggtaattcctaggacaatgccgtatgaaaggtcgataaatccctcacctttggaagaaacaagatt.

[0036] Based on the above morphological characteristics and ITS sequence classification and identification studies, it has been determined that the strain HN-7 of this invention belongs to the phylum Basidiomycota (Basidiomycetes). Basidiomycota Auricularia ( ) Auriculariales ), Auriculariaceae ( Auriculariaceae ), Auricularia ( Auricularia This strain ( Auriculariasp.) HN-7 was deposited on November 14, 2025 at the China Center for Type Culture Collection (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42368.

[0037] Example 3: Comparative Analysis of Basic Traits of HN-7 and 781 The strain of *Auricularia auricula-judae* provided in this invention was analyzed from four aspects: basic characteristics of the strain, antifungal ability, crude polysaccharide content, and amino acid content. Auricularia A comparative analysis was conducted between strain HN-7 and strain 781. The basic characteristics of the strains were determined according to the "Agricultural Industry Standard of the People's Republic of China NY / T 3729—2020, Guidelines for Testing the Distinctiveness (Distinguishing), Uniformity and Stability of New Plant Varieties - Auricularia auricula-judae". The antifungal ability of Auricularia auricula-judae mycelium was determined by the plate confrontation method. The crude polysaccharide of Auricularia auricula-judae fruiting body was determined by the sulfuric acid-phenol method. The amino acid detection was performed using the ninhydrin colorimetric method.

[0038] The results are shown in Table 3. In comparison, the *Auricularia auricula-judae* strain (… Auricularia The mycelial growth rate of sp. HN-7 is relatively fast. Regarding fruiting bodies, HN-7 has smaller auricles, a light brown ventral surface, and a grayish-yellow dorsal surface; the ventral surface and margins have more folds, and the individual leaves are wider, with average width and length increasing by 8.9% and 18.1% respectively compared to 781. In terms of nutritional composition, the water content of HN-7 fruiting bodies is 78.2%, and the polysaccharide and amino acid contents are increased by 28.9% and 39.5% respectively compared to 781, indicating a richer nutritional profile.

[0039] Table 3 shows a comparison of the basic characteristics of HN-7 and the control strain. Example 4: Identification of Inter-regional Simple Repeat Sequence Markers (ISSRs) in strain HN-7 The strain was activated and cultured at 25℃ for 7 days. Inoculum blocks were picked and inoculated onto PDA medium, and cultured at 25℃ for 10 days. The hyphae were ground using liquid nitrogen and stored at -80℃ for later use. Mycelial DNA was extracted using the CTAB method. Amplification was performed on a BioRad C1000 PCR instrument. The reaction system consisted of: 10 μL of 2×T5 Super PCR MIX (Basic), 8 μL of ddH2O, 1 μL of primer (808 (SEQ ID NO.2): 5′-AGAGAGAGAGAGAGAGC-3′), and 1 μL of template DNA, for a total of 20 μL. The amplification annealing temperature was 48.7℃. After electrophoretic separation and imaging, band statistics were performed. ISSR bands were counted as 1 for those present and 0 for those absent, constructing an initial data matrix. Cluster analysis was then performed using NTSYSpc2.1 professional software.

[0040] ISSR electrophoresis patterns Figure 6 As shown, lanes 1-22 are, in order, SICAU1, SICAU2, 781, SICAU3, SICAU4, SICAU5, HN-7, SICAU6, SICAU8, SICAU9, SICAU10, SICAU11, SICAU12, SICAU13, Amber, SICAU14, SICAU15, SICAU16, SICAU17, SICAU18, SICAU19, and SICAU20. The results show that 781 has 6 bands from top to bottom, while HN-7 has 8 bands. Significant differences exist between HN-7 and 781 in band distribution, staining intensity, and band width. The 7th band of HN-7 is brighter and wider than that of 781.

[0041] Genetic relationship clustering diagrams were plotted on the band data, and the results are shown below. Figure 7 As shown, the strains are divided into two major categories at a genetic similarity coefficient of 0.87, indicating that there is a significant genetic difference between strains HN-7 and 781 of Auricularia auricula-judae.

[0042] In summary, the high-yielding new Auricularia auricula-judae variety HN-7 selected in this invention has wider single leaves, a fruiting body water content of 78.2%, and polysaccharide and amino acid contents that are 28.9% and 39.5% higher than the existing strain 781, respectively. It is also richer in nutrients, which can enrich the germplasm resource bank of Auricularia auricula-judae, help adjust the industrial structure of Auricularia auricula-judae, and improve planting efficiency.

[0043] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A strain of Auricularia auricula-judae, HN-7, characterized in that, The taxonomic name of this strain is Auricularia sp., and was deposited at the China Center for Type Culture Collection on November 14, 2025, with accession number CGMCC No. 42368.

2. The fruiting body of the Auricularia auricula-judae strain HN-7 as described in claim 1.

3. Spores of the Auricularia auricula-judae strain HN-7 as described in claim 1.

4. The mycelium of the Auricularia auricula-judae strain HN-7 as described in claim 1.

5. The application of the Auricularia auricula-judae strain HN-7 as described in claim 1 in the cultivation of Auricularia auricula-judae.

6. The application according to claim 5, characterized in that, The formula for the cultivation bags contains the following components by weight percentage: 35% sawdust, 30% corn cob, 20% rice bran, 10% cottonseed hulls, 4% lime, and 1% gypsum.

7. The application of the Auricularia auricula-judae strain HN-7 as described in claim 1 in the hybridization breeding of Auricularia auricula-judae.