Nano PCR primers, kits, and detection methods for detecting bovine parvovirus.

Abstract

The application discloses Nano PCR primers, a kit and a detection method for detecting bovine parvovirus, and belongs to the technical field of virus detection. The application also provides a Nano PCR detection method for bovine parvovirus. 1 The primers and the detection method provided by the application have high sensitivity, the detection limit is 5x10 copies / μL, the possibility of missed detection is avoided, the specificity is high, and technical support is provided for effectively detecting and preventing and controlling bovine parvovirus.

Description

Technical Field

[0001] This invention relates to the field of virus detection technology, and in particular to Nano PCR primers, kits, and detection methods for detecting bovine parvovirus. Background Technology

[0002] Bovine parvovirus (BPV) is a significant pathogen affecting cattle farming. It can infect cattle of all ages, causing symptoms such as skin nodules, respiratory issues, and digestive disturbances. Calf mortality is high after infection, while adult cattle are prone to growth retardation and decreased productivity. BPV can also spread rapidly through contact, causing regional outbreaks and significant economic losses to the beef and dairy cattle industries. With the increasing scale and intensification of cattle farming in my country, the cross-regional movement of cattle is becoming more frequent, further increasing the risk of BPV transmission. Therefore, rapid and accurate detection of BPV has become a crucial aspect of disease control.

[0003] Currently, the main detection methods for bovine parvovirus include virus isolation and culture, serological testing, and routine PCR testing. Virus isolation and culture is the "gold standard" for pathogen detection, but this method is cumbersome, has a long culture cycle, and requires specialized biosafety laboratory conditions, making it difficult to meet the needs of grassroots farms and rapid clinical testing. Serological tests, such as enzyme-linked immunosorbent assay (ELISA), mainly detect the antibody level in the body, which can only reflect whether cattle have been infected with the virus. They cannot achieve real-time diagnosis of acute infection and are prone to false positives due to cross-reactivity, thus limiting the specificity of the test.

[0004] Conventional PCR technology has become a commonly used method for bovine parvovirus detection due to its relatively simple operation and fast detection speed. However, this technology suffers from insufficient sensitivity, resulting in a low detection rate for low-concentration virus samples and a high risk of false negatives, hindering early diagnosis of the disease. Furthermore, some conventional PCR detection methods lack specificity, exhibiting cross-amplification with other common bovine viruses such as bovine viral diarrhea virus, bovine coronavirus, and bovine infectious rhinotracheitis virus, affecting the accuracy of the results. In addition, the reaction systems and amplification procedures of some existing bovine parvovirus detection methods have not been systematically optimized, resulting in poor detection stability and making them unsuitable for the large-scale sample testing needs of primary care clinics.

[0005] Therefore, developing a highly sensitive, specific, rapid, and accurate nano-PCR detection primer, kit, and method for bovine parvovirus is of great significance for achieving early and rapid diagnosis of bovine parvovirus and effectively controlling the spread of the virus. Summary of the Invention

[0006] The purpose of this invention is to provide Nano PCR primers, kits, and detection methods for detecting bovine parvovirus, in order to solve the problems existing in the prior art.

[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is a Nano PCR primer for detecting bovine parvovirus, comprising an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2.

[0008] The second technical solution of the present invention is a kit for detecting parvovirus, comprising the aforementioned Nano PCR primers.

[0009] The third technical solution of the present invention is the application of the Nano PCR primers or the kit in the detection of bovine parvovirus.

[0010] The fourth technical solution of the present invention is a method for detecting bovine parvovirus for non-disease diagnosis or treatment purposes, comprising the following steps: using the DNA of the sample to be tested as a template, performing a Nano PCR amplification reaction using the Nano PCR primers or the kit, and determining whether bovine parvovirus is present based on the amplification results.

[0011] Based on the above technical solution, the present invention has the following technical effects: The Nano PCR primers, kit, and detection method for detecting bovine parvovirus provided by this invention achieve highly sensitive, highly specific, efficient, and convenient detection results through targeted design of specific primers and optimization of the reaction system and amplification procedure, with a detection limit as low as 5 × 10⁻⁶. 1 With a sensitivity 100 times higher than conventional PCR methods, this method can accurately detect low-concentration virus samples, effectively avoiding missed detections. This detection method only amplifies bovine parvovirus and has no cross-reactivity with other common bovine viruses such as bovine viral diarrhea virus and bovine coronavirus, ensuring accurate and reliable results. Furthermore, it requires no complex instruments or equipment, and the accompanying kit can be directly used for batch clinical sample testing. This method is of great significance for the early diagnosis, epidemiological investigation, and disease control of bovine parvovirus, effectively reducing the risk of virus transmission in cattle herds and minimizing economic losses in the livestock industry. Attached Figure Description

[0012] Figure 1 This is a map of the pMD-19T-VP2 plasmid.

[0013] Figure 2The results of Nano PCR detection at different concentrations of gold nanoparticles are shown; where M: DL 1,000 DNA Marker; lanes 1-5: screening for 0.1, 0.2, 0.3, 0.5, and 0.6 mM gold nanoparticles; lane 6: negative control.

[0014] Figure 3 The results of Nano PCR detection at different template concentrations are shown; where M: DL 2,000 DNA Marker; lane 1: negative control; lanes 2-9: 2, 4, 6, 8, 10, 12, 14, and 16 ng templates for screening.

[0015] Figure 4 The results are for Nano PCR detection at different upstream / downstream primer concentrations; where M: DL 2,000 DNA Marker; lane 1: negative control; lanes 2-7: 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 μM upstream / downstream primers.

[0016] Figure 5 The results of Nano PCR detection at different annealing temperatures are shown; where M: DL 2,000 DNA Marker; lane 1: negative control; lanes 2-8: annealing temperatures of 52, 53, 54, 55, 56, 57, and 58℃.

[0017] Figure 6 The results are from a sensitivity experiment; where M: DL 1,000 DNA Marker; 1: negative control; 2: 5 × 10⁻⁶ DNA Marker. 8 copies / μL, 3: 5×10 7 copies / μL, 4: 5×10 6 copies / μL, 5: 5×10 5 copies / μL, 6: 5×10 4 copies / μL, 7: 5×10 3 copies / μL, 8: 5×10 2 copies / μL, 9: 5×10 1 copies / μL.

[0018] Figure 7 For specific experimental results; where M: DL 2,000 DNA Marker; 1: Negative control; 2: BVDV; 3: BPV; 4: BCoV; 5: IBRV.

[0019] Figure 8The results are the BPV Nano PCR detection results in the actual tested samples; where M: DL 1,000 DNA Marker; 1: negative control; 2-9: BPV diseased samples. Detailed Implementation

[0020] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0021] This invention provides a Nano PCR primer for detecting bovine parvovirus, comprising an upstream primer as shown in SEQ ID NO. 1 and a downstream primer as shown in SEQ ID NO. 2.

[0022] This invention also provides a kit for detecting bovine parvovirus, including the Nano PCR primers.

[0023] This invention also provides the application of the Nano PCR primers or the kit in the detection of bovine parvovirus.

[0024] This invention also provides a method for detecting bovine parvovirus for non-disease diagnosis or treatment purposes, comprising the following steps: using the DNA of the sample to be tested as a template, performing a Nano PCR amplification reaction using the Nano PCR primers or the kit, and determining whether bovine parvovirus is present based on the amplification results.

[0025] In some specific implementations, the Nano PCR amplification reaction system consists of: 12.5 μL 2×PremixTaq, 20 ng DNA template, 1 μL 0.5 μM upstream primer, 1 μL 0.5 μM downstream primer, and 0.3 mM gold nanoparticles.

[0026] In some specific implementations, the Nano PCR amplification reaction procedure is as follows: pre-denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C.

[0027] In some specific implementation schemes, the method for determining whether bovine parvovirus is present is to detect the amplification products by agarose gel electrophoresis, and the presence of a specific band indicates a positive result.

[0028] Main experimental materials in the embodiments of this invention: Bovine parvovirus (BPV) was previously preserved in our laboratory and collected from fecal swabs of cattle infected with BPV; samples to be tested were collected from cattle farms in various regions of Yanbian Korean Autonomous Prefecture, Jilin Province; Bovine infectious rhinotracheitis virus (IBRV) was preserved by the Department of Veterinary Medicine, College of Agriculture, Yanbian University. Viral genomic DNA / RNA extraction kit and gel recovery kit were purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd. DL1,000 DNA Marker, DL2,000 DNA Marker, and pMD19-T vector were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd. The 2×Premix Taq PCR Mix kit was purchased from TIANGEN (Beijing) Co., Ltd.; gold nanoparticles were purchased from Sigma-Aldrich (USA); and DH5α competent cells were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0029] Example 1 Using the BPV-VP2 gene (GenBank No. M14363.1) registered in NCBI as a reference sequence, specific primers for the NanoPCR detection method were designed: Upstream primer VP2-F: 5'-CCAGCTCCAATATCAGTCGTAG-3' (SEQ ID NO.1); Downstream primer VP2-R: 5'-GTAGATTCTCCCGTTGCGTAG-3' (SEQ ID NO.2).

[0030] Synthesized by Invesco Great Britain (Shanghai) Trading Co., Ltd.

[0031] The amplified sequence of the above primer pair is (SEQ ID NO.3): CCAGCTCCAATATCAGTCGTAGACAACAACACTACAAACACAGTAGAAGAACACCTACTGAAAGGAGTGCCTCTGTACATGCTGGAAAACTCTGACCACGAAGTGCTACGCAACGGGAGAATCTAC.

[0032] Example 2 Construction and Identification of Recombinant Plasmid Standards BPV genomic DNA was extracted according to the instructions of the viral genomic DNA / RNA extraction kit (Jiangsu Kangwei Century Biotechnology Co., Ltd.). The extracted DNA was used as a template and VP2-F / VP2-R was used as primers for Nano PCR amplification.

[0033] The amplification system for Nano PCR was: 12.5 μL 2×Premix Taq, 2 μL DNA template, 0.5 μM upstream primer, and 0.5 μM downstream primer; The amplification program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃.

[0034] After PCR products were subjected to 1.5% agarose gel electrophoresis, the gel fragment containing the target fragment was excised under UV light for recovery and purification. The fragment was then ligated into the pMD19-T vector. The reaction mixture consisted of 1 μL pMD19-T vector, 5 μL DNA Ligation Solution I, and 4 μL gel-recovered DNA to obtain the recombinant plasmid pMD19-T-VP2. Figure 1 The samples were sent to Changchun Kumei Biotechnology Co., Ltd. in Jilin Province for sequencing. After sequence alignment and identification, recombinant plasmid standards for Nano PCR were prepared. The concentration of the plasmid standards was determined using the formula: Copy / μL = (6.02 × 10⁻⁶) 23 )×(ng / μL×10 -9 ) / (dsDNA×660).

[0035] Convert copy number to copy number concentration (5 × 10⁻⁶) 11 (copies / μg), used as plasmid standards for the experiment, stored at -20℃ for later use.

[0036] Example 3 Establishment and optimization of BPV Nano PCR detection method Using the constructed recombinant plasmid pMD19-T-VP2 standard as a template, a 25 μL reaction system was established with optimal template concentration, gold nanoparticle concentration, and primer concentration to establish a Nano PCR method. The Nano PCR template concentrations (2, 4, 6, 8, 10, 12, and 14 ng) were optimized to obtain the optimal template concentration for the reaction system.

[0037] The concentrations of gold nanoparticles in Nano PCR (0.1, 0.2, 0.3, 0.4, 0.5, 0.6 mM) were optimized to obtain the optimal concentration of gold nanoparticles in the reaction system.

[0038] The concentrations of upstream and downstream primers for Nano PCR (0.2, 0.3, 0.4, 0.5, 0.6, 0.7 μM) were optimized to obtain the optimal concentrations of upstream and downstream primers for the reaction system.

[0039] The annealing temperatures (52, 53, 54, 55, 56, 57, 58 ℃) were optimized to obtain the optimal annealing temperatures for the reaction conditions. The specific method is as follows: 1. Screening for the optimal template concentration in the Nano PCR reaction system To investigate the optimal template concentration in the BPV Nano PCR reaction system, different concentrations (2, 4, 6, 8, 10, 12, 14 ng) of pMD19-T-VP2 plasmid template were added to the reaction system for BPV Nano PCR amplification.

[0040] The amplification system for Nano PCR is as follows: 12.5 μL 2×Premix Taq, 4~20 ng DNA template, 1 μL upstream primer, 1 μL downstream primer, and different concentrations of gold nanoparticles (0.2-0.6mM). The amplification program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃.

[0041] The results showed that as the template concentration increased, the amplification product increased continuously. Figure 2 When the template concentration is 20 ng, the amount of amplified product is relatively large; when the template concentration continues to increase, the amplified product is not significantly different from that at the 20 ng template concentration. Therefore, this invention selects a template concentration of 20 ng as the optimal template concentration.

[0042] 2. Screening for the optimal concentration of gold nanoparticles in the Nano PCR reaction system To investigate the optimal concentration of gold nanoparticles in the BPV Nano PCR reaction system, different concentrations (0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM) of gold nanoparticles were added to the reaction system for BPV Nano PCR amplification.

[0043] The amplification system for Nano PCR is as follows: 12.5 μL 2×Premix Taq, 20 ng DNA template, 1 μL upstream primer, 1 μL downstream primer, and 0.1~0.6 mM gold nanoparticles (volume 1 μL). The amplification program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃.

[0044] The results showed that as the concentration of gold nanoparticles increased, the amount of amplification products continuously increased. Figure 3Subsequently, amplification inhibition occurred; when the concentration of gold nanoparticles was 0.3 mM, the amplification product was the most abundant; therefore, in this study, the optimal primer addition amount for the BPV Nano PCR detection method was selected as a gold nanoparticle concentration of 0.3 mM.

[0045] 3. Screening for the optimal primer concentration in the Nano PCR reaction system After determining the concentrations of template and colloidal gold particles in the BPV Nano PCR reaction system, the optimal primer concentrations in the BPV Nano PCR reaction system were further determined. Primers were added to final concentrations of 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 μM, respectively.

[0046] The amplification system for Nano PCR was as follows: 12.5 μL 2×Premix Taq, 20 ng DNA template, 1 μL 0.2~0.7 μM upstream primer, 1 μL 0.2~0.7 μM downstream primer, and 0.3 mM gold nanoparticles (volume 1 μL). The amplification program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃. The results are as follows. Figure 4 As shown.

[0047] The results showed that the amount of amplified product increased with increasing upstream / downstream primer concentration; when both upstream and downstream primer concentrations were 0.5 μM, the amount of amplified product was relatively large; when the primer concentration continued to increase, the amplified product was not significantly different from that when 0.5 μM primers were added. Therefore, the optimal primer concentration for the BPV Nano PCR detection method of this invention is 0.5 μM.

[0048] 4. Screening the optimal annealing temperature for the Nano PCR reaction system After determining the optimal concentrations of template, colloidal gold particles, and primers in the BPV Nano PCR reaction system, the optimal annealing temperature in the BPV Nano PCR reaction system was further determined.

[0049] The amplification system consisted of: 12.5 μL 2×Premix Taq, 20 ng DNA template, 1 μL 0.5 μM upstream primer, 1 μL 0.5 μM downstream primer, and 0.3 mM gold nanoparticles (1 μL in volume).

[0050] The amplification program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 52-58℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃.

[0051] The results showed that during BPV Nano PCR detection, the specificity of the amplification products gradually increased with increasing annealing temperature. When the annealing temperature reached 56 ℃, there were more amplification products. When the annealing temperature continued to rise, the amplification products showed no significant difference from those annealed at 56 ℃, and the negative control showed no amplification band. Figure 5 Therefore, the present invention selects 56 ℃ as the optimal annealing temperature.

[0052] Example 4 Sensitivity of BPV Nano PCR detection To compare the sensitivity of the BPV PCR method and the BPV Nano PCR method, the established BPV Nano PCR and BPV PCR methods were used to analyze samples with concentrations of 5 × 10⁻⁶. 1 ~ 5×10 9 The recombinant plasmid pMD19-T-VP2 standard was tested at copies / μL.

[0053] The reaction procedure and reaction system for BPV Nano PCR are the same as in Example 3.

[0054] The reaction system for conventional PCR is as follows: 12.5 μL 2×Premix Taq, 20 ng DNA template, 0.5 μM upstream primer, and 0.5 μM downstream primer. The primers and reaction procedure used for conventional PCR are the same as those for the BPV Nano PCR method.

[0055] The results showed that the limit of detection for recombinant plasmid standards using this method was 5 × 10⁻⁶. 1 copies / μL ( Figure 6 The limit of detection for conventional PCR is 5 × 10⁻⁶. 3 The Nano PCR method, with copies / μL, is 100 times more sensitive than the conventional PCR method.

[0056] Example 5 Specificity of BPV Nano PCR Detection The optimized BPV Nano PCR reaction system was used with BCoV, IBRV, and BVDV nucleic acids as templates to analyze the specificity of the detection primers and detection method of this invention. The results showed that the established BPV Nano PCR detection method can only specifically detect BPV. Figure 7The absence of amplification of other viral nucleic acids indicates that the established BPV Nano PCR has good specificity.

[0057] Example 6 Actual sample testing Twenty skin nodule tissue samples from cattle farms in various regions of Yanbian Prefecture suspected of having BPV infection were collected, minced, and homogenized with an appropriate amount of sterile PBS solution to prepare a tissue homogenate of approximately 10% by weight. The homogenate was subjected to three freeze-thaw cycles and centrifuged at 4000 rpm for 30 min at 4°C to extract viral genomic DNA. Nano PCR detection showed a 100% positive rate (24 / 24). Figure 8 The detection rate of the method of the present invention is higher than 85%. This indicates that the Nano PCR method established in this invention provides accurate and reliable detection results and can be used for batch testing of clinical samples.

[0058] As can be seen from the above embodiments, the present invention provides nano PCR primers, a kit, and a detection method for detecting bovine parvovirus. The nano PCR primers and detection method of the present invention have high sensitivity, with a detection limit of 5 × 10⁻⁶. 1 With copies / μL, it has good specificity and high accuracy, and can be used for the detection of bovine parvovirus.

[0059] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A Nano PCR primer for detecting bovine parvovirus, characterized in that, This includes the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.

2.

2. A kit for detecting bovine parvovirus, characterized in that, Includes the Nano PCR primers as described in claim 1.

3. The use of the Nano PCR primers as described in claim 1 or the kit as described in claim 2 in the detection of bovine parvovirus.

4. A method for detecting bovine parvovirus for purposes other than disease diagnosis or treatment, characterized in that, Includes the following steps: Using the DNA of the sample to be tested as a template, Nano PCR amplification reaction is performed using the Nano PCR primers described in claim 1 or the kit described in claim 2, and the presence of bovine parvovirus is determined based on the amplification results.

5. The detection method according to claim 4, characterized in that, The Nano PCR amplification reaction system consisted of: 12.5 μL 2×Premix Taq, 20 ng DNA template, 1 μL 0.5 μM upstream primer, 1 μL 0.5 μM downstream primer, and 0.3 mM gold nanoparticles.

6. The detection method according to claim 5, characterized in that, The Nano PCR amplification reaction program was as follows: pre-denaturation at 95℃ for 5 min, 35 cycles of denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min, final extension at 72℃ for 10 min, and storage at 4℃.

7. The detection method according to claim 6, characterized in that, The method for determining whether bovine parvovirus is present is to detect the amplification products by agarose gel electrophoresis; the presence of a specific band indicates a positive result.

Images