A strain of Rossellomorea marisflavi XJ3-14 and its application

Abstract

This invention discloses a plant Rossellomorea marisflavi The XJ3-14 strain and its application belong to the field of beneficial bacteria technology. This invention provides... Rossellomorea marisflavi The XJ3-14 strain was isolated for the first time and deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC M 2025698. It exhibits good salt and alkali tolerance and can grow well on media containing 16% NaCl or pH 12. It also has the ability to reduce alkali, fix nitrogen, solubilize potassium, dissolve organic phosphorus, dissolve inorganic phosphorus, produce protease and cellulase. Under normal conditions and salt and alkali stress conditions, it can significantly promote the photosynthetic capacity of cucumber plants, the growth of above-ground and underground parts, increase cucumber yield, improve cucumber quality, and can also significantly promote the growth of tomato and other plant seedlings.

Description

Technical Field

[0001] This invention relates to the field of beneficial bacteria technology, and in particular to a strain of beneficial bacteria. Rossellomorea marisflavi XJ3-14 strain and its application. Background Technology

[0002] Saline-alkali land refers to soil where the salt content affects the normal growth of crops. Based on salt content, it can be divided into slightly saline-alkali land, moderately saline-alkali land, and severely saline-alkali land. Slightly saline-alkali land has a salt content of less than 0.3%, while severely saline-alkali land has a salt content exceeding 0.6%. Arid and semi-arid regions are the main distribution areas of saline-alkali land. In addition, improper irrigation methods (such as flood irrigation or irrigation without drainage), long-term excessive use of chemical fertilizers, and insufficient use of organic fertilizers can also lead to increased soil salinity and the formation of saline-alkali land. The high concentration of salt ions in saline-alkali land lowers the osmotic pressure of the soil solution, inhibits seed germination and water absorption, and makes it extremely difficult for roots to absorb water and other necessary nutrients. Crops on saline-alkali land typically exhibit uneven emergence, weak growth, small, yellowing, scorched leaves, stunted growth, and premature aging; in severe cases, they may even die, leading to significant yield reduction or even crop failure.

[0003] Cucumber is an important economic vegetable crop in my country and one of the main types of vegetables grown in greenhouses. It is popular with consumers due to its unique flavor, crisp texture, high water content, rich nutrition, and easy digestibility, and plays an important role in regional economic development and social life. Cucumbers are sensitive to salt and alkali stress. Studies have shown that sodium ion concentrations ≥25 mmol / L or electrical conductivity EC values ​​≥2.2 dS / m can affect the normal growth and development of cucumber plants. When sodium ion concentrations ≥75 mmol / L, it significantly affects water absorption, the growth and development of both above-ground and underground parts of cucumber plants, inhibits photosynthetic carbon assimilation, disrupts ion homeostasis, and leads to wilting and yellowing of cucumber leaves. If this is not alleviated for a prolonged period, it can cause a significant reduction in cucumber yield or even total crop failure.

[0004] With increasing cultivation years and the long-term, excessive use of chemical fertilizers and pesticides, soil physicochemical properties have changed. In particular, the enclosed environment within greenhouses has exacerbated secondary soil salinization. Therefore, improving the saline-alkali land environment and mitigating the impact of saline-alkali stress on greenhouse crops is a crucial strategy for ensuring the sustainable development of greenhouse crop production. Summary of the Invention

[0005] The purpose of this invention is to provide a plant Rossellomorea marisflavi XJ3-14 strain and its applications, providing... Rossellomorea marisflaviThe XJ3-14 strain is the first strain isolated. It has good salt and alkali tolerance and can also reduce alkali, fix nitrogen, solubilize potassium, dissolve organic phosphorus, dissolve inorganic phosphorus, produce protease and cellulase. It can improve the yield and quality of cucumber under normal conditions and salt and alkali stress.

[0006] To achieve the above objectives, the present invention provides a plant Rossellomorea marisflavi Strain XJ3-14 was deposited on April 3, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 2025698.

[0007] Preferably, the Rossellomorea marisflavi The 16S rDNA sequence of strain XJ3-14 is shown in SEQ ID NO.3.

[0008] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in the preparation of saline-alkali land improvement products, wherein the product is added with the aforementioned Rossellomorea marisflavi XJ3-14 strain, the product is used to reduce soil salinity.

[0009] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in fertilizer preparation, wherein the fertilizer is added with the strain XJ3-14. Rossellomorea marisflavi XJ3-14 strain; the fertilizer has at least one effect of promoting the growth of aboveground and / or underground parts of plants and photosynthetic capacity; the fertilizer includes foliar fertilizer.

[0010] Preferably, the fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content, absorbable potassium content and absorbable iron content.

[0011] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in the preparation of a formulation that promotes the decomposition of organic matter, wherein the formulation is a formulation that promotes the decomposition of animal and plant residues, and wherein the formulation contains the aforementioned... Rossellomorea marisflavi strain XJ3-14.

[0012] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in the preparation of bactericidal agents, wherein the bactericidal agent is added with the aforementioned... Rossellomorea marisflavi strain XJ3-14.

[0013] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in the preparation of vegetable quality improvement agents, wherein the agent is added with the aforementioned Rossellomorea marisflavi XJ3-14 strain; the preparation has the effect of promoting at least one of the following: increasing the content of vitamin C, soluble protein and soluble sugar.

[0014] A plant as described above Rossellomorea marisflavi Application of strain XJ3-14 in the preparation of a specific formulation for salt-stressed plants, wherein the formulation contains the aforementioned... Rossellomorea marisflavi XJ3-14 strain; the preparation is used to promote crop growth and development under salt stress conditions.

[0015] Therefore, the present invention provides a plant Rossellomorea marisflavi XJ3-14 strain and its applications, with specific technical effects as follows: (1) The present invention provides a plant Rossellomorea marisflavi Strain XJ3-14 grows rapidly on LB agar at 28℃. The colonies are round, raised, with neat edges, smooth texture, moist and glossy, and are light yellow to orange-yellow in color. It was deposited on April 3, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan City, Hubei Province, with accession number CCTCC M 2025698. (2) The present invention provides Rossellomorea marisflavi Strain XJ3-14 exhibits high salt and alkali tolerance, growing well on media containing 16% NaCl or at pH 12; it also possesses alkalinity-lowering ability, with a reduction rate of 19.33%. (3) The present invention provides Rossellomorea marisflavi The XJ3-14 strain also possesses growth-promoting abilities such as nitrogen fixation, potassium solubilization, organic phosphorus solubilization, inorganic phosphorus solubilization, protease production, and cellulase production. Under normal conditions and salt-alkali stress conditions, it can significantly promote the photosynthetic capacity of cucumber plants, the growth of both above-ground and underground parts, increase cucumber yield, and improve cucumber quality.

[0016] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is in Embodiment 1 of the present invention Rossellomorea marisflavi Photograph of strain XJ3-14 growing on LB solid medium; Figure 2 It is the phylogenetic tree constructed in Embodiment 1 of the present invention; Figure 3These are the salt and alkali tolerance test results in Example 2 of the present invention; where a is a culture medium containing 10% NaCl and pH=9; b is a culture medium with pH=12; and c is a culture medium containing 16% NaCl. Figure 4 These are the results of growth-promoting characteristic detection in Example 2 of the present invention; where a is the nitrogen fixation result; b is the potassium solubilization result; c is the organic phosphorus dissolution result; d is the inorganic phosphorus dissolution result; e is the protease production result; and f is the cellulase production result. Figure 5 This is in embodiment 3 of the present invention Rossellomorea marisflavi The growth-promoting effect of strain XJ3-14 on cucumber seedlings; Figure 6 This is in embodiment 4 of the present invention. Rossellomorea marisflavi Results of stress relief of cucumber seedlings under salt-alkali stress by strain XJ3-14; Figure 7 This is in embodiment 5 of the present invention. Rossellomorea marisflavi Results of XJ3-14 strain on growth promotion of mature cucumber plants and fruits under salt-alkali stress; Figure 8 This is in embodiment 6 of the present invention. Rossellomorea marisflavi Results of XJ3-14 strain on promoting the growth of tomato seedlings.

[0019] Rossellomorea marisflavi Strain XJ3-14 was deposited on April 3, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M2025698. Detailed Implementation

[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0021] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all descriptions of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0022] The instruments, equipment, reagents, and materials used in the examples were all commercially available; methods not described in detail are conventional techniques in the art; letters after the values ​​in the table indicate significance, with different letters indicating significant differences. P <0.05.

[0023] The component information of the culture medium used in the examples is as follows: (1) LB medium: 5.0g yeast extract, 10g peptone, 10g sodium chloride, 15g agar, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15 minutes; (2) Assabeth medium: 0.2g potassium dihydrogen phosphate, 10.0g mannitol, 0.2g sodium chloride, 0.1g calcium sulfate, 5.0g calcium carbonate, 15.0g agar, 0.2g magnesium sulfate, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15min; (3) Skim milk culture medium: 10g skim milk powder and 20g agar are heated and dissolved in 1L of distilled water and autoclaved at 105℃ for 20min to avoid the formation of flocculent protein; (4) Organic phosphorus-soluble bacteria culture medium: glucose 10.0g, lecithin 0.2g, ammonium sulfate 0.5g, yeast extract 0.5g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium carbonate 1.0g, sodium chloride 0.3g, agar 15.0g, pH 7.0-7.5. 1L distilled water, autoclaved at 121℃ for 15min; (5) Inorganic phosphate-solubilizing bacteria culture medium: glucose 10.0g, ammonium sulfate 0.5g, yeast extract 0.5g, sodium chloride 0.3g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium phosphate 5.0g, agar 15.0g, pH 7.0-7.5, distilled water 1000mL, autoclave at 121℃ for 15min; (6) Sodium carboxycellulose medium: 10.0g peptone, 10.0g yeast powder, 10.0g sodium carboxycellulose, 5g sodium chloride, 1g potassium dihydrogen phosphate, 18g agar, 1L distilled water, autoclave at 121℃ for 15min; (7) Silicate bacterial culture medium: sucrose 5.0g, magnesium sulfate 0.5g, calcium sulfate 0.1g, disodium hydrogen phosphate 2.0g, ferric chloride 0.005g, glass powder 1.0g, agar 15.0g, pH 7.0±0.2. Weigh 23.6g of this product, add 1000mL of distilled water, and autoclave at 116℃ for 30min; (8) Chromium azurite CAS detection medium: Chromium azurite S (CAS) 0.06g, hexadecyltrimethylammonium bromide (HDTMA) 0.07g, ferric chloride hexahydrate 0.002g, sodium dihydrogen phosphate dihydrate 0.3g, disodium hydrogen phosphate dodecahydrate 0.3g, ammonium chloride 0.1g, potassium dihydrogen phosphate 0.04g, sodium chloride 0.06g, agar 9g, pH 6.8±0.1, distilled water 1000mL, autoclaved at 116℃ for 30min; (9) Preparation of bacterial suspension: The bacterial strain was activated to the logarithmic phase by culturing in LB medium at 28°C, centrifuged and washed, and then resuspended in sterile water to prepare a bacterial suspension with OD600≈0.8.

[0024] Example 1 strain Rossellomorea marisflavi The isolation, identification, and preservation of XJ3-14 are detailed below: (1) Sampling. Soil samples were collected from the rhizosphere of chili pepper plants in Yakshilak Village, Kumushilik Township, Shule County, Kashgar Prefecture, Xinjiang (76.36815504°N, 39.23638902°E) using the five-point sampling method. The method for collecting rhizosphere soil was as follows: the entire root system of the chili pepper plant, including the rhizosphere soil, was dug up with a shovel. The roots were then gently shaken to remove large clumps of soil without roots. The soil attached to the plant roots was then gently brushed off with a brush and collected into a resealable bag. Approximately 100g of rhizosphere soil was collected from each plant. The resealable bag was labeled with the name of the collection location, latitude and longitude, soil characteristics, plant name, and sampling time. After the samples were collected, the sampling bags were placed in an icebox and transported back to the laboratory as soon as possible for temporary storage at -20℃. The rhizosphere microbial isolation experiment was completed within 3-5 days.

[0025] (2) Isolation. Salt-tolerant bacterial strains were isolated from the collected soil samples using the dilution plating method. The soil suspension was diluted to 10... -2 10 -3 10 -4 and 10 -5 For each isogradient, 100 μL of LB medium was pipetted evenly onto plates, sealed with sealing film, numbered, labeled, and dated. The plates were then incubated upside down at 28°C for 24-48 hours. Each concentration was repeated three times. Colonies with different morphologies were selected and promptly transferred to LB medium for streaking again until single colonies were isolated and labeled. The isolated colonies were purified twice. The selected single colonies were then transferred to LB medium containing 10% NaCl and at pH 9 and streaked again. The plates were incubated upside down at 28°C for 48-72 hours to screen for salt-tolerant strains, named XJ3-14. The strains were temporarily stored at 4°C on slant agar or at -80°C to prevent loss of activity.

[0026] (3) Morphological identification. The salt-tolerant strain XJ3-14, selected and activated on LB solid medium, was incubated in a 28℃ biochemical incubator for 2 days. Basic morphological characteristics such as colony morphology, size, color, texture viscosity, gloss, transparency, and edge smoothness were observed and recorded by photograph. (Photos are shown below.) Figure 1As shown, under 28℃ incubation conditions, colonies grow rapidly on LB agar plates, forming round, raised colonies with neat edges. They range in color from light yellow to orange-yellow. The surface is smooth, moist, and glossy. After 48 hours of incubation on LB agar, the colonies are approximately 1-2 mm in diameter.

[0027] (4) Molecular identification: Single colonies of the strain were picked and placed in 1 mL of sterile water. Bacterial DNA was extracted by boiling lysis method, i.e., lysis at 100℃ for 10 min to obtain bacterial DNA. The strain was amplified by PCR using primers 27F (sequence shown in SEQ ID NO.1) and 1492R (sequence shown in SEQ ID NO.2).

[0028] A 50 μL PCR reaction system was used, and the amounts of each component were as per the instructions attached to the Taq enzyme package: 4 μL template (genomic DNA), 2 μL each of primers (27F and 1492R), 17 μL ddH2O, and 25 μL MIX (2×Taq plus Master Mix).

[0029] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min.

[0030] The PCR product was sent to the company for sequencing, and the 16S rDNA sequence of strain XJ3-14 was obtained, as shown in SEQ ID NO.3.

[0031] SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG SEQ ID NO.2: GGTTACCTTGTTACGACTT SEQ ID NO.3: The 16S rDNA sequence of strain XJ3-14 was subjected to multiple alignment in the NCBI database, and a phylogenetic tree was constructed using MEGA-X software (e.g., Figure 2 Homology comparison was performed on strain XJ3-14 (as shown in the image), and the results showed that the gene sequence of strain XJ3-14 was similar to that of strain XJ3-14. Rossellomorea marisflavi PP257582.1:1-1462 are in the same branch and adjacent to each other, therefore strain XJ3-14 is identified as... Rossellomorea marisflavi Bacteria, named Rossellomorea marisflavi For convenience, strain XJ3-14 will be referred to as strain XJ3-14 below.

[0032] Strain XJ3-14 was deposited on April 3, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 2025698.

[0033] Example 2 The salt and alkali tolerance and growth-promoting properties of strain XJ3-14 were tested, as detailed below: (1) Salt and alkali resistance test.

[0034] Single colonies of the isolated strain XJ3-14 were transferred to LB medium containing 10% NaCl and pH=9 (adjusted with 1% NaOH) and streaked again. The culture was then incubated upside down at 28℃ for 48-72 hours. Strains that grew well on these plates were preliminarily considered salt-tolerant strains. Further labeling of the salt-tolerant strains and determination of their salt tolerance thresholds were performed. The preliminarily screened salt-tolerant strains were inoculated into LB medium containing 12%, 14%, and 16% NaCl, as well as LB medium at pH=9, 10, 11, and 12, and incubated upside down at 28℃ for 48-72 hours. The presence or absence of colonies was used to determine their salt tolerance.

[0035] Test results as follows Figure 3 As shown. The results showed that strain XJ3-14 could grow well on LB medium containing 10% NaCl and pH=9. Figure 3 (Part a) The strain XJ3-14 was inoculated onto LB medium at pH=12, and the results showed that strain XJ3-14 could grow well on LB medium at pH=12. Figure 3 (Part b); strain XJ3-14 was inoculated onto LB medium containing 16% NaCl, and the results showed that strain XJ3-14 could grow well on LB medium containing 16% NaCl (part b). Figure 3 (Part C).

[0036] (2) Determine the alkali reduction rate of strain XJ3-14.

[0037] The target salt-tolerant strain was activated to the logarithmic growth phase in LB medium, centrifuged, washed, and resuspended in sterile physiological saline to prepare OD. 600 A bacterial suspension with a pH of approximately 0.8 was used. A specific liquid LB medium simulating a saline-alkaline environment (containing 10% NaCl, pH=9) was initially adjusted to pH 9.0. 1 mL of the bacterial suspension was added as the treatment group, while 1 mL of sterile water was added to the control group. The mixture was incubated at 28°C and 180 rpm for 24 h in a constant-temperature shaker, and the pH was measured afterward. The sample was centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The pH value of the supernatant was measured using a precisely calibrated pH meter and recorded.

[0038] Using the pH value of the blank control group as a benchmark, the relative alkalinity reduction rate of the treatment group was calculated using the following formula I to quantify the efficiency of the strain in reducing environmental alkalinity. The results are shown in Table 1. The alkalinity reduction rate of strain XJ3-14 was 19.33%.

[0039] Alkalinity reduction rate (%) = [(control group pH - treatment group pH) / control group pH] × 100 (Formula I).

[0040] Table 1 pH values ​​of the supernatant

[0041] (3) Detection of the growth-promoting characteristics of strain XJ3-14. This includes the detection of nitrogen fixation capacity, inorganic phosphorus solubility, organic phosphorus solubility, potassium solubilization, protease production, cellulase production, siderophore production, and IAA production capacity. The specific methods are as follows: Nitrogen fixation capacity: Strain XJ3-14 was inoculated into Assumption medium and cultured at 28°C for 7 days. The presence or absence of bacteria on the medium was observed.

[0042] Phosphorus solubility: Strain XJ3-14 was inoculated onto solid organic phosphorus-solubilizing bacteria culture medium and inorganic phosphorus-solubilizing bacteria culture medium plates, respectively, and cultured at 28°C for 7 days. The presence or absence of transparent phosphorus-solubilizing zones on the culture medium was observed.

[0043] Iron-producing vector: The strain XJ3-14 was inoculated onto a chromaine CAS detection medium plate and cultured at 28°C for 7 days. The presence or absence of a yellow-green halo was then observed.

[0044] Protease production capacity: The strain XJ3-14 was inoculated onto skim milk agar plates and cultured at 28°C for 3 days. The presence or absence of a clear zone was then observed.

[0045] Cellulase production capacity: Strain XJ3-14 was inoculated onto sodium carboxycellulose medium plates and cultured at 28°C for 3 days. After staining with 1 mg / mL Congo red solution for 30 min, the staining solution was discarded, and the sample was washed with 1 mol / L sodium chloride for 30 min. The presence or absence of a clear zone was observed.

[0046] IAA detection: 1 mL of XJ3-14 bacterial culture in the logarithmic growth phase was inoculated into LB liquid medium containing L-tryptophan and cultured at 28℃ and 200 r / min for 24 h. 100 μL of bacterial culture was then dropped onto a white ceramic plate, and the same volume of Salkowski colorimetric reagent was added and mixed well. The mixture was allowed to react in the dark at room temperature for 30 min. If the color turned red, it indicated that the strain had the ability to produce IAA; otherwise, it did not.

[0047] Potassium solubilization capacity: Strain XJ3-14 was inoculated into a silicate bacteria culture medium and cultured at 28°C for 7 days. The presence or absence of an oily liquid in the culture medium was then observed.

[0048] The results are as follows Figure 4 As shown in Table 2, strain XJ3-14 has the ability to promote growth by fixing nitrogen, solubilizing potassium, dissolving organic phosphorus, dissolving inorganic phosphorus, producing protease, and producing cellulase.

[0049] Table 2. Results of growth-promoting characteristics detection for strain XJ3-14

[0050] Note: "+" sign indicates that the ability exists, and "-" sign indicates that the ability does not exist.

[0051] Example 3 Using cucumber seedlings as experimental material, the growth-promoting effect of strain XJ3-14 was tested, as follows: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1 The temperature was 25±1℃ / 18±1℃ (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60-80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm, at a depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with half a dose of Hoagland's nutrient solution. For cucumber seedlings at the one-leaf-one-heart stage with uniform growth, four holes, each about 2cm deep, were made around the base of the seedling stem. A suspension of strain XJ3-14 (OD2000) was then placed inside the holes. 600 ≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL, and inoculate 12 seedlings per treatment, repeating 3 times. The control group (CK) is inoculated with only an equal volume of water. Inoculate again after 7 days. On day 7 after the second inoculation, measure and record the cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, and underground dry weight. Calculate the seedling vigor index using Formula II below.

[0052] Strong seedling index = (stem diameter / plant height + root dry weight / aboveground dry weight) × total plant dry weight (Formula II).

[0053] The results are as follows Figure 5 As shown in Table 3, inoculation with strain XJ3-14 significantly promoted cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, underground dry weight, and seedling vigor index, increasing by 77.07%, 23.19%, 38.88%, 36.30%, 27.40%, 19.93%, 50.00%, and 9.30%, respectively, compared to the control.

[0054] Table 3. Growth-promoting effect of strain XJ3-14 on cucumber seedlings

[0055] Example 4 Using cucumber seedlings as experimental material, the effect of strain XJ3-14 on alleviating salt-alkali stress in cucumbers was tested, as follows: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1 The temperature was 25±1℃ / 18±1℃ (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60-80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm at a depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with 1 / 2 Hoagland nutrient solution. For cucumber seedlings with uniform growth at the one-leaf-one-heart stage, four holes about 2cm deep were made around the base of the seedling stem. A suspension of strain ASR-60 (OD) was then placed in the holes. 600 ≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL of solution. Each treatment has 12 seedlings, and the treatment is repeated 3 times. The control (CK) is inoculated with only an equal volume of water. A second inoculation is performed 7 days later. On the 3rd day after the second inoculation, a solution of 75 mmol·L⁻¹ NaCl:Na₂SO₄:Na₂CO₃:NaHCO₃ in a molar ratio of 1:9:1:9 is prepared. -1 A compound saline-alkali solution (pH=8.9±0.1) was used. 40 mL of the compound saline-alkali solution was applied to each pot, and treatment was repeated every 2 days. Based on previous laboratory research, after 5 days of treatment, the fresh weight of the whole cucumber seedling, proline, and malondialdehyde content were measured and recorded. The salt damage index was calculated using formula VIII below.

[0056] Salt damage grading standards: Grade 0, no salt damage characteristics; Grade 1, true leaves intact, leaf edges yellowed; Grade 2, 25% of true leaves are wilted and yellowed; Grade 3, 50% of the true leaves are wilted and yellowed; Grade 4, 75% of true leaves are wilted and yellowed; Level 5, all leaves are wilting due to water loss.

[0057] (VIII).

[0058] The results are as follows Figure 7 As shown in Table 12, inoculation with strain XJ3-14 significantly promoted the fresh weight of cucumber seedlings under salt-alkali stress, increasing it by 31.18% compared to the control group. It also reduced the proline, malondialdehyde (MDA) content, and salt damage index in cucumber roots, decreasing them by 50.00%, 37.50%, and 45.62% respectively compared to the control.

[0059] Table 4. Alleviating effect of strain ASR-60 on cucumber seedlings under salt-alkali stress.

[0060] Example 5 The effects of strain XJ3-14 on the growth and yield of mature cucumbers under salt-alkali stress were investigated, as follows: After soaking and germination, cucumber seeds with uniform germination were selected and sown into 72-cell seed trays. The trays were then placed in an artificial climate chamber for seedling cultivation under the following conditions: light intensity of 360 µmol·photons·m -2 ·s -1 The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60-80%. When the seedlings reached the stage of one leaf and one bud, each tray was watered with 1L of half-filled Hoagland nutrient solution, changed every two days. When the seedlings reached the two-leaf and one-bud stage, four holes about 2cm deep were made around the base of the seedling stem. A suspension of strain XJ3-14 (OD2000) was then placed inside. 600 ≈0.8) Pour evenly into the holes, and irrigate the roots of each cucumber seedling with 10 mL. The CK group is inoculated with only the same amount of water.

[0061] When the cucumber seedlings reached the three-leaf stage, they were transplanted into a plastic greenhouse in Yangling, Shaanxi Province, using a trough-type substrate cultivation system and an integrated drip irrigation system for water and fertilizer management. The experimental plot area was 18.6 m². 2 The plants measured 6m x 3.1m in length and width, with a plant spacing of 20cm x 90cm, arranged in a randomized block design. Each treatment had 25 plants, with three replicates. Ten days after transplanting, a suspension of strain XJ3-14 (OD2000) was applied. 600(≈0.8) Irrigate the roots with 10 mL of water around the base of the stem, and irrigate each plant in the CK group with 10 mL of water. Irrigate the roots once every 10 days until the end of the cucumber's peak fruiting period.

[0062] After the cucumber plant's root fruit flowers, apply 150 mmol·L⁻¹ -1 Salt-alkali stress treatment was carried out using a compound salt-alkali solution (NaCl∶Na2SO4∶Na2CO3∶NaHCO3 molar ratio of 1∶9∶1∶9, pH=8.9±0.1). Each treatment was applied at 500 mL / plant, and the treatment was repeated every 5 days until the cucumber harvest was completed.

[0063] (1) To investigate the effect of strain XJ3-14 on cucumber growth under salt and alkali stress.

[0064] Nine uniformly growing cucumber plants were selected for each treatment and tagged. Stem diameter was measured using calipers at the vine-growing stage, early fruiting stage, and peak fruiting stage. Plant height, leaf length, and leaf width were measured with a tape measure, and leaf area was calculated. The dry and fresh weights of the roots, stems, and leaves were determined, with three replicates for each indicator. The measurement methods followed the cucumber germplasm resource description specifications and data standards formulated by Li Xixiang et al., such as... Figure 6 As shown.

[0065] Table 5 shows the statistical results of cucumber plant height, stem diameter, and leaf area at different stages. Inoculation with strain XJ3-14 significantly promoted the growth of cucumber plant height, stem diameter, and leaf area at different stages. During the vine-growing stage, plant height, stem diameter, and leaf area increased by 91.44%, 55.88%, and 120.32%, respectively; during the early fruiting stage, plant height, stem diameter, and leaf area increased by 79.19%, 35.31%, and 68.70%, respectively; and during the peak fruiting stage, plant height, stem diameter, and leaf area increased by 39.26%, 27.72%, and 39.12%, respectively.

[0066] Table 5. Effects of strain XJ3-14 on cucumber growth under salt-alkali stress.

[0067] Table 6 shows the statistical results of the fresh weight of cucumber roots, stems and leaves at different stages. Inoculation with strain XJ3-14 significantly promoted the fresh weight of cucumber roots, stems and leaves at different stages. During the vine-growing stage, the fresh weight of roots, stems and leaves increased by 143.19%, 183.75% and 139.87%, respectively; during the early fruiting stage, the fresh weight of roots, stems and leaves increased by 161.68%, 143.06% and 169.12%, respectively; and during the peak fruiting stage, the fresh weight of roots, stems and leaves increased by 304.01%, 122.86% and 133.38%, respectively.

[0068] Table 6. Effects of strain XJ3-14 on the fresh weight of cucumber plants under salt-alkali stress.

[0069] Table 7 shows the statistical results of root, stem, and leaf dry weight of cucumber at different stages under salt stress. Inoculation with strain XJ3-14 significantly promoted the dry weight of root, stem, and leaf of cucumber plants at different stages. During the vine-growing stage, the dry weight of root, stem, and leaf increased by 127.27%, 175.47%, and 98.54%, respectively; during the early fruiting stage, the dry weight of root, stem, and leaf increased by 240.00%, 164.88%, and 144.98%, respectively; and during the peak fruiting stage, the dry weight of root, stem, and leaf increased by 227.50%, 177.44%, and 169.27%, respectively.

[0070] Table 7. Effects of strain XJ3-14 on the dry weight of cucumber plants under salt-alkali stress.

[0071] (2) Investigate the effect of strain XJ3-14 on the photosynthetic pigments of cucumber under salt and alkali stress.

[0072] Select the fifth fully unfolded functional leaf (counting downwards from the growing point) from a healthy plant in its peak fruiting period, chop it, mix it thoroughly, weigh 0.2g, and place it in a 50mL centrifuge tube. Add 20mL of extraction solution (alcohol:acetone:water volume ratio of 4.5:4.5:1) to the tube and extract in the dark for 24 hours until the leaf tissue turns white. Use a WFZ UV-3802H UV-Vis spectrophotometer to measure the OD values ​​at wavelengths of 663nm, 645nm, and 440nm, respectively. Calculate the chlorophyll content in cucumber leaves using formulas III-VII. The results are shown in Table 8. Inoculation with strain XJ3-14 significantly promoted the increase of chlorophyll a, chlorophyll b, and carotenoids in cucumber plants, increasing by 32.23%, 38.40%, and 20.32%, respectively.

[0073] Chla (mg / g) = 12.7 OD 663 -2.69OD 645 (Formula III); Chlb (mg / g) = 22.9 OD 645 -4.68OD 663 (Formula IV); ChlT(a+b)(mg / g)=8.02OD 663 +20.2OD 645 (Formula V); Car (mg / g) = 4.7 OD 440 -0.27(Chla+Chlb)(Formula VI); Chl(Car) (mg / g) = Extraction liquid volume (mL) / mass (g) / 1000 (Equation VII).

[0074] Table 8. Effects of strain XJ3-14 on photosynthetic pigments in cucumber plants under salt-alkali stress.

[0075] (3) Investigate the effect of strain XJ3-14 on the photosynthetic parameters of cucumber under salt and alkali stress.

[0076] On the 80th day after transplanting (the day and the two preceding days were sunny), from 08:00 to 18:00, photosynthetic efficiency was measured using a Li-6400 photosynthesis system equipped with a transparent leaf chamber. Measurements were taken every 2 hours, with 9 plants selected for each treatment. The measured parameters included photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), and intercellular carbon dioxide concentration (Ci). Light, CO2 concentration, and temperature in the greenhouse were set to natural environmental conditions. The results are shown in Table 9. Inoculation with strain XJ3-14 significantly promoted the increase in transpiration rate, net photosynthetic rate, intercellular CO2 concentration, and stomatal conductance of cucumber plants, increasing them by 110.53%, 68.11%, 25.53%, and 131.65%, respectively.

[0077] Table 9. Effects of strain XJ3-14 on photosynthetic parameters of cucumber plants under salt-alkali stress.

[0078] (4) Investigate the effect of strain XJ3-14 on cucumber roots under salt and alkali stress.

[0079] Roots were collected from healthy, vigorous cucumber plants during their peak fruiting period. For each treatment, 0.5 g of the mid-root section was weighed and added to 10 mL of extract to fully submerge the roots. After incubation in a 37℃ water bath for 1 hour, 1 mol·L⁻¹ extract was added. -1 The reaction was stopped with 2 mL of sulfuric acid. The roots were then removed, dried, and ground with 10 mL of ethyl acetate and a small amount of quartz sand. The mixture was shaken well, filtered, and the filtrate was colorimetrically measured at 485 nm to determine root activity. Root morphology of cucumber plants was determined using a root sweeping instrument. The results are shown in Table 10. Inoculation with strain XJ3-14 significantly promoted the increase of total root length, root surface area, root volume, number of root tips, and root activity in cucumber plants, increasing by 58.75%, 36.17%, 41.40%, 55.86%, and 127.37%, respectively.

[0080] Table 10 Effects of strain XJ3-14 on the root system of cucumber plants under salt-alkali stress

[0081] (5) Investigate the effects of strain XJ3-14 on the weight and yield of cucumbers under salt and alkali stress.

[0082] Nine cucumber plants of uniform growth and in their peak fruiting stage were selected for each treatment. They were tagged on the day of flowering (counting from the base upwards) at the 14th node. Nine days later, three uniformly growing cucumbers from each treatment were selected, and their individual cucumber weights were measured. Each commercially mature cucumber from the 15th node until the vine was pulled from the ground was harvested, and the corresponding individual cucumber weight per plant for each treatment was measured. Yield was measured using an electronic balance with an accuracy of 0.01 g. Cucumber yield per plant is the cumulative yield of all plants in each treatment group. Results are as follows: Figure 6 As shown in Table 11, inoculation with strain XJ3-14 promoted an increase in cucumber diameter, single cucumber weight, and yield per plant, by 6.76%, 15.01%, and 82.57%, respectively.

[0083] Table 11 Effects of strain XJ3-14 on cucumber yield under salt-alkali stress

[0084] (6) Investigate the effects of strain XJ3-14 on the nutritional quality of cucumber under salt and alkali stress.

[0085] During the peak fruiting period, female flowers around the 14th node that opened on the same day were tagged and harvested on the morning of the 9th day after tagging. The harvested cucumbers were placed in ice boxes and quickly transported back to the laboratory. For each material, three straight, undamaged, commercially ripe cucumbers were selected, and three sections (2-3 cm each) were cut from the head, middle, and tail. After being flash-frozen in liquid nitrogen and ground, they were stored at -80℃ for ultra-low temperature testing. These were used for quality index determination. Vitamin C content was determined by LC-MS; soluble protein content was determined by the Coomassie Brilliant Blue G520 method; and soluble sugar content was determined by the anthrone colorimetric method. The results are shown in Table 12. Inoculation with strain XJ3-14 promoted an increase in vitamin C, soluble protein, and soluble sugar in cucumbers, increasing them by 62.88%, 1.03%, and 24.66%, respectively.

[0086] Table 12 Effects of strain XJ3-14 on the nutritional quality of cucumber under salt-alkali stress

[0087] Example 6 Using tomato seedlings as experimental material, the growth-promoting effect of strain XJ3-14 was tested, as follows: Tomato seeds, after disinfection, soaking, and germination, were sown in flowerpots containing autoclaved substrate at a depth of 0.5-1 cm, under the same cultivation conditions as in Example 3. When the tomato seedlings had three leaves and a central bud, uniformly growing seedlings were selected. Four holes, each about 2 cm deep, were made about 2 cm from the base of the seedling stem, and the roots were drenched with the prepared XJ3-14 bacterial suspension. Each treatment was inoculated with 50 seedlings, and the treatment was repeated three times. The control group (CK) was inoculated with an equal amount of water, followed by a second inoculation with the bacterial suspension 7 days later. Seven days after the second inoculation, 30 uniformly growing plants were randomly selected from each treatment, and the seedling height, stem diameter, total dry weight, and total fresh weight were measured.

[0088] The results are as follows Figure 8 As shown in Table 13, inoculation with strain XJ3-14 significantly promoted the height, stem diameter, fresh weight, and dry weight of tomato seedlings, increasing them by 35.8%, 29.56%, 64.49%, and 120% respectively compared to the control.

[0089] Table 13. Growth-promoting effect of strain XJ3-14 on tomato seedlings.

[0090] Therefore, the present invention provides Rossellomorea marisflavi The XJ3-14 strain was isolated for the first time and deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC M 2025698. It exhibits good salt and alkali tolerance and can grow well on LB medium containing 16% NaCl or pH 12. It also has the ability to reduce alkali, fix nitrogen, solubilize potassium, dissolve organic phosphorus, dissolve inorganic phosphorus, produce protease and cellulase. Under normal conditions and salt and alkali stress conditions, it can significantly promote the photosynthetic capacity of cucumber plants, the growth of above-ground and underground parts, increase cucumber yield, and improve cucumber quality.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A plant Rossellomorea marisflavi Strain XJ3-14 was deposited on April 3, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 2025698.

2. A plant according to claim 1 Rossellomorea marisflavi strain XJ3-14, characterized by: The Rossellomorea marisflavi The 16S rDNA sequence of strain XJ3-14 is shown in SEQ ID NO.

3.

3. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in the preparation of saline-alkali land improvement products is characterized by: Add the aforementioned to the product Rossellomorea marisflavi XJ3-14 strain, the product is used to reduce soil salinity.

4. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in fertilizer preparation is characterized by: The fertilizer contains the aforementioned Rossellomorea marisflavi XJ3-14 strain; the fertilizer has at least one effect of promoting the growth of aboveground and / or underground parts of plants and photosynthetic capacity; the fertilizer includes foliar fertilizer.

5. A plant according to claim 4 Rossellomorea marisflavi The application of strain XJ3-14 in fertilizer preparation is characterized by: The fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content, absorbable potassium content and absorbable iron content by at least one.

6. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in the preparation of agents that promote the decomposition of organic matter is characterized by: The formulation is a preparation that promotes the decomposition of animal and plant residues, and the formulation contains the aforementioned... Rossellomorea marisflavi strain XJ3-14.

7. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in the preparation of bactericidal agents is characterized by: The bactericidal agent contains the aforementioned Rossellomorea marisflavi strain XJ3-14.

8. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in the preparation of vegetable quality improvement agents is characterized by: The formulation contains the aforementioned Rossellomorea marisflavi XJ3-14 strain; the preparation has the effect of promoting at least one of the following: increasing the content of vitamin C, soluble protein and soluble sugar.

9. A plant as described in claim 1 or 2 Rossellomorea marisflavi The application of strain XJ3-14 in the preparation of a specific formulation for salt-stressed plants is characterized by: The formulation contains the aforementioned Rossellomorea marisflavi XJ3-14 strain; the preparation is used to promote crop growth and development under salt stress conditions.

Images