Bacillus velezensis b13, biocontrol agent and application thereof

Abstract

This invention belongs to the field of microbial technology, specifically relating to a strain of Bacillus bellis B13, a biocontrol agent, and its application. The Bacillus bellis B13 described in this invention is deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 2026344. Isolated from disease-free healthy citrus fruits, it exhibits stronger adaptability to the microenvironment on the citrus surface and has less impact on the environment and humans. Bacillus bellis B13 can effectively inhibit the growth of Penicillium fingering. The results of the examples show that treatment with strain B13 significantly reduced the incidence of postharvest diseases in Cara Cara navel oranges during postharvest storage, providing a new approach for citrus disease control.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Bacillus belye B13, a biocontrol agent, and its application. Background Technology

[0002] Citrus is a vital pillar crop in the agricultural economy. Citrus green mold is the most economically impactful post-harvest disease of citrus fruits, and its causative agent is *Penicillium fingernail* (…). Penicillium digitatum Post-harvest diseases cause enormous economic losses to the global citrus industry every year, especially in arid regions and subtropical climates, accounting for 90% of total post-harvest losses of citrus fruits. This seriously threatens the economic benefits of the citrus industry. Currently, chemical control remains the most widely used core control method in integrated management of citrus post-harvest diseases. However, the use of chemical fungicides has also caused many problems. After application, some pesticides are released into the surrounding ecological environment. Although some components can be decomposed and transformed through natural processes such as photodegradation or microbial metabolism, some chemical pesticides remain in the ecosystem for a long time due to their stable chemical properties. These persistent pollutants not only disrupt the environmental balance but may also be transferred along the food chain through bioaccumulation, eventually accumulating in the human body and posing a potential threat to public health and safety. Therefore, there is an urgent need for a biocontrol strain that can effectively control citrus diseases. Summary of the Invention

[0003] The purpose of this invention is to provide a strain of Bacillus belyssus B13, a biocontrol agent, and its application. The Bacillus belyssus B13 can inhibit the growth of Penicillium finger and is used to control citrus diseases.

[0004] This invention provides a strain of Bacillus belyssus ( Bacillus velezensis B13, the Bacillus belye B13, is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: M 2026344.

[0005] The present invention also provides a biocontrol agent, wherein the active ingredient of the biocontrol agent is the fermentation broth of Bacillus belyssus B13 described in the above scheme and / or the metabolites of Bacillus belyssus B13.

[0006] As a preferred embodiment, the OD of the fermentation broth 600 The value is 1.0 to 3.0.

[0007] As a preferred embodiment, the preparation of the fermentation broth includes: inoculating the Bacillus belye B13 into a fermentation medium and culturing with shaking to obtain the fermentation broth.

[0008] As a preferred embodiment, the metabolite comprises the fermentation supernatant of the Bacillus belye B13.

[0009] The present invention also provides the application of Bacillus belyssus B13 or the biocontrol agent described above in the control of pathogens, including Penicillium fingerlings.

[0010] The present invention also provides the application of Bacillus berberis B13 or the biocontrol agent described above in the control of citrus diseases.

[0011] As a preferred embodiment, the citrus disease includes green mold.

[0012] The present invention also provides a method for preventing and controlling postharvest diseases of citrus, by treating citrus fruits with Bacillus berleis B13 or the biocontrol agent described in the above scheme.

[0013] As a preferred embodiment, the treatment includes soaking and / or spraying; the soaking time is 1 to 3 minutes.

[0014] Beneficial effects: This invention provides a strain of Bacillus belyssus (B. belyssus) Bacillus velezensis B13, the *Bacillus berleis* strain described in this invention, is deposited at the China Center for Type Culture Collection (CCTCC), accession number M 2026344. This *Bacillus berleis* strain B13 was isolated from disease-free, healthy citrus fruits. It exhibits stronger adaptability to the microenvironment of citrus surfaces and has less impact on the environment and humans. *Bacillus berleis* strain B13 can effectively inhibit the growth of *Penicillium fingering*. The results of the examples show that treatment with strain B13 significantly reduced the incidence of postharvest diseases during citrus storage, providing a new approach for citrus disease control. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0016] Figure 1 The results of strain B13 identification are shown; where A is a colony morphology diagram of strain B13; and B is a phylogenetic tree of strain B13. Figure 2 The graph shows the inhibitory effect of strain B13 on Penicillium fingerlings. Figure 3 The image shows the inhibitory effect of the metabolites of strain B13 on Penicillium digitatum in Example 4; where A~C are the colony diameters when the volume concentration of the metabolites of strain B13 is 1%, 3% and 5% respectively; D is a colony diagram of Penicillium digitatum. Figure 4 The control effect of strain B13 on Penicillium fingering on citrus (puncture inoculation) in Example 5 is shown; where A is Wenzhou mandarin orange; B is Newhall navel orange. Figure 5The control effect of strain B13 on Penicillium fingering on Cara Cara navel oranges in Example 5 (inoculation by puncture and fruit dipping); where A is the diameter of the lesion; B is a picture of a Cara Cara navel orange. Figure 6 The incidence rate of postharvest diseases in citrus in Example 6; In the figure, ns indicates that the data show no significant difference; express p <0.05, express p <0.001; express p <0.0001.

[0017] Biological Preservation Instructions Strain B13, classified as Bacillus belesiensis Bacillus velezensis It was deposited on February 4, 2026 at the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 2026344. Detailed Implementation

[0018] This invention provides a strain of Bacillus belyssus ( Bacillus velezensis B13, the Bacillus belye B13, is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: M 2026344.

[0019] The *Bacillus berleis* B13 (hereinafter referred to as strain B13) described in this invention has raised, milky-white colonies with a wrinkled, dry surface, producing mucus, and is opaque and irregular. *Bacillus berleis* B13 was isolated from disease-free, healthy citrus fruits. It exhibits stronger adaptability to the microenvironment of citrus surfaces and has less impact on the environment and humans. *Bacillus berleis* B13 can effectively inhibit the growth of *Penicillium fingering*. The results of the examples show that treatment with strain B13 significantly reduced the incidence of postharvest diseases during the postharvest storage of citrus, providing a new approach for the control of citrus diseases.

[0020] The present invention also provides a biocontrol agent, wherein the active ingredient of the biocontrol agent is the bacterial cells of Bacillus belyssus B13 described in the above scheme and / or the metabolites of Bacillus belyssus B13.

[0021] In one embodiment, the bacterial cells comprise the fermentation broth and / or suspension of *Bacillus belye* B13. In another embodiment, the OD of the fermentation broth... 600The value is 1.0~3.0. In a specific embodiment of the present invention, the OD value of the fermentation broth is... 600 The value can be any value from 1.0 to 3.0, for example, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0. As one embodiment, the preparation of the fermentation broth includes: inoculating the *Bacillus belye* B13 into a fermentation medium and then shaking the culture to obtain the fermentation broth. As one embodiment, the fermentation medium includes LB medium. As one embodiment, the inoculum size of *Bacillus belye* B13 is 1%. As one embodiment, the shaking culture temperature is 28°C; the shaking rotation speed is 150 r / min; and the shaking culture time is 24 h.

[0022] In one embodiment, the metabolite comprises the fermentation supernatant of *Bacillus belyssae* B13. In another embodiment, the preparation of the fermentation supernatant includes: centrifuging the fermentation broth of *Bacillus belyssae* B13, filtering the supernatant, and obtaining the fermentation supernatant. In another embodiment, the centrifugation speed is 7000 r / min; the centrifugation time is 8 min; the filtration is membrane filtration; and the pore size of the membrane is 0.22 μm. The preparation of the fermentation broth has been discussed above and will not be repeated here. This invention uses a cell-free fermentation supernatant to prepare a biocontrol agent, which is highly safe, environmentally friendly, and can be directly applied to plants, stably exerting its antibacterial effect; it also effectively avoids contamination by other microorganisms and degradation of active ingredients; compared to live bacterial agents, it has a longer shelf life and is easier to store and transport. In another embodiment, the volume concentration of the metabolite is ≥1%, for example, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or 30%. The results of the examples show that the metabolites produced by strain B13 have a strong inhibitory effect on Penicillium digitatum. When the volume concentration of the metabolites is 10%, the inhibition rate of strain B13 on Penicillium digitatum can reach 100%.

[0023] This invention also provides the application of *Bacillus bellis* B13 or the biocontrol agent described above in the control of citrus diseases. In one embodiment, the pathogen of the citrus disease includes *Penicillium fingernail*. In another embodiment, the citrus disease includes green mold. The *Bacillus bellis* B13 of this invention can effectively inhibit the growth of *Penicillium fingernail* and inhibit spore germination. The results of the examples show that *Bacillus bellis* B13 can effectively control postharvest diseases of citrus, providing a new green approach to the control of citrus diseases.

[0024] This invention also provides a method for preventing postharvest diseases of citrus, using *Bacillus beryl* B13 or the biocontrol agent described in the above-described scheme to treat citrus fruits. As one embodiment, the treatment includes soaking and / or spraying; the soaking time is 1-3 minutes. In a specific embodiment of this invention, the soaking time can be any value within 1-3 minutes, for example, 1, 1.5, 2, 2.5, or 3 minutes. By soaking the citrus fruits for an appropriate time, this invention allows the surface of the citrus fruits to fully contact *Bacillus beryl* B13 or the biocontrol agent. As one embodiment, the spraying includes spraying the citrus fruits with *Bacillus beryl* B13 or the biocontrol agent described in the above-described scheme. In a specific embodiment of this invention, the spraying period includes before and / or after citrus harvesting. This invention does not specifically limit the dosage of the spray; simply moistening the surface of the citrus fruit is sufficient.

[0025] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0026] The culture medium and reagents involved in this invention are as follows: LB medium (Luria Bertani): yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L, pH adjusted to 7.0. Sterilized at 121°C for 20 min.

[0027] PDA medium: potato extract, glucose 20 g / L, agar 12 g / L, add distilled water to 1 L, sterilize at 121℃ for 30 min; Potato extract: 200 g of sliced ​​potatoes are added to 1 L of distilled water and heated to boiling for 10 min. The residue is removed by filtration and the filtrate is collected to obtain potato extract.

[0028] Imazalil: Brand name: Longdeng ® Rich and happy ® The product is in emulsifiable concentrate form, with an active ingredient content of 450 g / L for imazalil.

[0029] Baikede: The active ingredient is biguanide trioctylbenzene sulfonate, and the product formulation is 40% wettable powder; purchased from Japan Soda Co., Ltd.

[0030] Example 1 (1) Isolation of strain B13 Take 2-3 disease-free Ponkan orange fruits, place them in a sterilized bag, add 180 mL of PBS, seal the bag tightly, and shake on a shaker at 110 r / min and 27℃ for 40 min. After shaking, centrifuge the PBS in the bag at 8000 r / min for 8 min, dilute the precipitate, and spread it onto LB medium. After spreading, incubate the medium at 28℃. After the culture medium shows bacterial growth, streak plating is performed to obtain single colonies of strain B13, with the colony morphology as shown in the image. Figure 1 As shown in Figure A.

[0031] (2) Identification of strain B13 Add 800 μL of LB broth to a 2 mL centrifuge tube for incubation; pick a single colony of strain B13 from step (1) and place it in a 2 mL centrifuge tube, incubate at 28℃ and 150 r / min for 24 h until the LB broth becomes turbid. Take 1 μL of bacterial culture as a DNA template for PCR amplification: amplify the 16S rDNA fragment (SEQ ID NO.1) of strain B13 using universal bacterial primers 27F and 1492R; amplify the housekeeping gene of strain B13 using primers gyrB-F and gyrB-R. gyrB (SEQ ID NO.2); The primer sequences used are as follows: 27F (SEQ ID NO.3): 5′-AGAGTTTGATCCTGGCTCAG-3′; 1492R (SEQ ID NO. 4): 5′-GGTTACCTTGTTACGACTT-3′; gyrB-F (SEQ ID NO.5): 5′-ATTCCRGTCGGTATTCA-3′; gyrB-R (SEQ ID NO. 6): 5′-GCAGAGTCACCCTCAWCGAT-3′.

[0032] The PCR reaction system (25 μL) is as follows: Mix 12.5 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, DNA template 1 μL, and double-distilled water to make up to 25 μL.

[0033] The PCR reaction procedure is as follows: 95℃ for 5 min pre-denaturation, 30 cycles of 95℃ for 30 s denaturation and 72℃ for 80 s combined annealing / extension, final extension at 72℃ for 5 min followed by storage at 16℃; Butler Gene gyrB Sequencing method: denaturation at 56℃ for 30 s, extension at 72℃ for 1 min, 30 cycles, extension at 72℃ for 5 min.

[0034]

[0035] strain B13 gyRbGene sequence (SEQ ID NO.2): 5′-GAGTCTCATGACCGTTCTCCACGCCGGCGGTAAATTTGACGGAAGCGGATATAAAGTATCCGGCGGTCTTCACGGTGTAGGGGCATCCGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGAAAAATCCATTATCAGGCGTACGAGCGCGGTGTACCTGTGGCCGATCTTGAAGTGATCGGCGAAACTGATAAGACCGGAACGATTACGCACTTCGTTCCGGACCCGGAAATTTTCAAAGAAACAACTGTATATGACTATGATCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATTGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACAAATAATATCAACACATACGAAGGCGGCACGCACGAGGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACCAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCGGCGAAAAAAGCCCGGGAATTGACCCGGCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGCGGACTGTCCTCTAA-3′。

[0036] Will get gyRb Gene sequences were aligned using BLAST in the NCBI database, and a phylogenetic tree was constructed using maximum likelihood (ML) with MEGA11 software. The outgroup was selected from *E. coli* K-12. Escherichia coli K-12), the results are as follows Figure 1 As shown in Figure B. Strain B13 and... Bacillus velezensis They clustered together. Therefore, strain B13 was identified as Bacillus belye (B. belye). B. velezensis ).

[0037] Strains of strain B13 have single, raised, milky-white colonies with a wrinkled, dry surface, produce mucus, and are opaque and irregular. Figure 1 The strain B13 was deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2026344.

[0038] Example 2: Inhibitory effect of strain B13 on pathogens A single colony of strain B13 from Example 1 was inoculated onto LB medium and cultured at 28°C and 150 r / min for 24 h to obtain strain B13 bacterial culture (i.e., fermentation broth). OD 600 The value is 1.5.

[0039] Penicillium finger ( Penicillium digitatum Strain Pd-1 (published in the literature [SirichaiChaimunko, Screening antagonistic bacteria for the control of citrus green mold. Huazhong Agricultural University, dissertation, 2020]) was inoculated onto PDA plates and cultured at 25℃ for 5 days. Double-distilled water was added to the PDA plates, the plates were shaken thoroughly, and the mixture was continuously aspirated using a pipette. The aspirate was then filtered through lens paper to obtain a solution of *Penicillium fingeringense* spores, which was adjusted to a concentration of 1×10⁻⁶. 6 / mL. Add 10 μL of *Penicillium fingeringense* spore suspension to 100 mL of cooled but not solidified PDA medium. Pour the PDA medium containing the spore suspension evenly into a petri dish to obtain a PDA plate containing *Penicillium fingeringense* spore suspension. After the plates have air-dried, randomly divide them into two groups and process them as follows: B13 treatment group: 3 μL of the prepared strain B13 bacterial solution was added dropwise to the middle of a PDA plate containing Penicillium finger spore solution and placed in an incubator at 25℃ for incubation; CK group: The procedure was the same as the B13 treatment group, except that 3 μL of LB medium was added.

[0040] The two groups of culture media were placed in an incubator at 25°C and incubated for 3 days. The results are shown below. Figure 2 The results showed that strain B13 could inhibit the growth of Penicillium fingerlings.

[0041] Example 3: Inhibitory effect of strain B13 metabolites on pathogens Add 800 μL of LB liquid culture to a 2 mL centrifuge tube, pick a single colony of B13 from Example 1 and place it in a 2 mL centrifuge tube. After incubating at 28°C and 150 r / min for 24 h, transfer 100 μL of the bacterial culture to an Erlenmeyer flask containing 100 mL of LB liquid culture medium. Incubate at 28°C and 150 r / min for 24 h, then centrifuge at 7000 r / min for 8 min. Filter the filtrate through a 0.22 μm bacterial filter to obtain the metabolites of strain B13, namely the fermentation supernatant.

[0042] Metabolites of strain B13 were mixed with PDA solid medium and poured into plates, each plate containing 10 mL of medium. The volume concentrations of the metabolites of strain B13 in the medium were set at 1%, 3%, 5%, 10%, 20%, and 30%, respectively, and this was designated as the B13 treatment group. Simultaneously, liquid LB was added to PDA as a control (CK), with the volume concentrations of liquid LB in the PDA medium for the control group being 1%, 3%, 5%, 10%, 20%, and 30%, respectively.

[0043] 100 μL of *Penicillium fingeringense* spore suspension from Example 2 was spread onto a new PDA plate. After drying with moisture, the culture medium was incubated at 25°C for 24 h to obtain *Penicillium fingeringense* culture. 6 mm diameter circular mycelial discs were taken from the tips of the *Penicillium fingeringense* hyphae and inoculated onto plates of the B13 and CK treatment groups, respectively. The plates were incubated at 25°C, with each treatment repeated three times. After 5 days, the colony diameter was recorded and the inhibition rate was calculated. The inhibition rate was calculated using the following formula: Inhibition rate (%) = [(CK colony diameter - treated colony diameter) / (CK colony diameter - mycelial block diameter)] × 100%.

[0044] Test results as follows Figure 3 As shown in Table 1, when the metabolites of strain B13 were 1%, 3%, and 5% after 24 h of culture, the inhibition rates of strain B13 against Penicillium digitatum were 15.53%, 45.93%, and 74.64%, respectively. Figure 3 (A~C); at concentrations of 10%, 20%, and 30%, strain B13 showed a 100% inhibition rate against Penicillium fingering. Figure 3 (D). The results showed that the metabolites produced by strain B13 had a strong inhibitory effect on Penicillium fingering.

[0045] Table 1. Diameter of Penicillium finger colonies

[0046] Example 4: Inhibitory effect of strain B13 on Penicillium finger spores B13 treatment group: 190 μL of *Penicillium fingeringense* spore solution from Example 2 was added to a 2 mL centrifuge tube. Then, 10 μL of strain B13 from Example 2 was added to the centrifuge tube containing *Penicillium fingeringense* spores. The centrifuge tubes were then placed in an incubator at 25°C and 150 r / min for 12 h. Spore germination was observed under a microscope after incubation.

[0047] Control group: The procedure was the same as the experimental group, except that the bacterial culture of strain B13 was replaced with an equal volume of liquid LB medium. The culture was carried out at 25℃ with shaking at 150 r / min, and spore germination was measured after 12 h.

[0048] For each treatment, at least 100 spores were observed, the total number of spores and the number of germinating spores were counted, and the spore germination rate and inhibition rate were calculated.

[0049] Spore germination rate (%) = number of germinating spores / total number of spores × 100%; Spore germination inhibition rate (%) = [(control spore germination rate) - (treatment spore germination rate) / control spore germination rate] × 100.

[0050] The results showed that the germination rate of Penicillium digitatum spores in the control group reached 30% at 12 h, while the germination rate of Penicillium digitatum spores in the B13 treatment group was only 2%, indicating that the biocontrol bacteria B13 has an inhibitory effect on Penicillium digitatum spores.

[0051] Example 5: Control of Citrus Green Mold Disease by Straw B13 The control effect of strain B13 on citrus green mold was determined by puncture inoculation and puncture-dip inoculation methods.

[0052] (1) Puncture wound inoculation Newhall navel oranges and Wenzhou tangerines (both from Yichang, Hubei) were used as raw materials. The surface of the citrus fruits was disinfected for 1 minute with 84 disinfectant (1:50 dilution), and then washed three times with double-distilled water. After washing, a 3 mm deep wound was pierced into the equatorial side of the citrus fruit. The treated citrus fruits were randomly divided into two groups, with 8 fruits treated in each group. The specific grouping is as follows: B13 treatment group: Take 20 μL of B13 bacterial suspension from Example 2 and inoculate it at the wound site of citrus; 2 h later, take another 20 μL of Penicillium fingerling spore suspension from Example 2 (1×10⁻⁶). 6 Inoculate the wound with a concentration of 100 mL / mL and incubate in an environment of 25°C and 85%–90% relative humidity to observe the incidence of green mold.

[0053] Control group: The procedure was the same as the B13 treatment group, except that 20 μL of LB liquid culture medium and 20 μL of 1×10⁻⁶ oz. were inoculated at the wound site. 6 / mL of Penicillium finger spore liquid.

[0054] Four days later, the diameter of lesions, incidence rate, and control effect on the citrus fruits of the two groups were recorded respectively. The calculation formula is as follows: Incidence rate (%) = Number of cases / Total number of cases × 100.

[0055] Prevention and control effect (%) = (incidence rate of negative control - incidence rate of treatment) / incidence rate of negative control × 100.

[0056] The results are as follows Figure 4 As shown in the figure. The results indicated that strain B13 exhibited good biological control effects on different citrus varieties. In the puncture test on Wenzhou mandarins, after 4 days, the incidence rate in the control group was 100%, while the incidence rate in the strain B13 treatment group was 50%, achieving a control effect of 84.3%. In the experiment on Newhall navel oranges, the results showed that after 4 days, the incidence rate in the control group was 100%, while the incidence rate in the strain B13 treatment group was 12.50%, achieving a control effect as high as 96.37%.

[0057] (2) Inoculation by puncturing and dipping the fruit Cara Cara navel oranges (from Yichang, Hubei Province) were used as the subjects. The surface of the citrus fruits was disinfected for 1 minute with 84 disinfectant (1:50 dilution), then rinsed three times with double-distilled water and air-dried. A 3 mm deep wound was then pierced into the equatorial side of the citrus fruit. The treated citrus fruits were randomly divided into two groups, with 8 fruits treated in each group. The specific grouping is as follows: B13 treatment group: Citrus fruits were soaked in OD 600 Inoculate the bacterial suspension of strain B13 (value = 2.3) for 1 min, air dry, and then inoculate with 20 μL of a 1×10⁻⁶ solution. 6 / mL of Penicillium finger spore liquid.

[0058] Control group (CK): The procedure was the same as the B13 treatment group, except that the citrus fruits were soaked in liquid LB medium.

[0059] The two groups of citrus fruits were placed at room temperature to observe the disease development. After 4 days, the diameter of lesions, the incidence rate, and the control effect were recorded. The results are as follows: Figure 5 As shown. After 4 days, the incidence of green mold in the control group was 100%, while the incidence of green mold in the group treated with strain B13 was 50%; the diameter of lesions in Cara Cara navel oranges was 50.4 mm, and the diameter of lesions in the CK group was 16.4 mm. The control effect of strain B13 on green mold was 67.46%.

[0060] Example 6: Control of postharvest diseases in citrus by strain B13 Cara Cara navel oranges from Hubei Province, with uniform fruit size, free from pests and diseases, deformed fruit, and mechanical damage, were selected as the subjects. They were randomly divided into 4 groups, with 100 fruits treated in each group. To reduce inoculation error, each group was repeated 3 times. The specific groupings are as follows: Group B13: The strain B13 from Example 1 was inoculated into LB liquid medium and cultured by shaking at 28°C and 150 r / min to obtain OD. 600 B13 bacterial culture with an OD value of 2.3. 600 Citrus fruits were soaked in a B13 bacterial solution of 2.3 for 1 minute, and then air-dried naturally before being bagged and stored at room temperature. This solution was labeled B13. Positive control group: The procedure was the same as that of group B13, except that the citrus fruits were soaked in a mixture of imazalil (300 ppm) and bacitracin (300 ppm) for 1 min, which was recorded as imazalil + bacitracin. Negative control group: The procedure was the same as that of group B13, except that the citrus fruits were soaked in water for 1 minute, which was recorded as water. Blank control group: directly bagged and stored at room temperature, denoted as CK.

[0061] The citrus fruits from each group were stored at room temperature. The incidence rates and cumulative incidence rates of each disease were statistically analyzed on days 7, 14, 21, and 28. The diseases were also identified. The results are as follows: Figure 6 As shown.

[0062] The results showed that the incidence rates on day 28 were as follows: water treatment 38.00%, direct bagging (CK) 35.33%, mixed treatment with prochloraz and bacitracin 11.67%, and strain B13 treatment 14.33%. The incidence rate in the strain B13 treatment group was not significantly different from that in the mixed treatment group with prochloraz and bacitracin. p >0.05). Compared with water treatment, strain B13 achieved a control efficacy of 62.29%, while the control efficacy of the mixed treatment of prochloraz and chlorpyrifos was 69.29%. Treatment with strain B13 significantly reduced the incidence of postharvest diseases in CaraCara navel oranges during postharvest storage, indicating that strain B13 has biocontrol potential.

[0063] In summary, strain B13 can effectively inhibit the growth of Penicillium finger and is used to control citrus diseases.

[0064] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Bacillus belye ( Bacillus velezensis B13, characterized in that, The Bacillus belyssus B13 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2026344.

2. A biocontrol agent, characterized in that, The active ingredient of the biological agent is the fermentation broth of Bacillus vesiculus B13 as described in claim 1 and / or the metabolites of Bacillus vesiculus B13.

3. The biocontrol agent according to claim 2, characterized in that, The OD of the fermentation broth 600 The value is 1.0 to 3.

0.

4. The biocontrol agent according to claim 3, characterized in that, The preparation of the fermentation broth includes: inoculating the Bacillus belye B13 into a fermentation medium and culturing with shaking to obtain the fermentation broth.

5. The biocontrol agent according to claim 2, characterized in that, The metabolites include the fermentation supernatant of the Bacillus belyssus B13.

6. The application of Bacillus belyssus B13 as described in claim 1 or the biocontrol agent as described in any one of claims 2 to 5 in the control of pathogens, wherein the pathogens include Penicillium fingerlings.

7. The application of Bacillus belyssus B13 as described in claim 1 or the biocontrol agent as described in any one of claims 2 to 5 in the control of citrus diseases.

8. The application according to claim 7, characterized in that, The citrus diseases mentioned include green mold.

9. A method for preventing and controlling postharvest diseases of citrus, characterized in that, Citrus fruits are treated with Bacillus berreatus B13 as described in claim 1 or the biocontrol agent as described in any one of claims 2 to 5.

10. The method according to claim 9, characterized in that, The treatment includes soaking and / or spraying; the soaking time is 1 to 3 minutes.

Images