Use of osrx1 gene and osrx1 protein in regulating resistance to rice sheath blight
By regulating the expression level of the OsRX1 gene, a rice variety with high resistance to sheath blight was constructed, which solved the problem of insufficient rice resistance in traditional breeding methods and significantly improved the resistance of rice to sheath blight.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHENYANG AGRI UNIV
- Filing Date
- 2026-04-07
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies are insufficient to effectively improve rice resistance to sheath blight, and the pathogenic mechanism of sheath blight pathogen is complex, traditional breeding methods are limited, and there is a lack of highly resistant rice varieties.
By regulating the expression level of the OsRX1 gene, rice varieties with high resistance to rice sheath blight can be constructed using overexpression or silencing of the OsRX1 protein. This includes overexpressing or knocking out the OsRX1 gene in the rice genome and using recombinant overexpression vectors such as pBWA(V)HU vector for genetic transformation.
It significantly improved the resistance of rice to sheath blight. Overexpressing plants showed high resistance, while silenced plants were susceptible to sheath blight. This proves that the OsRX1 gene regulates rice resistance to sheath blight and achieves efficient disease-resistant breeding.
Smart Images

Figure CN122128349A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological breeding technology, specifically involving OsRX1 The role of genes and OsRX1 protein in regulating rice sheath blight resistance. Background Technology
[0002] Rice is a vital food crop globally, but its growth is frequently threatened by various diseases, leading to reduced yields. Traditional breeding methods have limitations in improving rice disease resistance; therefore, discovering and utilizing disease-resistance-related genes through genetic engineering is of great significance. Currently, several genes have been reported to participate in rice disease resistance processes, but further research is needed to identify new disease-resistance genes and their mechanisms of action.
[0003] Rice sheath blight is caused by the asexual form of Rhizoctonia solani (… Rhizoctonia solani Sheath blight (Kühn) is a necrotic disease of rice. Lesions mainly occur on leaf sheaths and leaves; in severe cases, the pathogen can invade the stem and spread to the panicle, easily causing premature aging and lodging, resulting in shriveled grains and severe yield reduction. It is one of the most destructive diseases of rice. Therefore, effective control of this disease is crucial to ensuring food security. Currently, there is a lack of rice varieties with high resistance to sheath blight in agricultural production. Furthermore, because most field-causing sheath blight pathogens have binucleate or multinucleate genomes, genetic transformation is difficult, leading to relatively slow progress in research on its pathogenic mechanism. This poses a significant challenge to the control of this disease. Summary of the Invention
[0004] This invention provides OsRX1 The role of the gene and OsRX1 protein in regulating rice sheath blight resistance, the aforementioned OsRX1 Genes and / or the OsRX1 protein can positively regulate rice resistance to sheath blight.
[0005] This invention provides an adjustment OsRX1 Application of reagents for regulating gene expression and / or OsRX1 protein content in regulating rice resistance to sheath blight; The amino acid sequence of the OsRX1 protein is shown in any of the following examples: (1) The sequence shown in SEQ ID No. 1; (2) A sequence that retains the basic function of the sequence shown in SEQ ID No. 1 after mutation, addition or deletion of one or more amino acids based on SEQ ID No. 1; (3) A sequence that has more than 70% homology with the sequence shown in SEQ ID No.1 and has the basic function of the sequence shown in SEQ ID No.1.
[0006] In one specific embodiment of the present invention, the... OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0007] In one specific embodiment of the present invention, the overexpression of the... OsRX1 Genes that enhance rice's resistance to sheath blight.
[0008] In one specific embodiment of the present invention, the knockout or silence of the... OsRX1 Genes, or reducing the aforementioned OsRX1 The expression level of genes reduces the resistance of rice to sheath blight.
[0009] This invention also provides a reagent for improving rice resistance to sheath blight, including overexpression of... OsRX1 Gene reagents, the OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0010] In one specific embodiment of the present invention, the reagent includes overexpression of the... OsRX1 Recombinant overexpression vectors of genes or recombinant microorganisms.
[0011] In one specific embodiment of the present invention, the base vector of the recombinant overexpression vector includes the pBWA(V)HU vector.
[0012] This invention also provides a method for improving rice resistance to sheath blight, comprising overexpressing in the target rice genome OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0013] This invention also provides a method for breeding rice varieties and / or lines highly resistant to sheath blight, comprising overexpressing in the genome of candidate rice varieties and / or lines OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0014] In one specific embodiment of the present invention, the method further includes performing the aforementioned process on the obtained varieties and / or strains. OsRX1 Determination of gene expression levels.
[0015] Beneficial effects: This invention utilizes genetic transformation to modify rice... OsRX1 Gene expression levels were controlled to obtain... OsRX1 Overexpressing plants and RNAi-interfered plants, compared with wild-type plants, showed that overexpressing plants contained [a certain amount of...]. OsRX1 The expression level of RNAi was significantly higher than that of wild-type RNAi plants. OsRX1The expression level of the RNAi gene was significantly lower than that of the wild type. Subsequent inoculation experiments with *Rhizoctonia solani* showed that, compared to the wild type, overexpressing plants exhibited significantly enhanced resistance to *Rhizoctonia solani*, while RNAi plants showed significantly weakened resistance. This invention demonstrates for the first time that the expression level can be controlled by regulating the RNAi gene. OsRX1 The expression level of the gene can be adjusted to regulate the resistance to rice sheath blight, thereby helping to create new rice varieties with high resistance to sheath blight. Attached Figure Description
[0016] Figure 1 for OsRX1 Schematic diagram of overexpression and RNAi vector; Figure 2 for OsRX1 Overexpression, gene silencing, and wild-type rice ZH11 OsRX1 The relative expression level of genes; Figure 3 for OsRX1 Phenotypic and lesion length statistics of overexpressing, gene-silencing and wild-type rice ZH11 plants after inoculation with sheath blight. Detailed Implementation
[0017] This invention provides an adjustment OsRX1 Application of reagents for regulating gene expression and / or OsRX1 protein content in regulating rice resistance to sheath blight; The amino acid sequence of the OsRX1 protein is shown in any of the following examples: (1) The sequence shown in SEQ ID No. 1; (2) A sequence that retains the basic function of the sequence shown in SEQ ID No. 1 after mutation, addition or deletion of one or more amino acids based on SEQ ID No. 1; (3) A sequence that has more than 70% homology with the sequence shown in SEQ ID No.1 and has the basic function of the sequence shown in SEQ ID No.1.
[0018] In one embodiment of the present invention, the amino acid sequence of the OsRX1 protein is shown in SEQ ID No. 1: MDTLLSVVASDIISRLISSLITKYSNQSTADHKLERLQWLLLRARTIVEEAHGRQISNQGMLLQLRQLMQSMYQGYYILNAFQEQHITGKRRRSSSSLKLKKLQAAMEDLESAIDDSKKEFVVFLLGCPCLPQRPYDTHLFREKCMFGRHEEKELIREFLLQPCDSPLRVLPIIRPREVGKNTLIEHVCNEESVHEHFSRVVRFKSDDLNNEENQESFFKTSELVASSTMSLVVVELVNDDISDETWRGFCSSIANGCSKMIVISRSETISRLGTTQALKLKRLKRHEFWYFFRTIAFGTADPEEHPELLRIARRIATTDQRCFHCC The present invention describes OsRX1 The genome sequence of the gene, in one embodiment as shown in SEQ ID No. 2: Its CDS sequence is shown in SEQ ID No. 3: ATGGACACACTCTTATCTGTAGTTGCCAGTGACATTATCAGCCGCCTCATCTCCTCCCTCATCACGAAGTACAGCAACCAAAGCACCGCCGATCATAAGCTTGAGCGTCTGCAATGGCTGCTCCTCAGAGCAAGAACCATCGTCGAGGAAGCCCATGGCCGGCAGATCTCCAACCAAGGTATGCTCCTACAGCTCAGGCAGCTAATGCAGAGCATGTACCAAGGCTACTACATTCTCAACGCCTTCCAAGAACAGCACATCACCGGTAAACGAAGGCGATCATCATCATCCCTCAAACTGAAGAAGCTTCAGGCTGCCATGGAGGATTTGGAATCTGCCATCGATGACTCGAAGAAGGAGTTTGTTGTGTTCTTGCTAGGCTGCCCATGCTTGCCTCAGCGACCATACGACACTCACCTGTTCAGGGAGAAGTGCATGTTTGGTCGGCACGAAGAGAAAGAGCTGATCCGTGAATTTCTGCTTCAACCTTGTGATTCTCCTTTGCGTGTTCTTCCAATCATCCGCCCCCGAGAAGTCGGGAAGAACACGCTGATCGAGCACGTCTGCAACGAGGAGAGCGTGCACGAGCATTTCTCACGGGTTGTTCGTTTCAAGAGCGATGATTTGAACAATGAAGAGAATCAAGAAAGTTTCTTCAAGACAAGTGAGCTGGTTGCTTCTAGTACCATGTCTCTGGTTGTCGTTGAGCTTGTCAACGACGATATCAGTGACGAGACATGGAGAGGATTCTGCTCATCCATTGCAAATGGTTGCAGCAAAATGATAGTCATCAGTAGATCGGAGACGATCTCAAGGTTAGGGACAACACAAGCACTCAAGCTCAAGAGGCTCAAACGCCACGAGTTCTGGTACTTCTTCCGAACCATTGCCTTTGGAACTGCAGATCCGGAAGAACATCCAGAGCTACTGCGTATCGCCAGGAGGATTGCAACAACAGATCAAAGGTGCTTCCATTGCTGCTAA。
[0019] In this embodiment of the invention, an overexpression of the described... OsRX1 Rice plants that produce this gene exhibit high resistance to sheath blight; RNAi was used to interfere with the... OsRX1 Gene expression can cause RNAi plants to exhibit significant susceptibility to sheath blight, confirming the aforementioned... OsRX1 Genes positively regulate rice resistance to sheath blight, which can be achieved by overexpressing the aforementioned gene. OsRX1 Genetic methods can be used to improve resistance to rice sheath blight by inhibiting, silencing, or knocking out the aforementioned pathogens. OsRX1 Genetic methods can be used to reduce rice's resistance to sheath blight.
[0020] This invention also provides a reagent for improving rice resistance to sheath blight, including overexpression of... OsRX1 Gene reagents, the OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0021] This invention does not specifically limit the overexpression method; conventional methods in the art can be used to achieve the desired results. OsRX1 Increasing gene expression levels is sufficient; therefore, the reagents include those for overexpressing the gene. OsRX1 Recombinant overexpression vectors or recombinant microorganisms, as in the examples, were used to construct recombinant overexpression vectors and utilize Agrobacterium-mediated rice callus to obtain... OsRX1 While high-expression transgenic rice is an example, it cannot be considered the entire scope of protection of this invention. This invention does not specifically limit the base vector of the recombinant overexpression vector; in one embodiment, the pBWA(V)HU vector is used as the base vector, and the... OsRX1 The gene's CDS sequence was inserted after the strong promoter Ubi, and the vector was digested with Bsa I / Eco31I and processed using Biorun 2. EasyClone Mix was used for recombination to construct the pBWA(V)HU-OsRX1 overexpression vector (purchased from Wuhan Boyuan Biotechnology Co., Ltd.), and then overexpression plants were obtained through Agrobacterium-mediated genetic transformation.
[0022] This invention also provides a method for improving rice resistance to sheath blight, comprising overexpressing in the target rice genome OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0023] In one embodiment of the present invention, the constructed pBWA(V)HU-OsRX1 overexpression vector was transformed into the Zhonghua 11 rice variety using an Agrobacterium-mediated genetic transformation method, thereby constructing an overexpression vector. OsRX1The overexpression strains of the gene significantly improved resistance to sheath blight compared to the wild type.
[0024] This invention also provides a method for breeding rice varieties and / or lines highly resistant to sheath blight, comprising overexpressing in the genome of candidate rice varieties and / or lines OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No. 2.
[0025] In one specific embodiment of the present invention, the method further includes performing the aforementioned process on the obtained varieties and / or strains. OsRX1 Determination of gene expression levels.
[0026] The methods for detecting the expression level described in this invention include qRT-PCR, western blotting, or ELISA detection. In the examples, qRT-PCR was used to verify the expression level. OsRX1 The expression level of genes, but this should not be considered the entire scope of protection of this invention. When performing the qRT-PCR detection described in this invention, [the following is used:] the expression level of genes. Actin The primer sequences used are as follows: (This is for internal reference only) OsRX1 -F (SEQ ID No.4): ATGGACACACTCTTATCTGTAGTTGCC; OsRX1 -R (SEQ ID No.5): GCTTATGATCGGCGGTGCTTT; Actin -F (SEQ ID No.6):GAGTATGATGAGTCGGGTCCAG; Actin -R (SEQ ID No. 7): ACACCAACAATCCCAAACAGAG.
[0027] In one embodiment, leaves of wild-type and mutant were collected, RNA was extracted and reverse transcribed into cDNA, and the cDNA was used as a template to prepare the reaction system. The reaction system can be prepared using the ChamQ universal SYBR qPCR Master Mix (Vazyme, China) kit. The operation steps are as follows: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s, 40 cycles; melting curve program: 95℃ for 15s, 60℃ for 30s, 95℃ for 15s.
[0028] To further illustrate the present invention, the following description, in conjunction with embodiments, explains the features provided by the present invention. OsRX1The role of the gene and OsRX1 protein in regulating rice sheath blight resistance is described in detail, but should not be construed as limiting the scope of protection of this invention.
[0029] Example 1 according to OsRX1 Full-length primers were designed based on the sequence (SEQ ID No. 3), and the target gene was obtained by PCR amplification using cDNA obtained through reverse transcription as a template. OsRX1 The full-length CDS fragment is linked to a homologous recombination reaction. Kill In the promoter gene overexpression plant vector pBWA(V)HU ( Figure 1 The specific experimental method is as follows: Using bioinformatics software such as Snapgene, design OsRX1 The amplification primers for the gene were SEQ ID No. 8 and SEQ ID No. 9. The amplification was performed using TOYOBO high-fidelity PCR polymerase KOD-Plus. OsRX1 Gene and cloning experiments. After gel electrophoresis, the PCR products were recovered using the Kangwei Century Gel Extraction Kit. The purified PCR products were mixed with the pBWA(V)HU vector at a molar ratio of 3:1. 10 μL of recombinase Biorun 2 was added. Add EasyClone Mix and ddH2O to a final volume of 20 μL. Incubate at 37°C for 30 h. Transform the ligation system into E. coli DH5α, screen for positive clones, and send them to a biotechnology company for sequencing analysis. Ensure the insertion is complete. OsRX1 The full-length CDS sequence is shown in SEQ ID No. 3.
[0030] OsRX1 -OX-F (SEQ ID No. 8):ttgtttggtgttacttctgttgcaacatggacacactcttatctgtagttg; OsRX1 -OX-R (SEQ ID No. 9): tagtctccgtcgtggtctttgtaatcgcagcaatggaagcacctttg; RNAi vector construction: according to OsRX1 Primers were designed based on the transcription sequence, using cDNA obtained from reverse transcription as a template, and primers were used... OsRX1 -RNAi-F and OsRX1 -RNAi-R is obtained through PCR amplification. OsRX1 The 3' end fragment is linked to the entry vector pDONR221 via the Gateway method. Figure 1After gel electrophoresis, the PCR products were recovered using the Kangwei Century GelExtraction Kit. The purified PCR products were mixed with the pDONR 221 vector at a 3:1 molar ratio. BP Clonase™ II enzyme mixture was added, thoroughly mixed, and incubated at 25°C for 1 hour. Proteinase K solution was added to the BP reaction product to terminate the reaction. The ligation system was transformed into *E. coli* DH5α, and positive clones were screened and sent to a biotechnology company for sequencing analysis. Ensure the insertion... OsRX1 The sequence showed no mutations. The correctly sequenced clone was named pDONR221- OsRX1 Cloning pDONR221- will be a basic process. OsRX1 Mix with the target vector pH7GWIWG2(II). Add LRClonase™ II enzyme mixture to the above mixture, and add proteinase K solution to the LR reaction product to terminate the reaction, thereby constructing the recombinant plasmid pH7GWIWG2(II)- OsRX1 -RNAi was used to transform the plasmid into E. coli DH5α, and positive clones were screened out.
[0031] OsRX1 -RNAi-F (SEQ ID No. 10): GGGGACAAGTTTGTAC AAA AAA GCA GGCTTCGGAACTGCAGATCCGGAAGA; OsRX1 -RNAi-R (SEQ ID No. 11): GGGGACCAC TTT GTA CAA GAA AGC TGGGTGACCACAGGCAAGAAGCTGAA.
[0032] Overexpression and RNAi plasmids were extracted and introduced into Agrobacterium tumefaciens GV3101 for transformation of callus tissue of rice variety Zhonghua 11. Hygromycin-resistant T0 generation rice was obtained. Individual plants were harvested and sown to produce T1 generation rice. RNA was extracted from rice leaves, reverse transcribed into cDNA, and qRT-PCR was used to identify overexpression and RNAi plants.
[0033] by Actin The primer sequences used are as follows: (This is for internal reference only) OsRX1 -F (SEQ ID No.4): CAAGAAATCTCGGCGGCTAG; OsRX1 -R (SEQ ID No.5): GCGAATTGGCGTAGACGAC; Actin -F (SEQ ID No.6):GAGTATGATGAGTCGGGTCCAG; Actin -R (SEQ ID No. 7): ACACCAACAATCCCAAACAGAG.
[0034] Collect wild type OsRX1 overexpression and OsRX1 RNA was extracted from leaves of RNAi plants, and cDNA was reverse transcribed. The cDNA was used as a template to prepare the reaction system, and the reaction was completed using the ChamQ universal SYBR qPCR Master Mix (Vazyme, China) kit.
[0035] The results are as follows Figure 2 As shown, compared with the wild type, overexpression of the plant's internal... OsRX1 The expression level was significantly higher in the wild type than in the α type. OsRX1 -RNAi plants OsRX1 The expression level was significantly lower than that of the wild type.
[0036] The obtained OsRX1 Overexpression and OsRX1 -RNAi strain inoculated with *Rhizoctonia solani* AG1-IA (Li, D., Wu, X., Huang, C., Lin, Q., Wang, Y., Yang, X., Wang, C., Xuan, Y., Wei, S., and Mei, Q. (2023). Enhanced Rice Resistance to Sheath Blight through NitrateTransporter 1.1B Mutation without Yield Loss under NH4+). + Fertilization. Journal of Agricultural and Food Chemistry 71, 19958-19969.), measuring the length of lesions after disease onset. Sheath blight identification is performed using a leaf sheath method. Activated sheath blight fungus mycelium is collected using a punch and placed in the center of a new PDA culture dish. Wood bark is placed radially around the mycelium. Once the mycelium has covered the entire dish, the wood bark at the same distance from the mycelium is removed and placed in a cultured rice leaf sheath. The dish is then sprayed twice with distilled water and wrapped with plastic wrap to maintain moisture. Wild-type, OsRX1 Overexpressing plants and OsRX1 Eight RNAi plants were inoculated at a time, and the length of lesions was measured one week later. Results are as follows: Figure 3 As shown, OsRX1 The lesion length of RNAi plants was significantly longer than that of wild-type controls, indicating that the overexpressing plants had significantly improved resistance to sheath blight.
[0037] Table 1. Statistics on lesion length after inoculation with *Rhizoctonia solani*.
[0038] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A regulation OsRX1 Application of reagents for regulating gene expression and / or OsRX1 protein content in regulating rice resistance to sheath blight; The amino acid sequence of the OsRX1 protein is shown in any of the following examples: (1) The sequence shown in SEQ ID No. 1; (2) A sequence that retains the basic function of the sequence shown in SEQ ID No. 1 after mutation, addition or deletion of one or more amino acids based on SEQ ID No. 1; (3) A sequence that has more than 70% homology with the sequence shown in SEQ ID No.1 and has the basic function of the sequence shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, The OsRX1 The gene includes the genome sequence shown in SEQ ID No.
2.
3. The application according to claim 1 or 2, characterized in that, Overexpression OsRX1 Genes that enhance rice's resistance to sheath blight.
4. The application according to claim 1 or 2, characterized in that, Knockout or silencing OsRX1 Genes, or reducing the aforementioned OsRX1 The expression level of genes reduces the resistance of rice to sheath blight.
5. A reagent for improving rice resistance to sheath blight, characterized in that, Including overexpression OsRX1 Gene reagents, the OsRX1 The gene includes the genome sequence shown in SEQ ID No.
2.
6. The reagent according to claim 5, characterized in that, The reagent includes overexpression of the [specific ingredient]. OsRX1 Recombinant overexpression vectors of genes or recombinant microorganisms.
7. The reagent according to claim 6, characterized in that, The base vector for the recombinant overexpression vector includes the pBWA(V)HU vector.
8. A method for improving the resistance of rice to sheath blight, characterized in that, Including overexpression in the target rice genome OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No.
2.
9. A method for breeding rice varieties and / or lines highly resistant to rice sheath blight, characterized in that, Including overexpression in the genome of candidate rice varieties and / or lines OsRX1 Genes, the ones mentioned OsRX1 The gene includes the genome sequence shown in SEQ ID No.
2.
10. The method according to claim 9, characterized in that, This also includes the aforementioned process for obtaining varieties and / or strains. OsRX1 Determination of gene expression levels.