A method for genetic transformation and gene editing applicable to multiple species of achenes

Abstract

This invention discloses a genetic transformation and gene editing method applicable to multiple sesquiterpene species, belonging to the field of plant genetic transformation and gene editing technology. The method uses the cotyledonary nodes of sterile seedlings of the sesquiterpene genus as explants, and introduces an optimized pScEF1α-Cas9 gene editing transformation vector using Agrobacterium infection. Regenerated plants are obtained through recovery culture, selection culture, and rooting culture. The vector contains four gene expression units: pScEF1α:Cas9, pGmU6:sgRNA, pGmUBI:DsRed2, and pCaMV35S:HygR. In vivo screening is further performed using the DsRed2 fluorescent reporter gene, and the gene-edited plants are identified by molecular detection. This method is applicable to common sesquiterpene, stem-nodled sesquiterpene, and spiny sesquiterpene, and has advantages such as strong species versatility, high transformation efficiency, short cycle, visualized screening, and high positive rate, providing efficient technical support for gene function research and genetic improvement of sesquiterpene species.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic transformation and gene editing technology, specifically relating to a highly efficient genetic transformation and gene editing method for sesbania, and more particularly to a highly efficient genetic transformation and gene editing method applicable to multiple sesbania species. Background Technology

[0002] Sesbania cannabina is a plant belonging to the genus Sesbania in the legume family. Plants in this genus generally possess excellent characteristics such as tolerance to waterlogging, salinity, and poor soil conditions. They have high biomass and high protein content, making them both high-quality protein forage and excellent green manure crops for improving saline-alkali land. They are distributed and used in many southern provinces of my country. With the expansion of Sesbania cultivation, the need for trait improvement and functional research using modern biotechnology (especially gene editing technology) is becoming increasingly urgent.

[0003] Patent document CN115710589A (hereinafter referred to as Document 1) discloses a genetic transformation method for common sesbania (Sesbania cannabina). This method uses sterile cotyledons and hypocotyls as explants, inducing dedifferentiation to form callus tissue after infection with Agrobacterium, and then redistributing it to form regenerated seedlings. However, the transformation efficiency of the method described in Document 1 is low, only 5%-12%, and requires a complete dedifferentiation and redifferentiation process, which is time-consuming, complex, and does not involve gene editing methods. On the other hand, this method is limited to common sesbania (Sesbania cannabina), which is species-limited and difficult or impossible to apply to other sesbania species. Patent document CN119709838A (hereinafter referred to as Document 2) discloses a highly efficient genetic transformation method for stem-nodular sesbania (Sesbania rostrata). This method uses cotyledonary nodes as explants, directly inducing adventitious bud formation after infection with Agrobacterium. However, the method disclosed in Document 2 suffers from species limitation, and the transformation efficiency is only about 25%, and it does not involve gene editing technology.

[0004] Therefore, there is an urgent need to establish a systematic approach for efficient genetic transformation and gene editing applicable to multiple species of sesbania, providing technical reserves for basic research and biotechnology breeding of sesbania. Summary of the Invention

[0005] Sesbania species are important green manure and forage resources, but their genetic improvement is severely hampered by the lack of efficient and universal genetic transformation and gene editing systems. Existing technologies (such as CN115710589A) have established genetic transformation methods for common sesbania, but suffer from low transformation efficiency (5%-12%), the need to undergo a callus stage, long cycles, and strong species limitations. Subsequent technologies (such as CN119709838A) have improved the transformation efficiency of stem-nodled sesbania, but remain limited to a single species and do not involve gene editing. Therefore, there is an urgent need in this field for a sesbania genetic transformation method that is applicable across species, has high transformation efficiency, and integrates gene editing functions.

[0006] To address the aforementioned technical problems, this invention provides a genetic transformation and gene editing method applicable to multiple sesame species, the core of which lies in combining an optimized and efficient transformation process with a dedicated gene editing tool system.

[0007] In summary, the method of the present invention includes the following steps: (1) Using the cotyledonary nodes of sterile seedlings of the genus *Senecio* as explants, the pScEF1α-Cas9 gene editing transformation vector was introduced into them using the *Agrobacterium* infection method, and regenerated plants were obtained by culturing. The pScEF1α-Cas9 gene editing transformation vector was constructed on the backbone of the *Agrobacterium* transformation vector pCambia3301, and contained the following four sequentially arranged gene expression units in its T-DNA region: pScEF1α: Cas9; pGmU6: sgRNA; pGmUBI: DsRed2; pCaMV35S: HygR; wherein, the nucleotide sequence of pScEF1α is shown in SEQ ID NO: 1; the nucleotide sequence of Cas9 is shown in SEQ ID NO: 2; the nucleotide sequence of pGmU6 is shown in SEQ ID NO: 3; the nucleotide sequence of sgRNA is shown in SEQ ID NO: 4; the nucleotide sequence of pGmUBI is shown in SEQ ID NO: 5; and the nucleotide sequence of DsRed2 is shown in SEQ ID NO: 5. As shown in SEQ ID NO: 6; the nucleotide sequence of pCaMV35S is shown in SEQ ID NO: 7; the nucleotide sequence of HygR is shown in SEQ ID NO: 8; (2) The regenerated plants were initially screened in vivo using the pScEF1α-Cas9 gene editing transformation vector containing the DsRed2 fluorescent reporter gene to obtain transformed regenerated plants. (3) Molecular detection was performed on the target gene of the transformed and regenerated plant to identify the gene-edited regenerated plant.

[0008] Preferably, the Agrobacterium infection method in step (1) is an Agrobacterium infection method with vacuum assistance.

[0009] Preferably, the vacuum-assisted treatment conditions are a pressure of 0.07 MPa and a treatment time of 10 minutes.

[0010] Preferably, in step (1), the culture process includes: culturing the infected explants in a recovery medium containing 1-2 mg / L 6-BA until adventitious shoots emerge.

[0011] Preferably, the adventitious buds are transferred to a selection medium containing 1-2 mg / L 6-BA and 5-10 mg / L hygromycin for selection culture until clustered buds are produced.

[0012] Preferably, when the resistant buds grow to 3-5 cm, they are rooted in a rooting medium containing 5-10 mg / L hygromycin.

[0013] Preferably, the sgRNA targets the ScTFL1 gene of sesquiterpenoids, and the nucleotide sequence of the ScTFL1 gene is shown in SEQ ID NO:9.

[0014] Preferably, the nucleotide sequence of the pScEF1α-Cas9 gene editing transformation vector is shown in SEQ ID NO: 10.

[0015] Preferably, the *Senecio* species is *Senecio vulgaris*, *Senecio spp.*, or *Senecio spp.*

[0016] In some preferred embodiments of the present invention.

[0017] (1) ScTFL1 target selection Based on the genomic information of sesquiterpene, the ScTFL1 gene was identified and screened. Targets were then screened using CRISPR-P 2.0. Based on the score and the location of the target, one target was selected: ScTFL11.

[0018] (2) Construction of gene editing vectors Currently, genetic transformation of leguminous dicotyledonous plants faces challenges due to difficulties, low efficiency, and strong genotype dependence. However, in species such as soybean, transformation efficiencies exceeding 80% have been achieved, and editing events can be derived from a few transformation events. No gene editing technologies have been reported for sesbania. This invention aims to establish a sesbania gene editing system and simultaneously improve Cas9 expression in sesbania. Using an Agrobacterium rhizogenes-mediated rhizogenes transformation system, the ScEF1α promoter, which efficiently expresses the Cas9 gene in sesbania, was screened. Hygromycin resistance significantly improved regeneration and transformation efficiency. Among these, Figure 1The gene-editing vector was modified from pCambia3301 and mainly contains four gene units in the following order from the left boundary of T-DNA: pScEF1α: Cas9, pGmU6: sgRNA, pGmUBI: DsRed2, and pCaMV35S: HygR, and is named pScEF1α-Cas9. The soybean UBI gene promoter expresses DsRed2, pGmUBI: DsRed2; the cauliflower virus 35S promoter expresses the hygromycin resistance gene HygR, pCaMV35S: HygR.

[0019] (3) Agrobacterium-mediated genetic transformation of sesquiterpene Straw-mediated genetic transformation of sesbania yields regenerated plants through rapid induction of shoot clusters. The selected explants are cotyledonary nodes, which are easy to obtain and preserve. The transformation process is simple and the cycle is short, with only 2.5-3 months from obtaining the explants to transplanting the regenerated plants. The basic culture medium formula used is listed in Table 1.

[0020] Table 1: Culture media used in the genetic transformation experiment of Agrobacterium sesquiterpenoids

[0021] (1) Activation of Agrobacterium: Agrobacterium carrying the target gene vector was removed from a -80℃ freezer. A small amount of Agrobacterium was streaked onto a solid LB agar plate containing the appropriate antibiotic and incubated in the dark at 28℃ for 2 days. A single colony was picked and inoculated into 1 mL of LB liquid medium and incubated overnight. Vector PCR was performed on the bacterial culture to confirm that the strain carried the target gene vector. The bacterial culture was then reactivated at a 1:100 inoculum ratio. The bacterial culture was added to 5 mL of liquid LB medium containing the appropriate antibiotic and incubated at 28℃ with shaking at 220 rpm for approximately 14 hours. When the bacterial concentration reached OD600 = 0.6, 1 mL of the bacterial culture was evenly spread onto a solid LB agar plate containing the appropriate antibiotic and incubated in the dark at 28℃ for 2 days. The bacterial cells were then washed with infection solution and resuspended, and the bacterial concentration was adjusted to OD600 = 0.6 for explant transformation.

[0022] (2) Preparation of sesquiterpene-transformed explants: Select approximately 500 healthy, plump, recently harvested, and uniformly colored mature sesame seeds. Soak them in concentrated sulfuric acid for 30-40 minutes, rinse with clean water, and air-dry the seed coats. Arrange the dried sesame seeds in a single layer in a petri dish. Place the desiccator containing the petri dishes in a fume hood, and open all the petri dishes, placing a 250 mL beaker in the center. Add 200 mL of sodium hypochlorite to the beaker, then slowly add 20 mL of concentrated HCl along the side of the beaker. Immediately cover the desiccator. After approximately 10 hours, add another 10 mL of concentrated HCl. After another approximately 14 hours, cover the petri dishes and place them in a laminar flow hood. Open the petri dishes for approximately 3-5 hours to remove excess chlorine (total sterilization time 24 hours). Remove the petri dishes and transfer the seeds to new petri dishes lined with sterile filter paper. Add sterile water and incubate at 28°C for 1 week to obtain sterile sesame seedlings. Take a section of hypocotyl from the cotyledon of a sterile sesame seedling and cut it off, leaving 0.8-1.2 mm of hypocotyl. Divide the sesame cotyledon into two evenly along the hypocotyl, then cut off the upper half of the cotyledon, scrape off the apical bud and growing point, and make 8-10 incisions in the meristematic area of ​​the cotyledon to obtain the sesame explant.

[0023] (3) Agrobacterium infection and co-culture: The prepared explants were immersed in Agrobacterium infection solution, vacuum treated at 0.07 MPa for 10 min, and cultured in a constant temperature shaker at 28°C and 180 rpm for 30 min. After that, the infected explants were removed and the surface liquid was wiped off with sterile filter paper. The cotyledons were then placed evenly on a co-culture medium covered with filter paper with the cotyledon plane facing down. The explants were cultured in the dark at 25±2°C for about 4-5 days.

[0024] (4) Resume culture: Remove the explants that have completed co-culture, insert them at a 45-degree angle with the wound side facing up into the selection medium, and culture them for 1-2 weeks under conditions of 25±2 ℃ light, 16 / 8h photoperiod, and 55% humidity until adventitious buds emerge.

[0025] (5) Screening and cultivation: Collect explants after recovery culture, remove the remaining cotyledons and the dark brown basal surface tissue, transfer them to selection medium, and culture them at 25±2℃ with a photoperiod of 16 / 8h and a humidity of 55%. Replace the medium every 3-4 weeks until a large number of clustered shoots are produced.

[0026] (6) Resistant bud rooting culture: When the young shoots grow to 3-5cm, cut the resistant shoots from the base and insert them into the rooting medium and culture them under light at 25±2℃ for 2-3 weeks until the plant height is ≥8cm.

[0027] (7) Hardening off and transplanting of resistant regenerated plants: When the resistant regenerated seedlings grow to more than 8 cm and the roots are more than 3 cm long, open the culture bottle cap and add a small amount of sterile water. Harden the seedlings for 36 hours, carefully remove the plants with tweezers, rinse the roots with clean water to completely remove the culture medium, transplant them into nutrient soil, cover and keep moist until new leaves grow.

[0028] (8) Transgenic positive detection and editing detection of regenerated plants: The obtained resistant regenerated plants need to be tested using molecular biology techniques to determine whether the exogenous vector has integrated into the sesame cell genome. Commonly used PCR amplification techniques are employed, and vector-specific amplification primers are designed based on the transformation vector used, for example... Figure 1 Detection of the hygromycin resistance gene in the vector. Take a small amount of leaves from resistant / regenerated plants, extract DNA, and perform PCR amplification. Plants containing the target amplification product are transgenic plants, which can then be used for gene editing detection.

[0029] The editing of the target gene was determined using PCR amplification combined with first-generation DNA sequencing. Specific primers were designed before and after the sgRNA at positions 200-300 bp upstream and downstream to specifically amplify the target fragment. The amplified products were then sequenced to confirm the type of editing.

[0030] Based on common knowledge in this field, the above preferred conditions can be combined arbitrarily without exceeding the concept and protection scope of this invention. Beneficial effects

[0031] Compared with the prior art, the present invention has the following significant advantages: (1) Strong species universality: For the first time, a genetic transformation and gene editing system that can be applied to common sesquiterpene, stem nodule sesquiterpene and spiny sesquiterpene has been established, breaking through the species limitations of existing technologies.

[0032] (2) High transformation efficiency: By using cotyledon node explants combined with vacuum-assisted infection technology and optimizing key culture media (especially induction formula containing 6-BA), the introduction efficiency of exogenous genes and plant regeneration was significantly improved, and the transformation cycle was shortened.

[0033] (3) Integrated gene editing and visualization screening: A CRISPR-Cas9 gene editing vector optimized for sesquiterpene is provided, which integrates a high-efficiency promoter, hygromycin screening marker and DsRed2 fluorescent reporter gene, enabling rapid, early and non-destructive initial screening of transgenic events, greatly reducing the workload of subsequent molecular identification.

[0034] (4) High and stable positive rate: By continuously applying screening pressure in the rooting medium, non-transgenic "escape seedlings" are effectively eliminated, ensuring that the regenerated plants obtained have a very high positive rate of foreign gene integration, providing reliable materials for subsequent functional studies.

[0035] (5) By using sgRNA and taking advantage of the sequence similarity of homologous genes, the Tianjing TFL1 gene was successfully edited, and materials of various gene editing types were obtained.

[0036] (6) Standardized operation process: It provides a complete and reproducible operation procedure from explant preparation, infection, culture, screening to identification, laying a solid technical foundation for functional genomics research and molecular breeding of Sesbania species. Attached Figure Description

[0037] Figure 1 The diagram below shows the gene editing transformation vector of the present invention (Figure A: The gene expression units from the left boundary of T-DNA are pScEF1α: Cas9, pGmU6: sgRNA, pGmUBI: DsRed2 and pCaMV35S: HygR; Figure B: The structural diagram of the gene editing transformation vector of the guar TFL1 gene). Figure 2 Statistical graph of Cas9 protein expression levels driven by different promoters in sesquiterpene; Figure 3 This is a flowchart illustrating the genetic transformation and gene editing process applicable to multiple species of sesbania in this invention; Figure 4 Phenotypic images of shoot selection using hygromycin and spectinomycin, respectively (Figure A: Bright field image of selection using hygromycin; Figure B: DsRed2 fluorescence detection image of selection using hygromycin; Figure C: Bright field image of selection using spectinomycin; Figure D: DsRed2 fluorescence detection image of selection using spectinomycin). Figure 5 The sequencing alignment results of the ScTFL1 gene-edited plants in Example 3 of this invention are shown, indicating that the edited plants have different editing types such as single base deletion and fragment deletion.

[0038] The following examples will illustrate the detailed operation method and result verification of the above process. The overall process is shown in Figure 3, where the screening effects of hygromycin and spectinomycin are compared. Figure 4 As shown.

[0039] Implementation Case 1: Activity Detection of Different Promoters in Sesame I. Construction of promoter activity detection vector 1. Construction of promoter activity detection vector (1) Cloning the promoter of the scEF1α gene of sesquiterpene: Primers proScEF1α-F and proScEF1α-R were designed based on the DNA sequence of the sesquiterpene genome, and the promoter region pScEF1α of scEF1α was cloned using PCR amplification. Cloning the promoters of the soybean GmEF1α and GmUBI genes: Primers proGmEF1α-F and proGmEF1α-R, proGmUBI-F and proGmUBI-R were designed based on the soybean Williams82 genome Glycine max Wm82.a2.v1 (phytozome.jgi.doe.gov), and the promoter regions pGmEF1α and pGmUBI were cloned using PCR amplification. Using the PGES503 vector as a template, PCR amplification was performed with primers pro2X35S-F and pro2X35S-R to obtain the 2×35S promoter fragment; using the XF5110 vector as a template, PCR amplification was performed with primers pro35S-PPDK-F and pro35S-PPDK-R to obtain the 35S-PPDK promoter fragment.

[0040] (2) The RPS5A-Cas9 vector was digested with BglⅡ enzyme to obtain the linearized RPS5A-Cas9 vector.

[0041] (3) According to the instructions of the Jianshi Bio DNA Purification and Recovery Kit (TD407-50-A), the linearized vector and PCR product obtained above were recovered and ligated using the homologous recombination method of Clon Express.

[0042] (4) Take 10 μL of the reaction product and transform it into Escherichia coli DH5α (CAT#: DL1001) by heat shock method. Spread it evenly on LB plates containing kanamycin and incubate in the dark at 37°C for 14 hours. Use primers RPS5A-F and RPS5A-R to detect positive clones. After the sequencing is correct, extract the plasmid to obtain the final plasmid. The primer sequences are shown in Table 2 below.

[0043] Table 2. Primer Sequences

[0044] The carrier can be obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only used to repeat the relevant experiments of this invention and is not used for other purposes.

[0045] 2. Validation of Agrobacterium-mediated transformation and rooting transformation Six constructed promoter activity detection vectors were transformed into Agrobacterium rhizogenes strain K599 (CAT#AC1080). Hairy roots were induced in the hypocotyl of Sesbania serrata via Agrobacterium rhizogenes-mediated infection. After 15 days of culture, root tissue was harvested, ground, and RNA was extracted. The expression level of Cas9 protein was detected, and the differences in transcriptional activity in Sesbania serrata were compared by comparing the differences in Cas9 expression levels driven by different promoters. The results showed that, as Figure 2 Different promoters showed significant differences in their ability to drive Cas9 expression in sesquiterpene. The ScEF1α promoter exhibited the strongest driving activity, so the ScEF1α promoter was subsequently selected to drive Cas9 expression in the sesquiterpene gene editing vector.

[0046] Example 2: This example discloses the construction of gene editing vectors pScEF1α-Cas9-TFL-01 and pScEF1α-Cas9-TFL-02. (1) ScTFL1 sgRNA target selection and primer design sgRNAs were designed and screened using the website https: / / ngdc.cncb.ac.cn / halomics / . Off-target probability was assessed through whole-genome alignment, and finally, one highly specific target (ScTFL1-1) was selected. Its sequence information is shown in Table 3.

[0047] Table 3. ScTFL1 gene sgRNA target sequence

[0048] Primer sequences were then designed based on the vector, and the sequences are shown in Table 4.

[0049] Table 4. Primers for sgRNA target sites of single-target gene editing vectors

[0050] (2) Using the JRH0951 vector as a template, GmU6+ sgRNA was amplified with primers sgRNAF1+sgRNAR1 and sgRNA+scaffold was amplified with primers sgRNAF2+sgRNAR2.

[0051] (3) Cloning the soybean GmUBI promoter and DsRed2 nucleotide sequence Cloning the DsRed2 gene: Using the PGES501 vector as a template, the DsRed2 gene was amplified using primers DsRed2-F and DsRed2-R. The primer sequences used are detailed in Table 5.

[0052] Cloning of the soybean GmUbiqutin gene promoter: Primers proGmEF1α-F and proGmEF1α-R, GmUBI-F and GmUBI-R were designed based on the soybean Williams82 genome Glycine maxWm82.a2.v1 (phytozome.jgi.doe.gov). The promoter region pGmUBI was cloned using PCR amplification. The primer sequences used are detailed in Table 5.

[0053] The constructed pScEF1α-Cas9 vector retains the binary vector backbone of the Agrobacterium tumefaciens transformation vector pCambia3301, containing four gene expression units in the following order from the left boundary of the T-DNA: pScEF1α: Cas9, pGmU6: sgRNA, pGmUBI: DsRed2, and pCaMV35S: HygR. The sgRNA can be replaced with a target gene-specific sgRNA, directly constructing an editing vector for editing the target gene. The vector with the ScTFL1 sgRNA added was named pScEF1α-Cas9-TFL-01; the vector with the HygR gene expression selection marker replaced by the AADA gene expression selection marker was named pScEF1α-Cas9-TFL-02.

[0054] Table 5. Primer sequences for amplifying the DsRed2 gene and GmUBI promoter

[0055] Example 3: Genetic transformation of common sesquiton Gene editing requires the introduction of a gene editing vector into the target cells. To edit the TFL1 gene in common sesame, cotyledonary nodes of common sesame were used as explants, and the gene editing vector pScEF1α-Cas9-TFL-01 was transferred into them. The specific operation procedure is as follows: (1) Explant preparation: Select plump common sesame seeds with smooth surfaces, soak them in concentrated sulfuric acid for 30-40 minutes, wash them with clean water, and dry the seed coat; arrange the dried sesame seeds in a single layer in a petri dish, place them in a desiccator, add 200 mL of sodium hypochlorite and 20 mL of hydrochloric acid, immediately cover the desiccator, seal and sterilize for 24 hours, then transfer the petri dish to a sterile laminar flow hood and blow air for 1-2 hours to remove residual chlorine. Add sterile water and incubate in the dark at 25℃ for 1 week, separate the two cotyledons equally along the hypocotyl, remove the growing point and the upper half of the cotyledon, and make 8-10 light cuts at the cotyledon meristem to obtain the prepared explants.

[0056] (2) Preparation of Agrobacterium infection solution: Take Agrobacterium carrying the target gene vector from a -80℃ freezer, and streak a small amount of Agrobacterium onto a solid LB medium plate containing the corresponding antibiotic. Incubate in the dark at 28℃ for 2 days. Pick a single colony and inoculate it into 1 mL of LB liquid medium and incubate overnight. Perform vector PCR detection on the bacterial solution to confirm that the strain carries the target gene vector. Take the bacterial solution and perform a second activation at an inoculation volume of 1:100. Add the bacterial solution to 5 mL of liquid LB medium containing the corresponding antibiotic and incubate at 28℃ with shaking at 220 rpm for about 14-16 hours. When the bacterial solution concentration reaches OD600 = 0.6, take 1 mL of bacterial solution and spread it evenly onto a solid LB medium plate containing the corresponding antibiotic. Incubate in the dark at 28℃ for 2 days. Wash the bacterial cells with infection solution and resuspend them. Adjust the bacterial solution concentration to OD600 = 0.6 for explant transformation.

[0057] (3) Infection and co-culture: Transfer the prepared explants to Agrobacterium infection solution, vacuum treat for 10 minutes at 0.07 MPa, soak for 30 minutes, remove the explants, use sterile filter paper to absorb the residual bacterial solution, place them with the wound side down on the co-culture medium covered with sterile filter paper, and incubate in the dark for 4-5 days.

[0058] (4) Recovery culture: Take out the explants that have finished co-cultured above, insert them obliquely into the screening medium at a 45-degree angle with the wound side facing up, and culture them for 1-2 weeks under the conditions of 25±2 ℃ light and 16 / 8h photoperiod until adventitious buds grow.

[0059] (5) Screening culture: Collect explants after recovery culture, remove the remaining cotyledons and the dark brown surface tissue at the base, and transfer them to a screening medium containing 20-50 mg / L spectinomycin. Culture them at 25±2℃ with a photoperiod of 16 / 8h. Replace the medium every 3-4 weeks until a large number of clustered shoots are produced.

[0060] (6) Rooting culture of resistant shoots: When the young shoots grow to 3-5cm, cut the resistant shoots from the base and insert them into a rooting medium containing 20-50mg / L spectinomycin and culture them under light at 25±2℃ for 2-3 weeks until the plant height is ≥8cm.

[0061] (7) Hardening and transplanting of resistant regenerated plants: When the resistant regenerated seedlings grow to more than 8 cm and the root length exceeds 3 cm, open the culture bottle cap and add a small amount of sterile water. Harden the seedlings for 36 hours, carefully remove the plants with tweezers, rinse the roots with clean water to completely remove the culture medium, transplant them into nutrient soil, cover and keep moist until new leaves grow.

[0062] Following the above procedure and using the corresponding basic culture media described in Table 1, common sesbania underwent multiple batches of transformation tests and condition optimization, resulting in a large number of clustered shoots. Different concentrations of spectinomycin (20-50 mg / L) were tested. From 300 explants infected at a concentration of 30 mg / L, 100 healthy plants were obtained, of which 72 were positive, with a transformation efficiency of approximately 25%. Gene cloning and sequencing were then performed. The sequencing results were compared with the target gene sequence using SnapGene software. If an edited DNA sequence was found, the editing was considered successful. 24 of these were edited plants, with an editing efficiency of 33.3%. Sequencing results showed that the ScTFL1 gene-edited plants exhibited different editing types, such as single base deletions and fragment deletions. Figure 4 As shown.

[0063] Example 4: Genetic transformation of stem nodule sesquiterpene *Senecio scandens*, another species in the genus *Senecio*, was transformed using both pScEF1α-Cas9-TFL-01 and pScEF1α-Cas9-TFL-02 vectors. The Agrobacterium-mediated transformation process was similar to that of *Senecio scandens*. Screening was conducted at different concentrations of spectinomycin (20-50 mg / L) and hygromycin (5-10 mg / L). Lower concentrations of spectinomycin significantly inhibited regeneration of *Senecio scandens*, leading to browning and death of explants and clustered buds. Hygromycin was more suitable for transformation screening of *Senecio scandens*, achieving a transformation efficiency of over 32% and an editing efficiency of 25% at a concentration of 5-8 mg / L.

[0064] Example 5: Genetic transformation of sesquiterpene Transformation was performed on another species of the genus *Senecio scandens*, *Senecio scandens* var. *spinosa*, using both pScEF1α-Cas9-TFL-01 and pScEF1α-Cas9-TFL-02 vectors. The Agrobacterium-mediated transformation process was similar to that of *Senecio scandens* var. *spinosa*. Screening was conducted at different concentrations of spectinomycin (20-50 mg / L) and hygromycin (5-10 mg / L). Lower concentrations of spectinomycin significantly inhibited the regeneration of *Senecio scandens* var. *spinosa*, leading to browning and death of explants and clustered buds. Hygromycin was more suitable for the transformation screening of *Senecio scandens* var. *spinosa*. The results are as follows: Figure 4 Using hygromycin at a concentration of 8-10 mg / L, 40 regenerated seedlings were obtained from 360 explants. 24 of these seedlings were positive, resulting in a transformation efficiency of 9%. Among these, 8 were edited seedlings, representing an editing efficiency of 22%.

[0065] Example 6: Evaluation and selection of antibiotic screening effectiveness The screening effects of different antibiotics were tested, and it was found that explants selected with hygromycin showed normal growth and significant DsRed2 fluorescence signal. Figure 5A, B), while spectinomycin selection resulted in severe browning of explants and no fluorescence signal (A, B), while spectinomycin selection led to severe browning of explants and no fluorescence signal (B). Figure 5 (C, D) indicates that hygromycin is more suitable for genetic transformation screening of Sesbania species.

[0066] The specific sequences of SEQ ID NO: 1-10 mentioned above are as follows; pScEF1α (SEQ ID NO: 1) Cas9(SEQ ID NO: 2) pGmU6(SEQ ID NO: 3) aaaataaatggtaaaatgtcaaatcaaaactaggctgcagtatgcagagcagagtcatgatgatactacttactacaccgattcttgtgtgcagaaaaatatgttaaaataattgaatctttctctagccaaatttgacaacaatgtacaccgttcatattgagagacgatgcttcttgtttgctttcggtggaagctgcatatactcaacattactccttcagcgagttttccaactgagtcccacattgcccagacctaacacggtattcttgtttataatgaaatgtgccaccacatggatt sgRNA(SEQ ID NO: 4) TGACCGACCCGGATGTTCCTGG pGmUBI(SEQ ID NO: 5) DsRed2( SEQ ID NO: 6) ATGGCATCCAGCGAAAATGTTATAACCGGTTTATGAGGTTCAAAGTCAGAATGGAAGGAACTGTTAACGGCCATGAATTTGAGATCGAGGGTGAGGGGGAAGGTCGACCGTACGAGGGACACAATACTGTCAAGCTCAAAGTTACCAAAGGAGGTCCTCTCCCATTTG CTTGGGATATATTATCACCCCAATTTCAGTATGGGTCAAAAGTGTATGTAAAACATCCTGCTGATATCCCAGATTATAAAAAACTAAGTTTCCCTGAAGGATTTAAGTGGGAGCGCGTCATGAATTTTGAAGATGGAGGCGTAGCAACAGTTACGCAAGATTCCTCACTT CAGGATGGTTGTTTCATATACAAGGTGAAGTTTATTGGAGTAAACTTCCCAAGTGACGGCCCCGTGATGCAAAAGAAAACCATGGGTTGGGAAGCATCTACAGAGAGGTTGTATCCTCGTTGATGGTGTTCTGAAGGGAGAAACACACAAGGCTTTGAAGCTTAAGGATGGGGGGCACTATTTGGTTGAGTTCAAGTCTATTTACATGGCCAAAAAGCCAGTTCAGTTACCTGGTTATTACTATGTGGACGCGAAACTTGACATTACTTCTCATAATGAAGACTACACAATTGTGGAGCAATATGAAAGAACTGAAGGGAGACATCATCTTTTTCTGTGA pCaMV35S( SEQ ID NO: 7) TGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGA HygR(SEQ ID NO: 8) ScTFL1(SEQ ID NO: 9) pScEF1α-Cas9(SEQ ID NO: 10) Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A genetic transformation and gene editing method applicable to multiple sesame species, characterized in that, Includes the following steps: (1) Using the cotyledonary nodes of sterile seedlings of the genus *Senecio* as explants, the pScEF1α-Cas9 gene editing transformation vector was introduced into them using the *Agrobacterium* infection method, and regenerated plants were obtained by culturing. The pScEF1α-Cas9 gene editing transformation vector was constructed on the backbone of the *Agrobacterium* transformation vector pCambia3301, and contained the following four sequentially arranged gene expression units in its T-DNA region: pScEF1α: Cas9; pGmU6: sgRNA; pGmUBI: DsRed2; pCaMV35S: HygR; wherein, the nucleotide sequence of pScEF1α is shown in SEQ ID NO: 1; the nucleotide sequence of Cas9 is shown in SEQ ID NO: 2; the nucleotide sequence of pGmU6 is shown in SEQ ID NO: 3; the nucleotide sequence of sgRNA is shown in SEQ ID NO: 4; the nucleotide sequence of pGmUBI is shown in SEQ ID NO: 5; and the nucleotide sequence of DsRed2 is shown in SEQ ID NO:

5. As shown in SEQ ID NO: 6; the nucleotide sequence of pCaMV35S is shown in SEQ ID NO: 7; the nucleotide sequence of HygR is shown in SEQ ID NO: 8; (2) The regenerated plants were initially screened in vivo using the pScEF1α-Cas9 gene editing transformation vector containing the DsRed2 fluorescent reporter gene to obtain transformed regenerated plants. (3) Molecular detection was performed on the target gene of the transformed and regenerated plant to identify the gene-edited regenerated plant.

2. The method according to claim 1, characterized in that, The Agrobacterium infection method described in step (1) is an Agrobacterium infection method with vacuum assistance.

3. The method according to claim 2, characterized in that, The vacuum-assisted treatment is performed at a pressure of 0.07 MPa for 10 minutes.

4. The method according to claim 1, characterized in that, In step (1), the culture process includes: culturing the infected explants in a recovery medium containing 1-2 mg / L 6-BA until adventitious shoots emerge.

5. The method according to claim 4, characterized in that, The adventitious buds were transferred to a selection medium containing 1-2 mg / L 6-BA and 5-10 mg / L hygromycin for selection culture until clustered buds were produced.

6. The method according to claim 5, characterized in that, When the resistant buds grow to 3-5 cm, they are rooted in a rooting medium containing 5-10 mg / L hygromycin.

7. The method according to claim 1, characterized in that, The sgRNA targets the ScTFL1 gene of sesquiterpenoids, and the nucleotide sequence of the ScTFL1 gene is shown in SEQ ID NO:

9.

8. The method according to claim 1, characterized in that, The nucleotide sequence of the pScEF1α-Cas9 gene editing transformation vector is shown in SEQ ID NO:

10.

9. The method according to claim 1, characterized in that, The species mentioned are common sesquiterpenes, stem sesquiterpenes, or spiny sesquiterpenes.

Images