A lyophilized PCR kit for detecting Clonorchis sinensis in fecal samples

Abstract

This invention belongs to the field of parasite detection technology, specifically relating to a lyophilized PCR kit for detecting Clonorchis sinensis in fecal samples. The lyophilized PCR kit of this invention includes a lyophilized reaction powder, a positive control, a negative control, and a reconstitution solvent. The lyophilized reaction powder is prepared by freeze-drying a reaction solution containing the following components: (a) a first primer pair and a first probe for detecting the Clonorchis sinensis COX1 gene; (b) a second primer pair and a second probe for detecting the human genomic actin (ACT) gene; (c) PCR reaction components: including hot-start Taq DNA polymerase, dNTPs, and a buffer system; and (d) a lyophilization protectant. This invention targets the Clonorchis sinensis-specific COX1 gene and uses PCR amplification technology to detect fecal samples, accurately identifying Clonorchis sinensis nucleic acid and effectively avoiding cross-reactions with other parasites and intestinal flora. The detection specificity and sensitivity are significantly improved, and the repeatability and stability are excellent.

Description

Technical Field

[0001] This invention belongs to the field of parasite detection technology, specifically relating to a freeze-dried PCR kit for detecting Clonorchis sinensis in fecal samples. Background Technology

[0002] Clonorchis sinensis ( Clonorchis sinensis Clonorchis sinensis, also known as liver fluke, is a zoonotic foodborne parasitic disease that infects the biliary system of humans and animals, primarily distributed in Asia. Transmission of Clonorchis sinensis is mainly via the oral route. Its eggs are excreted in the host's feces and enter the aquatic environment, where they successively parasitize first intermediate hosts (freshwater snails) and second intermediate hosts (freshwater fish and shrimp), gradually developing into metacercariae. When definitive hosts such as humans, cats, and dogs ingest fish and shrimp containing metacercariae, the metacercariae migrate through the digestive tract to the host's hepatobiliary ducts, eventually developing into adult worms and parasitizing there. Infection can lead to cholangitis, cholecystitis, obstructive jaundice, or cholangiohepatitis, often complicated by biliary tract infection and cholelithiasis. Complications are numerous, with common ones including cholecystitis, cholangitis, gallstones, hepatobiliary obstruction, and cholangiohepatitis. Adult worms occasionally parasitize the pancreatic duct, causing pancreatitis and cholangitis; in addition, they can promote the proliferation of bile duct epithelial cells, thereby inducing bile duct cancer. In endemic areas, it is a serious public health problem. In 2009, the International Agency for Research on Cancer (IARC) classified Clonorchis sinensis as a Group 1 human carcinogen. Because some patients with this disease have no obvious clinical manifestations, it is easily confused with diseases such as hepatitis, often leading to misdiagnosis and mistreatment. Current diagnostic methods include etiological testing (such as the modified Kato thick smear method and the aldehyde-ether centrifugation precipitation method), immunological testing (such as ELISA), and imaging testing (such as B-ultrasound). Among them, WS 309-2009 "Diagnostic Criteria for Clonorchiasis" recommends three etiological examinations, including ELISA and the modified Kato thick smear method. However, etiological testing has limitations such as small eggs, easy to miss, false negatives in low infection levels, difficulty in distinguishing similar eggs, and the need for professional personnel to operate. Although immunological testing is objective and easy to operate, it has problems such as poor specificity. To overcome these limitations, a variety of PCR-based detection technologies have been developed, which can rapidly amplify and identify trematode species.

[0003] Existing PCR-based detection technologies have several limitations: Jilin University's patent CN 112322754 A uses a liquid reaction system, requiring low-temperature storage and transportation, and lacks a dedicated internal control to monitor the entire detection process; while the patents CN 120006006 A and CN 120006007 A from the First Affiliated Hospital of Sun Yat-sen University (Guangxi Hospital) introduce internal control primers, they do not employ freeze-drying technology, resulting in insufficient convenience for storage and transportation; the droplet-type digital PCR kit patented by the Institute of Parasitic Diseases Prevention and Control, Chinese Center for Disease Control and Prevention (CN 110760596 A) requires specialized instruments and is costly; Jilin University's dual PCR detection method patented by CN 112176077 A is only applicable to Clonorchis sinensis and Clonorchis orientalis metacercariae, limiting its applicability and also relying on low-temperature storage and transportation.

[0004] Therefore, there is a need for a rapid, accurate, and low-temperature-independent detection technique for Clonorchis sinensis. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a freeze-dried PCR kit for detecting Clonorchis sinensis in fecal samples.

[0006] The core improvements of this invention are reflected in the following three aspects: First, an optimized freeze-drying process is adopted. The reaction solution containing Clonorchis sinensis COX1 gene specific primers and probes (SEQ ID NO:1-3), human ACT gene internal reference primers and probes (SEQ ID NO:4-6), hot-start Taq DNA polymerase and other components is mixed with freeze-drying protectant of 4% trehalose, 2% gelatin and 2% maltodextrin. The mixture is then processed into freeze-dried powder through a multi-step process. It is equipped with positive control, negative control and nuclease-free water reconstitution solvent to achieve room temperature storage and transportation (stability period ≥12 months), reduce transportation costs and allow for direct use after reconstitution. Second, a dual fluorescence detection system is constructed, with the COX1 gene ensuring detection specificity, the ACT internal control monitoring the effectiveness of nucleic acid extraction and amplification, and the combination of the fluorescence PCR program FAM and VIC channel for synergistic detection, achieving 100% specificity for clinical samples and avoiding false negatives / false positives. Third, the reaction ratio has been optimized, with each tube containing 0.4 μM of primer, 0.2 μM of probe, and 0.5 U of hot-start Taq enzyme, achieving a detection sensitivity of 5 copies / reaction, which is far superior to existing technologies.

[0007] Based on this, the present invention provides a lyophilized PCR kit for detecting Clonorchis sinensis in fecal samples. Fecal samples are a common clinical sample type for detecting Clonorchis sinensis infection in humans, as the parasite's eggs are excreted in the feces of infected individuals. This kit uses lyophilized reagents, exhibiting excellent stability and allowing for transport at room temperature. During use, only nuclease-free sterile water and the corresponding fecal nucleic acid template need to be added for direct detection. This kit enables rapid and accurate screening of Clonorchis sinensis in fecal samples, offering significant advantages such as ease of operation and stable and reliable results, making it suitable for widespread application in various clinical laboratories.

[0008] The technical solution of this invention to solve the technical problem is as follows: This invention provides a lyophilized PCR kit for detecting Clonorchis sinensis in fecal samples, the lyophilized PCR kit comprising a lyophilized reaction powder, a positive control, a negative control, and a reconstitution solvent; The lyophilized reaction powder is prepared by freeze-drying a reaction solution containing the following components: (a) The first primer pair and the first probe used to detect the COX1 gene of Clonorchis sinensis; (b) A second primer pair and a second probe for detecting the human genome actin (ACT) gene; (c) PCR reaction components: including hot-start Taq DNA polymerase, dNTPs, and buffer system; (d) Lyophilization protectant.

[0009] Furthermore, the first probe and the second probe are respectively labeled with a fluorescent group and a quenching group at both ends. The fluorescent group is one of FAM, VIC or other fluorescent groups with luminescent properties, and the quenching group is one of BHQ1, MGB or other chemical groups with fluorescence quenching function.

[0010] Further, the sequences of the first primer pair (COX1) are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the sequence of the first probe is shown in SEQ ID NO: 3; the sequences of the second primer pair (ACT) are shown in SEQ ID NO: 4 and SEQ ID NO: 5; and the sequence of the second probe is shown in SEQ ID NO: 6.

[0011] Furthermore, each tube of the reaction lyophilized powder comprises: 0.1 μM to 1 μM for each primer, 0.1 μM to 1 μM for each probe, 0.1 to 1 unit of hot-start Taq DNA polymerase, 2% to 10% lyophilization protectant (w / v), 0.1 to 1 mM dNTP, and a 1 to 10× buffer system.

[0012] Furthermore, each tube of the lyophilized reaction powder includes 0.4 μM of each primer, 0.2 μM of each probe, 0.5 U Taq DNA polymerase, 3% w / v lyophilization protectant, 0.6 mM dNTP, and a 5× buffer system.

[0013] Furthermore, the hot-start Taq DNA polymerase is a mutant antibody-modified Taq DNA polymerase.

[0014] Furthermore, the freeze-drying protectant comprises one or more of the following: mannitol, HPMC-E5, trehalose, PEG-6000, sucrose, maltodextrin, gelatin, CMC-Na (50-200 cps), PVP-10000, etc.

[0015] Furthermore, the freeze-drying protectant comprises 1%~10% w / w trehalose, 1%~10% w / w gelatin and 1%~10% w / w maltodextrin, with the balance being nuclease-free water.

[0016] Furthermore, the freeze-drying protectant comprises 4% w / w trehalose, 2% w / w gelatin and 2% w / w maltodextrin, with the balance being nuclease-free water.

[0017] Furthermore, the freeze-drying procedure for preparing the reaction freeze-dried powder includes: pre-cooling at 4°C for 20 min; pre-freezing at -40°C for 2 h; pre-freezing at -30°C for 4 h at 0.14 mbar; sublimation at -10°C for 2 h at 0.14 mbar; sublimation at 0°C for 1 h at 0.14 mbar; and desorption at 30°C for 5 h at 0.14 mbar.

[0018] Furthermore, the positive controls consist of a plasmid containing the Clonorchis sinensis COX1 gene fragment (nucleotide sequence as shown in SEQ ID NO: 7), a plasmid containing the human ACT gene fragment (nucleotide sequence as shown in SEQ ID NO: 8), and TE buffer, with each plasmid having a concentration of 10. 5 copies / mL.

[0019] Further, the negative control consists of a plasmid containing a human ACT gene fragment (nucleotide sequence as shown in SEQ ID NO: 8) and TE buffer, with a plasmid concentration of 10. 5 copies / mL.

[0020] Furthermore, the resolvent is nuclease-free water.

[0021] Furthermore, the fluorescence PCR amplification program is as follows: 95℃ for 30s; 95℃ for 10s, 58℃ for 30s, 40 cycles (for acquiring fluorescence signals); COX1 is detected in the FAM channel, and ACT is detected in the VIC channel.

[0022] The lyophilized reagent prepared in this invention involves mixing a premixed reaction system targeting the aforementioned multiple targets with lyophilization protectants (trehalose, gelatin, and maltodextrin), followed by optimized process freeze-drying to form a lyophilized reaction powder. It exhibits excellent stability and can be transported at room temperature. For use, only nuclease-free sterile water and the corresponding nucleic acid template need to be added for direct instrumental detection. This kit enables rapid and accurate screening of Clonorchis sinensis in fecal samples, offering significant advantages such as ease of operation, stable and reliable results, and strong anti-interference capabilities, making it suitable for widespread application in various clinical laboratories.

[0023] The present invention has the following technical effects: This invention targets the COX1 gene specific to Clonorchis sinensis and uses PCR amplification technology to detect fecal samples. It can accurately identify Clonorchis sinensis nucleic acid and effectively avoid cross-reactions with other parasites and intestinal flora. The detection specificity and sensitivity are significantly improved, and the repeatability and stability are excellent, which can greatly reduce the risk of missed detection in samples with low infection levels.

[0024] This invention uses non-invasively collected feces as the test sample and combines PCR technology to rapidly amplify the target gene. It requires no invasive sampling or complex pretreatment, is simple to operate and easy to promote. It significantly improves patient compliance (especially in large-scale screening populations), simplifies the testing process and shortens the testing cycle, and provides an efficient technical means for the early screening and clinical diagnosis of Clonorchis sinensis infection.

[0025] This reagent is processed using a freeze-drying process, which not only ensures performance stability but also enables storage and transportation at room temperature, significantly reducing transportation costs. Attached Figure Description

[0026] Figure 1 It is a lyophilized reaction powder.

[0027] Figure 2 This is a comparison between lyophilized PCR reagent and liquid PCR reagent. In this diagram, a represents the positive control; b represents the negative control.

[0028] Figure 3 These are the results of the reagent kit stability test. In this table, a represents a positive sample; b represents a negative sample.

[0029] Figure 4 These are the clinical sample test results from the kit. Where a represents a positive sample and b represents a negative sample. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0031] Example 1: Primer and probe design for target and internal standard The gene sequence of Clonorchis sinensis was obtained from the NCBI (National Center of Biotechnology Information) database. Primer and probe sequences were designed in conserved regions according to primer and probe design principles. The primer and probe sequences used for the target and internal control in this invention are shown in the table below.

[0032] .

[0033] A synthetic plasmid containing the COX1 gene fragment of Clonorchis sinensis, the sequence of which is shown in SEQ ID NO: 7, is as follows: ATGTTATTTCATCAGATGTTTTATAATTATGTGGTTACTAGGCATGGGGTTGCTATGATTTTTTTCTTCTTGATGCCTGTTCTTGTGGGCGGTTTTGGTAACTACCTACTGCCTCTGTTACTTGGTTTATCAGATTTGAATT The synthetic plasmid sequence containing the human ACT gene fragment is shown in SEQ ID NO: 8, and is as follows: CCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGG The primers, probes and plasmids used in this invention were all synthesized by Jiangsu Kangwei Century Biotechnology Co., Ltd.

[0034] Example 2: Preparation of lyophilized PCR reagents and kits for detecting Clonorchis sinensis in fecal samples (1) Reaction lyophilized powder: The reaction lyophilized powder is prepared as follows: .

[0035] The freeze-drying mixture was prepared according to the above system. After mixing, the freeze-drying mixture was dispensed into eight-packs at a rate of 25 μl / reaction and then freeze-dried.

[0036] The freeze-drying program was as follows: pre-cooling at 4℃ for 20 min; pre-freezing at -40℃ for 2 h; pre-freezing at -30℃ for 4 h at 0.14 mbar; sublimation at -10℃ for 2 h at 0.14 mbar; sublimation at 0℃ for 1 h at 0.14 mbar; and desorption at 30℃ for 5 h at 0.14 mbar.

[0037] After freeze-drying, cover the eight-pack with a lid, place the eight-pack into an aluminum foil bag, and vacuum-seal to obtain the freeze-dried reaction powder. The freeze-dried reaction powder is as follows: Figure 1 As shown.

[0038] (2) Positive controls: plasmids containing the COX1 gene fragment of Clonorchis sinensis, plasmids containing the human ACT gene fragment, and TE buffer, with each plasmid having a concentration of 10. 5 copies / mL; (3) Negative control: plasmid containing the human ACT gene fragment and TE buffer, both with a plasmid concentration of 10. 5 copies / mL.

[0039] (4) Resolvent: Nuclease-free water.

[0040] The kit (24 doses / box) components are shown in the table below: .

[0041] The Taq DNA polymerase, dNTPs, buffer system, etc. used in this invention are all from Jiangsu Kangwei Century Biotechnology Co., Ltd.

[0042] Example 3: Detection procedure of lyophilized PCR reagents and kits for detecting Clonorchis sinensis in fecal samples as described in Example 2. 1) Sample processing: Take 200 μL of the sample to be tested, positive control and negative control. It is recommended to use the nucleic acid extraction or purification reagent (Su Tai Medical Device Registration No. 20240072) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd., and perform nucleic acid extraction according to its instructions.

[0043] 2) Sample addition: ① Preparation of reaction solution: Calculate the required number of reactions based on the number of samples to be tested. If the number of samples is n, then the total number of reactions N = n + 2. Take N tubes of lyophilized reaction powder, centrifuge for 30 seconds to ensure that the lyophilized reaction powder reaches the bottom of the tube, and set aside for later use.

[0044] ② Sample addition: Gently open the cap of the eight-tube containing the lyophilized powder, add 20 μL of reconstituted solvent to the lyophilized reaction powder, and cap the tube again. Take 5 μL of extracted sample nucleic acid, positive control, and negative control, and add them to the tube containing the reconstituted lyophilized reaction powder. The total reaction volume is 25 μL.

[0045] ③ Vortex for 30 seconds until completely dissolved and the solution is clear with no white lyophilized residue. Remove air bubbles and centrifuge for 30 seconds. Set aside for later use.

[0046] 3) PCR amplification This invention uses an ABI 7500 real-time quantitative PCR instrument for detection. The fluorescence PCR amplification program is: 95℃ for 30s; 95℃ for 10s, 58℃ for 30s, 40 cycles (for acquiring fluorescence signals); COX1 is detected in the FAM channel, and the ACT internal standard is detected in the VIC channel.

[0047] 4) Results Analysis ① Quality control standards: Positive control: The target Ct value for FAM and VIC channels should be ≤35; Negative control: FAM channel shows no amplification curve (No Ct) or Ct value > 38, VIC channel corresponding target Ct value should be ≤ 35; All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0048] ②Result Determination If the FAM and VIC channels show a clear S-shaped amplification curve and the Ct value is ≤38, the result is considered positive; if the FAM and VIC channels show no amplification curve (No Ct) or the Ct value is >38, the result is considered negative. See the table below for details: .

[0049] Note: For samples that test positive for Clonorchis sinensis, the internal standard test result is not required; for negative samples, the internal standard test should be positive. If the internal standard test is negative, the test result of the sample is invalid, the cause should be found and eliminated, and the sample should be retested and the experiment repeated.

[0050] Example 4: Comparison of PCR lyophilized reagents and PCR liquid reagents This embodiment uses the PCR lyophilized reagent prepared in Example 2 and the liquid PCR reagent with the same formulation as the lyophilized reagent for comparative testing.

[0051] PCR lyophilized reagent: Reaction lyophilized powder + 20 μl reconstitution solvent + 5 μl nucleic acid of the sample to be tested The liquid reagent formula is as follows: .

[0052] The samples to be tested served as positive and negative controls; The detection method is the same as in Example 3. The positive and negative controls meet the quality control standards, and the detection is effective.

[0053] Test results as follows Figure 2As shown: The lyophilized reagent prepared by the method of this invention has essentially no change in detection performance compared to the liquid PCR reagent with the same formulation as the lyophilized reagent.

[0054] Example 5: Sensitivity detection of the lyophilized PCR reagents and kits used for detecting Clonorchis sinensis in fecal samples in Example 2. Positive samples were diluted with negative samples (sterile saline) to five different concentrations. RNase-free water was used as a template-free control. All templates were replicated 20 times. The detection method was the same as in Example 3. The results are shown in the table below: the detection sensitivity for Clonorchis sinensis was 5 copies / reaction.

[0055] .

[0056] Example 6: Stability test of the lyophilized PCR reagents and kits used for detecting Clonorchis sinensis in fecal samples in Example 2. The PCR lyophilized kit was stored at room temperature for 13 months and compared with freshly prepared PCR lyophilized kits. The samples used for testing were remaining positive and negative fecal samples from the hospital's laboratory for Clonorchis sinensis testing. The detection method was the same as in Example 3.

[0057] Test results as follows Figure 3 As shown, the PCR lyophilized kit stored at room temperature for 13 months and the newly prepared PCR lyophilized kit have basically the same detection effect. Therefore, the PCR lyophilized kit prepared in Example 2 can be stored at room temperature for at least 12 months.

[0058] Example 7: Clinical application of the lyophilized PCR reagents and kits used in Example 2 for detecting Clonorchis sinensis in fecal samples. The reagents used were the freeze-dried PCR reagents and kits for detecting Clonorchis sinensis in fecal samples prepared in Example 2. The samples to be tested were 8 remaining Clonorchis sinensis fecal samples and 8 negative fecal samples from the hospital's laboratory.

[0059] The detection method was the same as in Example 3. The positive and negative controls met the quality control standards, and the test was valid.

[0060] like Figure 4 As shown in the table below, the test results are as follows: 8 samples were positive for Clonorchis sinensis, and 8 samples were negative; consistent with the hospital's diagnosis.

[0061] .

[0062] The above are merely embodiments of the present invention and do not limit the patent scope of the present invention. Any equivalent modifications made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A lyophilized PCR kit for detecting Clonorchis sinensis in fecal samples, characterized in that, The lyophilized PCR kit includes a reaction lyophilized powder, a positive control, a negative control, and a reconstitution solvent; The lyophilized reaction powder is prepared by freeze-drying a reaction solution containing the following components: (a) The first primer pair and the first probe used to detect the COX1 gene of Clonorchis sinensis; (b) A second primer pair and a second probe for detecting the human genome actin (ACT) gene; (c) PCR reaction components: including hot-start Taq DNA polymerase, dNTPs, and buffer system; (d) Lyophilization protectant.

2. The reagent kit according to claim 1, characterized in that, The sequences of the first primer pair (COX1) are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the sequence of the first probe is shown in SEQ ID NO: 3; the sequences of the second primer pair (ACT) are shown in SEQ ID NO: 4 and SEQ ID NO: 5; the sequence of the second probe is shown in SEQ ID NO: 6; the first probe and the second probe are labeled with a fluorescent group and a quenching group at both ends, respectively.

3. The reagent kit according to claim 1, characterized in that, Each tube of the lyophilized reaction powder comprises: 0.1 μM to 1 μM for each primer, 0.1 μM to 1 μM for each probe, 0.1 to 1 unit of hot-start Taq DNA polymerase, 2% to 10% lyophilization protectant (w / v), 0.1 to 1 mM dNTP, and a 1 to 10× buffer system.

4. The reagent kit according to claim 3, characterized in that, Each tube of the lyophilized reaction powder contains 0.4 μM of each primer, 0.2 μM of each probe, 0.5 U Taq DNA polymerase, 3% w / v lyophilization protectant, 0.6 mM dNTP, and a 5× buffer system.

5. The reagent kit according to claim 1, characterized in that, The hot-start Taq DNA polymerase is a mutant antibody-modified Taq DNA polymerase.

6. The reagent kit according to claim 1, characterized in that, The freeze-drying protectant comprises one or more of the following: mannitol, HPMC-E5, trehalose, PEG-6000, sucrose, maltodextrin, gelatin, CMC-Na (50-200 cps), PVP-10000, etc.

7. The kit according to claim 1, characterized in that, The freeze-drying protectant contains 1%~10% w / w trehalose, 1%~10% w / w gelatin and 1%~10% w / w maltodextrin, with the balance being nuclease-free water.

8. The reagent kit according to claim 1, characterized in that, The freeze-drying protectant contains 4% w / w trehalose, 2% w / w gelatin and 2% w / w maltodextrin, with the balance being nuclease-free water.

9. The reagent kit according to claim 1, characterized in that, The freeze-drying process for preparing the reaction freeze-dried powder includes: pre-cooling at 4°C for 20 min; pre-freezing at -40°C for 2 h; pre-freezing at -30°C for 4 h at 0.14 mbar; sublimation at -10°C for 2 h at 0.14 mbar; sublimation at 0°C for 1 h at 0.14 mbar; and desorption at 30°C for 5 h at 0.14 mbar.

10. The kit according to claim 1, characterized in that, The positive controls consisted of a plasmid containing the Clonorchis sinensis COX1 gene fragment (nucleotide sequence shown in SEQ ID NO: 7), a plasmid containing the human ACT gene fragment (nucleotide sequence shown in SEQ ID NO: 8), and TE buffer, with each plasmid having a concentration of 10. 5 copies / mL; The negative control consisted of a plasmid containing a human ACT gene fragment (nucleotide sequence as shown in SEQ ID NO: 8) and TE buffer, with a plasmid concentration of 10. 5 copies / mL; The resolvent is nuclease-free water.

Images