Recombinant strain for producing inositol and preparation method and application thereof

Abstract

The application discloses a recombinant strain for producing myo-inositol and a preparation method and application thereof, and belongs to the technical field of genetic engineering. The recombinant strain does not express myo-inositol dehydrogenase, expresses a myo-inositol monophosphatase mutant, and overexpresses myo-inositol-1-phosphate synthase; the amino acid sequence of the myo-inositol monophosphatase mutant is shown as SEQ ID NO. 1. The catalytic efficiency of the myo-inositol monophosphatase mutant obtained after mutation is further improved, the ability of the recombinant strain to synthesize myo-inositol is effectively enhanced, meanwhile, the recombinant strain does not express myo-inositol dehydrogenase and overexpresses myo-inositol-1-phosphate synthase, so that the recombinant strain can efficiently synthesize myo-inositol.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a recombinant strain for producing inositol, its preparation method, and its applications. Background Technology

[0002] Myo-inositol, also known as cyclohexanehexol, is a water-soluble vitamin-like substance widely found in animals and plants, and has important applications in medicine, food, feed, and cosmetics. Currently, the main methods for producing myo-inositol include phytic acid hydrolysis, chemical synthesis, and biosynthesis. These traditional methods suffer from problems such as cumbersome operation steps, high production costs, and serious environmental pollution.

[0003] The aforementioned problems can be avoided by using genetically engineered microbial fermentation to produce inositol. However, the inositol yield during microbial fermentation is low, and it overlooks the fact that in addition to accumulating the target product inositol, the microbial metabolism during fermentation also produces a variety of organic acids (such as lactic acid, acetic acid, succinic acid, citric acid, etc.). These metabolites are bioactive substances required for plant growth and can be used as functional components in agriculture.

[0004] The long-term excessive use of chemical fertilizers in agricultural production has led to increasingly prominent problems such as soil compaction, decline in organic matter, and imbalance of the micro-ecosystem. Developing new environmentally friendly fertilizers that can simultaneously promote crop growth, improve quality, and improve soil has become an urgent need for sustainable agricultural development. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a recombinant strain for producing inositol, its preparation method and application, to overcome the problems of insufficient yield of inositol produced by microbial fermentation and the inability to fully utilize the organic acids in the fermentation products in the prior art.

[0006] In a first aspect, the present invention provides a recombinant strain for producing inositol, wherein the recombinant strain does not express inositol dehydrogenase, expresses an inositol monophosphatase mutant, and overexpresses inositol-1-phosphosynthase. The amino acid sequence of the inositol monophosphatase mutant is shown in SEQ ID NO.1.

[0007] Compared with the prior art, the catalytic efficiency of the inositol monophosphatase mutant obtained by the present invention is further improved, which effectively enhances the ability of the recombinant strain to synthesize inositol. At the same time, the recombinant strain does not express inositol dehydrogenase and overexpresses inositol-1-phosphate synthase, which enables the recombinant strain to synthesize inositol efficiently.

[0008] Furthermore, the host strain of the recombinant strain is Corynebacterium glutamicum.

[0009] Furthermore, the nucleotide sequence of the inositol monophosphatase mutant gene is shown in SEQ ID NO.2.

[0010] Secondly, the present invention provides a method for preparing a recombinant strain for producing inositol, comprising the following steps: Knock out the inositol dehydrogenase gene in the host strain, wherein the inositol dehydrogenase gene includes iolG, oxiB, oxiD and oxiE; The inositol monophosphatase gene in the host strain was mutated by changing the 87th amino acid of the protein encoded by the inositol monophosphatase gene from I to K. The expression vector containing the inositol-1-phosphate synthase gene ino1 was transferred into the host strain.

[0011] Furthermore, the nucleotide sequence of iolG is shown in SEQ ID NO.3; The nucleotide sequence of oxiB is shown in SEQ ID NO.4; The nucleotide sequence of oxiD is shown in SEQ ID NO.5; The nucleotide sequence of oxiE is shown in SEQ ID NO.6; The nucleotide sequence of the inositol-1-phosphate synthase gene ino1 is shown in SEQ ID NO.7.

[0012] Thirdly, the present invention provides the application of the above-mentioned recombinant strain in the preparation of inositol, organic acids or fertilizers.

[0013] Fourthly, the present invention provides a method for fermenting and producing inositol and organic acids, using the above-mentioned recombinant strain to ferment and produce inositol and organic acids, comprising the following steps: The above recombinant strain was subjected to seed culture to obtain seed solution; The seed culture was inoculated into the fermentation medium for fermentation culture. Under the condition of DO≥30%, the glucose concentration in the fermentation broth was consumed to 30g / L~40g / L. Then, the DO value was reduced to 5%~10%, and an inducer was added to induce the recombinant strain to express the inositol-1-phosphate synthase gene ino1, and synthesize inositol and organic acids at the same time. When the glucose concentration in the fermentation broth is ≤20 g / L, add glucose solution to maintain the glucose concentration in the fermentation broth at 10 g / L~30 g / L. After fermentation for 70-75 hours, a fermentation broth containing both inositol and organic acids is obtained.

[0014] Compared with existing technologies, this invention employs a two-stage dissolved oxygen control method during the fermentation of recombinant strains. In the first stage, by increasing the stirring speed and aeration rate, the dissolved oxygen level is maintained at a high level of ≥30%, ensuring rapid cell growth and sufficient biomass accumulation. In the second stage, by decreasing the stirring speed and aeration rate, the dissolved oxygen level is maintained at a lower level of 5%~10%. Under these conditions, the tricarboxylic acid cycle oxidation capacity of the strain is limited, resulting in the extracellular release of organic acid intermediate metabolites such as pyruvate and citric acid. Furthermore, an inducer is added in the second stage to induce the expression of the inositol-1-phosphate synthase gene ino1 in the recombinant strain, further enhancing the inositol synthesis capacity of the recombinant strain. The recombinant strain continuously synthesizes inositol and secretes it into the culture medium. This invention, through a metabolic flux rebalancing strategy, allows the recombinant strain to controllably release some carbon sources in the form of organic acids while ensuring high inositol production. This achieves the synergistic accumulation of inositol and organic acids, further improving carbon source utilization, and eliminating the need for additional precursors, thus reducing production costs.

[0015] Furthermore, the seed culture temperature is 30℃~40℃.

[0016] Furthermore, the fermentation culture temperature is 30℃~40℃.

[0017] Furthermore, 6 to 9 grams of pure glucose are added per hour per liter of fermentation broth.

[0018] Furthermore, the organic acid includes at least one of pyruvic acid, citric acid, α-ketoglutarate, and succinic acid.

[0019] Fifthly, the present invention provides a method for preparing a fertilizer, the fertilizer comprising microbial protein powder and liquid fertilizer, comprising the following steps: The fermentation broth prepared by the above method was inactivated at high temperature and filtered to obtain bacterial cells and filtrate. The bacterial cells are dried and pulverized to obtain bacterial protein powder; The filtrate is concentrated to a solid content of 10wt%~20wt% to obtain liquid fertilizer.

[0020] Compared with existing technologies, this invention directly prepares liquid fertilizer from fermentation broth through simple treatment, and converts the microbial cells into protein powder, achieving full utilization of all components, with no waste liquid discharge, making it green and environmentally friendly. In planting, the microbial protein powder and liquid fertilizer, combined with conventional fertilizers, can effectively promote the accumulation of dry matter in plants and further increase the organic matter content of the soil, thus having the dual effects of promoting growth and improving soil. Attached Figure Description

[0021] Figure 1 The growth status and inositol content of the strain in Example 5 are shown.

[0022] Figure 2This refers to the accumulation of organic acids in the fermentation broth under different dissolved oxygen conditions in Example 9.

[0023] Figure 3 The dry matter accumulation of tomatoes in Example 11.

[0024] Figure 4 The organic matter content of the soil in Example 11. Detailed Implementation

[0025] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0026] In the following examples of the present invention, the composition of the LBHIS culture medium is as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 10 g / L brain heart extract powder, and 90 g / L sorbitol.

[0027] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.

[0028] Example 1: Knockout of the inositol dehydrogenase gene iolG Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the upstream homologous arm iolG-U was amplified by PCR using the upstream primer iolG-U-UL (SEQ ID NO.8) and the downstream primer iolG-U-UR (SEQ ID NO.9). Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the downstream homologous arm iolG-D was amplified by PCR using the upstream primer iolG-D-DL (SEQ ID NO.10) and the downstream primer iolG-D-DR (SEQ ID NO.11).

[0029] The two PCR reaction systems were as follows: 5×PCR buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream primer (10 μM): 1.5 μL; downstream primer (10 μM): 1.5 μL; template: 1 μL; DNA polymerase: 0.5 μL; ddH2O: bring to 50 μL.

[0030] The two PCR reaction programs are as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 55℃ annealing: 30 s; 72℃ extension: 15 s; denaturation, annealing, and extension cycles: 30 cycles; 72℃ final extension: 10 min; 4℃ incubation.

[0031] The upstream homologous arm iolG-U and the downstream homologous arm iolG-D obtained by the above PCR amplification were spliced ​​together by overlap extension PCR to obtain the fusion fragment iolG-U-iolG-D.

[0032] The reaction system for the first stage of overlap extension PCR was as follows: 5× high-fidelity enzyme buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream homologous arm iol G-U: 4 μL; downstream homologous arm iol G-D: 4 μL; high-fidelity DNA polymerase: 1 μL; ddH2O: to a final volume of 50 μL.

[0033] The reaction program for the first stage of overlap extension PCR was as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 60℃ annealing: 30 s; 72℃ extension: 1 min; number of denaturation, annealing and extension cycles: 15 cycles.

[0034] After the first stage procedure is completed, 2 μL of upstream primer iolG-U-UL and 2 μL of downstream primer iolG-D-DR are added to the reaction system to perform the second stage of specific amplification.

[0035] The reaction procedure for the second stage is as follows: denaturation at 95℃ for 30 seconds; annealing at 60℃ for 30 seconds; extension at 72℃ for 1 minute; number of denaturation, annealing, and extension cycles: 30 cycles; final extension at 72℃ for 10 minutes; and holding at 4℃.

[0036] The expression vector pK18mobsacB was digested with the restriction endonuclease SalI at 37°C for 2 hours to obtain the linearized vector pK18mobsacB.

[0037] The linearized vector pK18mobsacB was ligated to the aforementioned fusion fragment iolG-U-iolG-D to obtain the ligation product. The ligation system consisted of 1 μL of the linearized vector pK18mobsacB, 2 μL of the fusion fragment iolG-U-iolG-D, 5 μL of the one-step cloning enzyme (Exnase recombinase), and 2 μL of ddH2O.

[0038] The above ligation product was transformed into E. coli JM109 competent cells, plated on LB agar plates (containing 50 μg / mL kanamycin), and cultured at 37°C for 12 h. Single colonies were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C with shaking for 8 h. The plasmid was extracted and sent for testing, and it was confirmed that there was no mutation in the homologous arm, and the correct plasmid pK18-ΔiolG was obtained.

[0039] In *Corynebacterium glutamicum* ATCC13032 competent cells, the plasmid pK18-ΔiolG was added, gently mixed, and incubated on ice for 30 min. The cells were then transferred to a pre-cooled (0℃) electroporation cuvette with a 2 mm gap for electroporation. The voltage, resistance, and capacitance were 2.5 kV and 600 Ω, respectively. Immediately after electroporation, 900 μL of pre-cooled (0℃) LBHIS medium was added, and the mixture was thoroughly mixed. The cells were then incubated at 30℃ and 200 rpm for 2.5 h. 200 μL of the bacterial culture was then spread onto LBHIS plates (containing 50 μg / mL kanamycin) and incubated at 30℃ until a single colony grew. This single colony is the iolG single-exchange strain.

[0040] The above-mentioned iolG single-exchange strain was inoculated into antibiotic-free LHBIS liquid medium and cultured at 30℃ and 200 rpm for 12 h. The resulting bacterial culture was diluted 1:2000, and 100 μL of the diluted solution was spread onto LHBIS plates containing 100 g / L sucrose and cultured at 30℃ for 48 h. After the culture was completed, 20-30 single colonies were picked from the LHBIS plates containing 100 g / L sucrose and inoculated onto LHBIS plates and LHBIS plates containing 50 μg / mL kanamycin, respectively, and cultured at 30℃ for 24 h. The strain that grows only on LHBIS plates and does not grow at all on LHBIS plates containing 50 μg / mL kanamycin is the target strain ATCC13032-ΔiolG with the iolG gene knocked out.

[0041] Example 2: Knockout of the inositol dehydrogenase gene oxiB Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the upstream homologous arm oxiB-U was amplified by PCR using the upstream primer oxiB-U-UL (SEQ ID NO. 12) and the downstream primer oxiB-U-UR (SEQ ID NO. 13). Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the downstream homologous arm oxiB-D was amplified by PCR using the upstream primer oxiB-D-DL (SEQ ID NO. 14) and the downstream primer oxiB-D-DR (SEQ ID NO. 15).

[0042] The two PCR reaction systems were as follows: 5×PCR buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream primer (10 μM): 1.5 μL; downstream primer (10 μM): 1.5 μL; template: 1 μL; DNA polymerase: 0.5 μL; ddH2O: bring to 50 μL.

[0043] The two PCR reaction programs are as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 55℃ annealing: 30 s; 72℃ extension: 15 s; denaturation, annealing, and extension cycles: 30 cycles; 72℃ final extension: 10 min; 4℃ incubation.

[0044] The upstream homologous arm oxiB-U and the downstream homologous arm oxiB-D obtained by the above PCR amplification were spliced ​​together by overlap extension PCR to obtain the fusion fragment oxiB-U-oxiB-D.

[0045] The reaction system for the first stage of the above overlap extension PCR was as follows: 5× high-fidelity enzyme buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream homologous arm oxiB-U: 4 μL; downstream homologous arm oxiB-D: 4 μL; high-fidelity DNA polymerase: 1 μL; ddH2O: to a final volume of 50 μL.

[0046] The reaction procedure for the first stage of the above overlap extension PCR is as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 60℃ annealing: 30 s; 72℃ extension: 1 min; number of denaturation, annealing and extension cycles: 15 cycles.

[0047] After the first stage procedure is completed, 2 μL of upstream primer oxiB-U-UL and 2 μL of downstream primer oxiB-D-DR are added to the reaction system to perform the second stage of specific amplification.

[0048] The reaction procedure for the second stage is as follows: denaturation at 95℃ for 30 seconds; annealing at 60℃ for 30 seconds; extension at 72℃ for 1 minute; number of denaturation, annealing, and extension cycles: 30 cycles; final extension at 72℃ for 10 minutes; and holding at 4℃.

[0049] The expression vector pK18mobsacB was digested with the restriction endonuclease SalI at 37°C for 2 hours to obtain the linearized vector pK18mobsacB.

[0050] The linearized vector pK18mobsacB was ligated with the above-mentioned fusion fragment oxiB-U-oxiB-D to obtain the ligation product. The ligation system consisted of: 1 μL of linearized vector pK18mobsacB, 2 μL of fusion fragment oxiB-U-oxiB-D, 5 μL of one-step cloning enzyme (Exnase recombinase), and 2 μL of ddH2O.

[0051] The above ligation product was transformed into E. coli JM109 competent cells, plated on LB agar plates (containing 50 μg / mL kanamycin), and cultured at 37°C for 12 h. Single colonies were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C with shaking for 8 h. The plasmid was extracted and sent for testing, and it was confirmed that there was no mutation in the homologous arm, thus obtaining the correct plasmid pK18-ΔoxiB.

[0052] In *Corynebacterium glutamicum* ATCC13032-ΔiolG competent cells, the plasmid pK18-ΔoxiB was added, gently mixed, and incubated on ice for 30 min. The cells were then transferred to a pre-cooled (0℃) electroporation cuvette with a 2 mm gap for electroporation. The voltage, resistance, and capacitance were 2.5 kV, 600 Ω, and 25 μF, respectively. Immediately after electroporation, 900 μL of pre-cooled (0℃) LBHIS medium was added, and the cells were mixed by pipetting. The cells were then incubated at 30℃ and 200 rpm for 2.5 h. 200 μL of the bacterial culture was then spread onto LBHIS plates (containing 50 μg / mL kanamycin) and incubated at 30℃ until a single colony grew. This single colony is the oxiB single-exchange strain.

[0053] The above-mentioned oxiB single-exchange strain was inoculated into antibiotic-free LBHIS liquid medium and cultured at 30℃ and 200 rpm for 12 h. The resulting bacterial culture was diluted 1:2000, and 100 μL of the diluted solution was spread onto LBHIS plates containing 100 g / L sucrose and cultured at 30℃ for 48 h. After the culture was completed, 20-30 single colonies were picked from the LBHIS plates containing 100 g / L sucrose and inoculated onto LBHIS plates and LBHIS plates containing 50 μg / mL kanamycin, respectively, and cultured at 30℃ for 24 h. The strain that grows only on LBHIS plates and does not grow at all on LBHIS plates containing 50 μg / mL kanamycin is the target strain ATCC13032-ΔiolGΔ-oxiB with the oxiB gene knocked out.

[0054] Example 3: Knockout of the inositol dehydrogenase gene oxiD Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the upstream homologous arm oxiD-U was amplified by PCR using the upstream primer oxiD-U-UL (SEQ ID NO.16) and the downstream primer oxiD-U-UR (SEQ ID NO.17). Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the downstream homologous arm oxiD-D was amplified by PCR using the upstream primer oxiD-D-DL (SEQ ID NO.18) and the downstream primer oxiD-D-DR (SEQ ID NO.19).

[0055] The two PCR reaction systems were as follows: 5×PCR buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream primer (10 μM): 1.5 μL; downstream primer (10 μM): 1.5 μL; template: 1 μL; DNA polymerase: 0.5 μL; ddH2O: bring to 50 μL.

[0056] The two PCR reaction programs are as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 55℃ annealing: 30 s; 72℃ extension: 15 s; denaturation, annealing, and extension cycles: 30 cycles; 72℃ final extension: 10 min; 4℃ incubation.

[0057] The upstream homologous arm oxiD-U and the downstream homologous arm oxiD-D obtained by the above PCR amplification were spliced ​​together by overlap extension PCR to obtain the fusion fragment oxiD-U-oxiD-D.

[0058] The reaction system for the first stage of the above overlap extension PCR was as follows: 5× high-fidelity enzyme buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream homologous arm oxiD-U: 4 μL; downstream homologous arm oxiD-D: 4 μL; high-fidelity DNA polymerase: 1 μL; ddH2O: to a final volume of 50 μL.

[0059] The reaction program for the first stage of the above overlap extension PCR was as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 60℃ annealing: 30 s; 72℃ extension: 1 min; number of denaturation, annealing and extension cycles: 15 cycles.

[0060] After the first stage procedure is completed, 2 μL of upstream primer oxiD-U-UL and 2 μL of downstream primer oxiD-D-DR are added to the reaction system to perform the second stage of specific amplification.

[0061] The reaction procedure for the second stage is as follows: denaturation at 95℃ for 30 seconds; annealing at 60℃ for 30 seconds; extension at 72℃ for 1 minute; number of denaturation, annealing, and extension cycles: 30 cycles; final extension at 72℃ for 10 minutes; and holding at 4℃.

[0062] The expression vector pK18mobsacB was digested with the restriction endonuclease SalI at 37°C for 2 hours to obtain the linearized vector pK18mobsacB.

[0063] The linearized vector pK18mobsacB was ligated with the above-mentioned fusion fragment oxiD-U-oxiD-D to obtain the ligation product. The ligation system consisted of 1 μL of the linearized vector pK18mobsacB, 2 μL of the fusion fragment oxiD-U-oxiD-D, 5 μL of one-step cloning enzyme (Exnase recombinase), and 2 μL of ddH2O.

[0064] The above ligation product was transformed into E. coli JM109 competent cells, plated on LB agar plates (containing 50 μg / mL kanamycin), and cultured at 37°C for 12 h. Single colonies were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C with shaking for 8 h. The plasmid was extracted and sent for testing, and it was confirmed that there was no mutation in the homologous arm, thus obtaining the correct plasmid pK18-ΔoxiD.

[0065] In *Corynebacterium glutamicum* ATCC13032-ΔiolG-ΔoxiB competent cells, the plasmid pK18-ΔoxiD was added, gently mixed, and incubated on ice for 30 min. The mixture was then transferred to a pre-cooled (0℃) electroporation cuvette with a 2 mm gap for electroporation. The voltage, resistance, and capacitance were 2.5 kV, 600 Ω, and 25 μF, respectively. Immediately after electroporation, 900 μL of pre-cooled (0℃) LBHIS medium was added, and the mixture was thoroughly mixed. The cells were then incubated at 30℃ and 200 rpm for 2.5 h. 200 μL of the bacterial culture was then spread onto LBHIS plates (containing 50 μg / mL kanamycin) and incubated at 30℃ until a single colony grew. This single colony is the oxiD single-exchange strain.

[0066] The above-mentioned oxiD single-exchange strain was inoculated into antibiotic-free LHBIS liquid medium and cultured at 30℃ and 200 rpm for 12 h. The resulting bacterial culture was diluted 1:2000, and 100 μL of the diluted solution was spread onto LHBIS plates containing 100 g / L sucrose and cultured at 30℃ for 48 h. After the culture was completed, 20-30 single colonies were picked from the LHBIS plates containing 100 g / L sucrose and inoculated onto LHBIS plates and LHBIS plates containing 50 μg / mL kanamycin, respectively, and cultured at 30℃ for 24 h. The strain that grows only on LHBIS plates and does not grow at all on LHBIS plates containing 50 μg / mL kanamycin is the target strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD with the oxiD gene knocked out.

[0067] Example 4: Knockout of the inositol dehydrogenase gene oxiE Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the upstream homologous arm oxiE-U was amplified by PCR using the upstream primer oxiE-U-UL (SEQ ID NO. 20) and the downstream primer oxiE-U-UR (SEQ ID NO. 21). Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the downstream homologous arm oxiE-D was amplified by PCR using the upstream primer oxiE-D-DL (SEQ ID NO. 22) and the downstream primer oxiE-D-DR (SEQ ID NO. 23).

[0068] The two PCR reaction systems were as follows: 5×PCR buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream primer (10 μM): 1.5 μL; downstream primer (10 μM): 1.5 μL; template: 1 μL; DNA polymerase: 0.5 μL; ddH2O: bring to 50 μL.

[0069] The two PCR reaction programs are as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 55℃ annealing: 30 s; 72℃ extension: 15 s; denaturation, annealing, and extension cycles: 30 cycles; 72℃ final extension: 10 min; 4℃ incubation.

[0070] The upstream homologous arm oxiE-U and the downstream homologous arm oxiE-D obtained by the above PCR amplification were spliced ​​together by overlap extension PCR to obtain the fusion fragment oxiE-U-oxiE-D.

[0071] The reaction system for the first stage of the above overlap extension PCR was as follows: 5× high-fidelity enzyme buffer: 10 μL; dNTPs (2.5 mM): 4 μL; upstream homologous arm oxiE-U: 4 μL; downstream homologous arm oxiE-D: 4 μL; high-fidelity DNA polymerase: 1 μL; ddH2O: to a final volume of 50 μL.

[0072] The reaction program for the first stage of the above overlap extension PCR was as follows: 95℃ pre-denaturation: 5 min; 95℃ denaturation: 30 s; 60℃ annealing: 30 s; 72℃ extension: 1 min; number of denaturation, annealing and extension cycles: 15 cycles.

[0073] After the first stage procedure is completed, 2 μL of upstream primer oxiE-U-UL and 2 μL of downstream primer oxiE-D-DR are added to the reaction system to perform the second stage of specific amplification.

[0074] The reaction procedure for the second stage is as follows: denaturation at 95℃ for 30 seconds; annealing at 60℃ for 30 seconds; extension at 72℃ for 1 minute; number of denaturation, annealing, and extension cycles: 30 cycles; final extension at 72℃ for 10 minutes; and holding at 4℃.

[0075] The expression vector pK18mobsacB was digested with the restriction endonuclease SalI at 37°C for 2 hours to obtain the linearized vector pK18mobsacB.

[0076] The linearized vector pK18mobsacB was ligated with the above-mentioned fusion fragment oxiE-U-oxiE-D to obtain the ligation product. The ligation system consisted of 1 μL of the linearized vector pK18mobsacB, 2 μL of the fusion fragment oxiE-U-oxiE-D, 5 μL of one-step cloning enzyme (Exnase recombinase), and 2 μL of ddH2O.

[0077] The above ligation product was transformed into E. coli JM109 competent cells, plated on LB agar plates (containing 50 μg / mL kanamycin), and cultured at 37°C for 12 h. Single colonies were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C with shaking for 8 h. The plasmid was extracted and sent for testing, and it was confirmed that there was no mutation in the homologous arm, thus obtaining the correct plasmid pK18-ΔoxiE.

[0078] In *Corynebacterium glutamicum* ATCC13032-ΔiolG-ΔoxiB-ΔoxiD competent cells, the plasmid pK18-ΔoxiE was added, gently mixed, and incubated on ice for 30 min. The mixture was then transferred to a pre-cooled (0℃) electroporation cuvette with a 2 mm gap for electroporation. The voltage, resistance, and capacitance were 2.5 kV, 600 Ω, and 25 μF, respectively. Immediately after electroporation, 900 μL of pre-cooled (0℃) LBHIS medium was added, and the mixture was thoroughly mixed. The cells were then incubated at 30℃ and 200 rpm for 2.5 h. 200 μL of the bacterial culture was then spread onto LBHIS plates (containing 50 μg / mL kanamycin) and incubated at 30℃ until a single colony grew. This single colony is the oxiE single-exchange strain.

[0079] The above-mentioned oxiE single-exchange strain was inoculated into antibiotic-free LHBIS liquid medium and cultured at 30℃ and 200 rpm for 12 h. The resulting bacterial culture was diluted 1:2000, and 100 μL of the diluted solution was spread onto LHBIS plates containing 100 g / L sucrose and cultured at 30℃ for 48 h. After the culture was completed, 20-30 single colonies were picked from the LHBIS plates containing 100 g / L sucrose and inoculated onto LHBIS plates and LHBIS plates containing 50 μg / mL kanamycin, respectively, and cultured at 30℃ for 24 h. The strain that grows only on LHBIS plates and does not grow at all on LHBIS plates containing 50 μg / mL kanamycin is the target strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE with the oxiE gene knocked out.

[0080] Example 5 Validation of strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE Wild-type Corynebacterium glutamicum ATCC13032 and the strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE prepared in Example 4 above were inoculated into two basal media with inositol as the single carbon source. The basal media contained 20 g / L of inositol, and the other components were the same as those of LBHIS medium.

[0081] After culturing the two basal culture media at 30℃ and 200rpm for 72h respectively, the OD of the culture media was measured. 600 The values ​​and inositol content were as follows: Figure 1 As shown.

[0082] Figure 1 In this text, WT represents wild-type Corynebacterium glutamicum ATCC13032, and C1 represents the strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE prepared in Example 4.

[0083] Depend on Figure 1 It can be seen that the OD of wild-type Corynebacterium glutamicum ATCC13032 600 The OD values ​​of strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE showed a significant increase, while the inositol content decreased significantly, indicating that the strain can grow normally and that inositol is being consumed. 600 The value increase was small, and the inositol content remained almost unchanged, indicating that no inositol was consumed, confirming that the inositol dehydrogenase genes iolG, oxiB, oxiD, and oxiE were successfully knocked out.

[0084] Example 6: Mutation of the inositol monophosphatase gene Using CRISPR-Cas9 combined with ssDNA recombination technology, the inositol monophosphatase gene was mutated, changing amino acid 87 from I to K in the encoded protein. The specific steps are as follows: Designing and artificially synthesizing ssDNA donor templates: 5'-TGGATCATCGACCCAAAAGACGGCACCAAAAACTACGTCCGCGGCGTCCCCGTATGGGCAACCCTGATCGCGCTGCTCGACAACGGCAAA -3' (SEQ ID NO. 24).

[0085] Based on the sgRNA targeting sequence: 5'-TAGTTTTTGGTGCCGTCGAT-3' (SEQ ID NO.25), two complementary oligonucleotide chains were synthesized for cloning into the BsaI restriction site of plasmid pFST. sgRNA-F: 5'-AAAC TAGTTTTTGGTGCCGTCGAT-3' (SEQ ID NO. 26).

[0086] sgRNA-R: 5'-AAAA ATCGACGGCACCAAAAACTA-3' (SEQ ID NO. 27).

[0087] Preparation system: sgRNA-F: 1 µL; sgRNA-R: 1 µL; 10× annealing buffer: 1 µL; ddH2O: 7 µL; Set the program to 95℃ for 5 minutes, then slowly cool to 25℃ at a rate of 0.1℃ / second to obtain the annealed product.

[0088] The plasmid pFST was digested with the restriction endonuclease BsaI at 37°C for 4 hours to obtain the linearized plasmid pFST.

[0089] The enzyme digestion system was as follows: pFST plasmid: 1 μL; restriction endonuclease BsaI: 1 μL; 10× CutSmart buffer: 5 µL; ddH2O: to 50 µL.

[0090] The linearized plasmid pFST was ligated with the above annealing product at 16°C for 2 hours to obtain the ligation product.

[0091] The ligation system was as follows: linearized plasmid pFST: 50 ng; annealing product: 1 µL; T4 DNA ligase: 1 µL; 10× ligation buffer: 1 µL; ddH2O to bring the total to 10 µL.

[0092] Transform 5 µL of the above ligation product into DH5α competent cells, plate them on LB agar plates containing chloramphenicol (20 µg / mL), and incubate at 37°C for 16 hours. Pick 5-10 single colonies and inoculate them into LB liquid medium containing 20 µg / mL chloramphenicol. After shaking culture at 37°C for 4 hours, extract the plasmid from the colonies to obtain plasmid pFST-sgRNA.

[0093] Take 500 ng of plasmid pFSC, 500 ng of plasmid pFST-sgRNA, and 500 ng of ssDNA donor template, mix them, and finally add ddH2O to a total volume of 10 µL to obtain a DNA mixture. Transform the DNA mixture into competent cells of strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE prepared in Example 4 above, plate them on LBHIS plates containing 50 µg / mL kanamycin and 20 µg / mL chloramphenicol, and incubate upside down at 30°C for 48 hours until single colonies appear. Send single colonies for sequencing to obtain correct positive clones.

[0094] Plasmid elimination: Positive clones verified by sequencing were inoculated into antibiotic-free LBHIS liquid medium and cultured with shaking at 37°C and 200 rpm for 24 hours. The culture was then transferred to another fresh antibiotic-free LBHIS medium at a volume ratio of 1% and cultured again at 37°C for 24 hours. The resulting culture was then transferred to another fresh antibiotic-free LBHIS medium at a volume ratio of 1% and cultured again at 37°C for 24 hours.

[0095] The final culture medium obtained above was diluted 100 times and spread on antibiotic-free LBHIS plates. After incubation at 30°C for 36 hours, 20-30 single colonies were randomly selected from the plates and inoculated onto another antibiotic-free LBHIS plate and another LBHIS plate containing 50 µg / mL kanamycin and 20 µg / mL chloramphenicol. After incubation at 30°C overnight, the strain could grow normally on the antibiotic-free plate, but it did not grow at all on the LBHIS plate containing 50 µg / mL kanamycin and 20 µg / mL chloramphenicol, indicating that there were no plasmids remaining in the strain.

[0096] The selected colonies were sequenced again, and it was finally confirmed that the genome contained the I87K mutation and the sequence was correct, thus obtaining strain I87K.

[0097] Example 7 Overexpression of the inositol-1-phosphate synthase gene ino1 Using the genome of strain I87K as a template and F1 and R1 as primers, PCR amplification was performed to obtain the ino1 gene sequence with restriction enzyme sites.

[0098] F1: CCGGAATTCATGAGCACGTCCACCATCAGGGTTG (SEQ ID NO. 28); R1: CCC AAGCTTTACGCCTCGATGATGAATGCCTC (SEQ ID NO. 29).

[0099] Among them, F1 introduces the EcoRI restriction site, and R1 introduces the HindIII restriction site.

[0100] The reaction system for the above PCR amplification reaction is as follows: template: 1 μL; F1: 1 μL; R1: 1 μL; 2× high-fidelity PCR premix: 25 μL; ddH2O: to 50 μL.

[0101] The reaction program for the above PCR amplification reaction is as follows: 98℃ pre-denaturation: 3 minutes; 98℃ denaturation: 10 seconds; 55℃ annealing: 15 seconds; 72℃ extension: 1 minute; denaturation, annealing, and extension cycles: 30 cycles; 72℃ final extension: 5 minutes.

[0102] The expression vector pXMJ19 and the ino1 gene sequence obtained by PCR amplification were double-digested using restriction endonucleases EcoRI and HindIII, respectively, and digested at 37℃ for 2 h to obtain the linearized vector pXMJ19 and the digested ino1 gene sequence.

[0103] The double enzyme digestion system is as follows: expression vector pXMJ19 or ino1 gene sequence: 1 μL; EcoRI: 1 μL; HindIII: 1 μL; 10× buffer: 5 μL; ddH2O: add to 50 μL.

[0104] The linearized vector pXMJ19 and the enzyme-digested ino1 gene sequence were ligated and the ligation was carried out at 16℃ for 4 h to obtain the plasmid pXMJ19-ino1.

[0105] The ligation system was as follows: linearized vector pXMJ19: 5 μL; digested ino1 gene sequence: 5 μL; T4 DNA ligase: 1 μL; 10×T4 ligation buffer: 2 μL; ddH2O: to a final volume of 20 μL.

[0106] 5 μL of the above-mentioned ligation product plasmid pXMJ19-ino1 was transformed into DH5α competent cells, plated on LB plates containing 20 μg / mL chloramphenicol, and cultured at 37°C for 16 hours. Single colonies were picked, plasmids were extracted and sent for testing. It was confirmed that the ino1 gene sequence in the plasmid was complete and without PCR-introduced mutations, and the correctly sequenced plasmid pXMJ19-ino1 was obtained.

[0107] 1 μL of the correctly sequenced plasmid pXMJ19-ino1 was transformed into competent cells of strain I87K to obtain strain I87K / pXMJ19-ino1.

[0108] Example 8: Validation of the strain Wild-type Corynebacterium glutamicum ATCC13032, strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE prepared in Example 4, strain I87K prepared in Example 6, and strain I87K / pXMJ19-ino1 prepared in Example 7 were inoculated into LBHIS medium and cultured at 30℃ and 220rpm for 16h to obtain seed cultures of wild-type Corynebacterium glutamicum ATCC13032, strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE, strain I87K, and strain I87K / pXMJ19-ino1, respectively.

[0109] The seed cultures of wild-type Corynebacterium glutamicum ATCC13032, strain ATCC13032-ΔiolG-ΔoxiB-ΔoxiD-ΔoxiE, strain I87K, and strain I87K / pXMJ19-ino1 were each transferred to separate fresh LBHIS media at a volume ratio of 1% and cultured at 30°C and 220 rpm until OD600. 600 The concentration was increased to 0.6, and IPTG was added to a final concentration of 0.5 mM. After induction culture at 30℃ for 36 h, the amount of inositol produced in the fermentation broth was measured. The results are shown in Table 1.

[0110] Table 1

[0111] The results above show that, compared to the wild-type Corynebacterium glutamicum ATCC13032, the present invention, by knocking out the inositol dehydrogenase genes iolG, oxiB, oxiD, and oxiE and mutating the inositol monophosphatase to obtain strain I87K, significantly enhances the ability to synthesize inositol. Furthermore, strain I87K exhibits an even greater ability to produce inositol through fermentation after overexpression of the inositol-1-phosphate synthase gene ino1.

[0112] Example 9: Fermentation production of inositol and organic acids Single colonies of strain I87K / pXMJ19-ino1 were selected and cultured using seed culture medium at 37°C until OD500. 600 The seed solution was obtained by adjusting the solution to 1.8.

[0113] The seed culture medium mentioned above is LBG medium containing 25 μg / mL chloramphenicol.

[0114] LBG medium composition: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose.

[0115] The above seed culture was inoculated into the fermenter at a volume ratio of 10%. Fermentation conditions were: temperature 37℃, stirring speed 1000 rpm, aeration rate 1.5 vvm, and dissolved oxygen (DO) ≥ 30%. When the glucose concentration in the fermentation broth reached 40 g / L, the stirring speed was reduced to 300 rpm and the aeration rate to 1.0 vvm, maintaining the dissolved oxygen (DO) value at 5%–10%. IPTG was then added to a final concentration of 0.5 mM to induce the expression of the inositol-1-phosphate synthase gene ino1, simultaneously synthesizing inositol and organic acids. When the glucose concentration in the fermentation broth was ≤ 20 g / L, a 500 g / L glucose solution was added, at a rate of 8 g of pure glucose per liter of fermentation broth per hour, maintaining the glucose concentration in the fermentation broth within the range of 10 g / L–30 g / L.

[0116] After fermenting in a fermenter for 72 hours, the fermentation was stopped, yielding a fermentation broth containing both inositol and organic acids.

[0117] The culture medium in the fermenter consisted of: 80 g / L glucose, 20 g / L (NH4)2SO4, 1 g / L KH2PO4, 1 g / L K2HPO4, 0.25 g / L MgSO4·7H2O, 10 mg / L CaCl2, 10 mg / L FeSO4·7H2O, 10 mg / L MnSO4·H2O, 1 mg / L ZnSO4·7H2O, 0.2 mg / L CuSO4, 0.02 mg / L NiCl2·6H2O, 0.2 mg / L biotin, 0.2 mg / L vitamin B1, and 42 g / L MOPS buffer (for pH maintenance). The pH was adjusted to 7.0 with 4% NaOH solution.

[0118] High dissolved oxygen control fermentation: The strain I87K / pXMJ19-ino1 was fermented using the method described above, with the difference being that when the glucose concentration in the fermentation broth was consumed to 40 g / L, the stirring speed and aeration rate were not reduced, and the dissolved oxygen (DO) value was always ≥30%. All other steps were the same.

[0119] OD in the two fermentation processes mentioned above 600 Sampling and testing were conducted on inositol and organic acid content. The results showed that: Cell growth: The cells grew well during the fermentation process in both of the above fermentation methods.

[0120] Inositol production: At the end of 72 h of fermentation in this example, the cumulative concentration of inositol reached 13 g / L, which was slightly lower than the inositol production (15 g / L) of the high dissolved oxygen control fermentation (DO ≥ 30% throughout), indicating that inositol synthesis was not seriously affected.

[0121] Organic acid accumulation: In this example, after reducing dissolved oxygen, the total organic acid content in the fermentation broth gradually increased. At the fermentation endpoint, the concentrations of the main organic acids were: pyruvic acid 4.8 g / L, citric acid 3.2 g / L, α-ketoglutaric acid 2.1 g / L, and succinic acid 1.5 g / L. In contrast, the total organic acid content in the high-dissolved oxygen control fermentation was only 2.3 g / L, demonstrating that the low-dissolved oxygen strategy successfully achieved the directed overflow of carbon sources into organic acids.

[0122] The effect of organic acid accumulation in fermentation broth under different dissolved oxygen conditions, for example Figure 2 As shown.

[0123] Example 10: Preparation of Fertilizer The fermentation broth prepared in Example 10 was subjected to high-temperature inactivation at 90°C for 30 minutes. The inactivated fermentation broth was then filtered through a 100 nm ceramic membrane to obtain wet bacterial cells and filtrate. Other parameters used in the ceramic membrane filtration were conventional parameters commonly used in the art.

[0124] The isolated wet bacterial cells were dried at 70°C and then pulverized using a pulverizer to obtain bacterial protein powder.

[0125] The filtrate was concentrated using a nanofiltration membrane with a pore size of 200 Da until the solid content was 15 wt%, yielding a liquid fertilizer. Other parameters used in the nanofiltration concentration process were standard parameters commonly used in the field.

[0126] Example 11 Application of Fertilizer Experimental location: Facility base in Damengzhuang Town, Wuqing District, Tianjin.

[0127] The climate is a warm temperate semi-arid and semi-humid continental monsoon climate, with little rain in winter and spring, hot and humid summers, and distinct seasons.

[0128] The experimental greenhouses were over 16 years old, with high soil fertility. The soil type was alluvial soil, with a medium loam texture and slightly alkaline. There was secondary salinization, and the accumulation of nitrogen and phosphorus in the soil was relatively serious. In addition, the large amount of irrigation water posed an environmental risk of nitrogen and phosphorus leaching.

[0129] Tested variety: Tomato, specifically You Shi No. 3.

[0130] The experiment was set up with four treatment groups: G1 (local conventional fertilizer), G2 (local conventional fertilizer + microbial protein powder), G3 (local conventional fertilizer + liquid fertilizer), and G4 (local conventional fertilizer + microbial protein powder + liquid fertilizer), with three replicates.

[0131] The local standard fertilizer is: Compound fertilizer, with a ratio of 15-15-15.

[0132] Experimental methods: G1 treatment group: Local conventional fertilizer was applied starting on the second day after tomato sowing, and was applied with irrigation water once a week at a rate of 150 kg / hm² each time, until 15 days before harvest.

[0133] G2 treatment group: On the second day after tomato sowing, local conventional fertilizer and microbial protein powder were applied. Fertilizer was applied once a week with irrigation water. The amount of local conventional fertilizer was 100 kg / hm² each time, and the amount of microbial protein powder was 10 kg / hm² each time. 2 Fertilization should continue until 15 days before harvest.

[0134] Treatment group G3: On the second day after tomato sowing, apply local conventional liquid fertilizer once a week with irrigation water. The dosage of local conventional fertilizer is 100 kg / hm² each time, and the dosage of liquid fertilizer is 200 L / hm² each time. 2 Fertilization should continue until 15 days before harvest.

[0135] Treatment Group G4: On the second day after tomato sowing, apply local conventional fertilizer, microbial protein powder, and liquid fertilizer. Fertilize once a week with irrigation water. The amount of local conventional fertilizer is 50 kg / hm² each time, and the amount of microbial protein powder is 10 kg / hm² each time. 2 The dosage of liquid fertilizer is 200L / hm² per application. 2 Fertilization should continue until 15 days before harvest.

[0136] Experimental results are as follows Figure 3 , Figure 4 As shown.

[0137] Depend on Figure 3 It can be seen that after applying different fertilizers, the dry matter accumulation of tomato roots, stems, leaves, and fruits was further increased compared to the G1 treatment group, with the G4 treatment group showing the highest dry matter accumulation. This indicates that the microbial protein powder and liquid fertilizer of the present invention, combined with local conventional fertilizers, effectively promotes the accumulation of dry matter in plants.

[0138] Depend on Figure 4 It can be seen that after applying different fertilizers, the soil organic matter content increased further compared to the G1 treatment group, with the G4 treatment group showing the highest soil organic matter content. This indicates that the microbial protein powder and liquid fertilizer of the present invention, combined with local conventional fertilizers, further increased the soil organic matter content and improved soil quality.

[0139] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant bacterial strain for producing inositol, characterized in that, The recombinant strain does not express inositol dehydrogenase, expresses an inositol monophosphatase mutant, and overexpresses inositol-1-phosphosynthase. The amino acid sequence of the inositol monophosphatase mutant is shown in SEQ ID NO.

1.

2. The recombinant strain according to claim 1, characterized in that, The host strain of the recombinant strain is Corynebacterium glutamicum.

3. The recombinant strain according to claim 1, characterized in that, The nucleotide sequence of the inositol monophosphatase mutant gene is shown in SEQ ID NO.

2.

4. A method for preparing a recombinant bacterial strain, characterized in that, The method for preparing the recombinant strain for producing inositol according to any one of claims 1 to 3 comprises the following steps: Knock out the inositol dehydrogenase gene in the host strain, wherein the inositol dehydrogenase gene includes iolG, oxiB, oxiD and oxiE; The inositol monophosphatase gene in the host strain was mutated by changing the 87th amino acid of the protein encoded by the inositol monophosphatase gene from I to K. The expression vector containing the inositol-1-phosphate synthase gene ino1 was transferred into the host strain.

5. The preparation method according to claim 4, characterized in that, The nucleotide sequence of iolG is shown in SEQ ID NO.3; The nucleotide sequence of oxiB is shown in SEQ ID NO.4; The nucleotide sequence of the oxiD is shown in SEQ ID NO.5; The nucleotide sequence of oxiE is shown in SEQ ID NO.6; The nucleotide sequence of the inositol-1-phosphate synthase gene ino1 is shown in SEQ ID NO.

7.

6. The use of the recombinant strain according to any one of claims 1 to 3 in the preparation of inositol, organic acids or fertilizers.

7. A method for fermenting to produce inositol and organic acids, characterized in that, The production of inositol and organic acids by fermentation using the recombinant strain according to any one of claims 1 to 3 includes the following steps: The recombinant strain according to any one of claims 1 to 3 is subjected to seed culture to obtain seed liquid; The seed culture was inoculated into a fermentation medium for fermentation culture. Under the condition of DO≥30%, the glucose concentration in the fermentation broth was consumed to 30g / L~40g / L. Then, the DO value was reduced to 5%~10%, and an inducer was added to induce the recombinant strain to express the inositol-1-phosphate synthase gene ino1, and simultaneously synthesize inositol and organic acids. When the glucose concentration in the fermentation broth is ≤20 g / L, add glucose solution to maintain the glucose concentration in the fermentation broth at 10 g / L~30 g / L; After fermentation for 70-75 hours, a fermentation broth containing both inositol and organic acids is obtained.

8. The method according to claim 7, characterized in that, The seed culture temperature is 30℃~40℃; and / or, The fermentation culture temperature is 30℃~40℃; and / or, Add 6g to 9g of pure glucose per liter of fermentation broth per hour.

9. The method according to claim 7, characterized in that, The organic acid includes at least one of pyruvic acid, citric acid, α-ketoglutarate, and succinic acid.

10. A method for preparing a fertilizer, characterized in that, The fertilizer includes microbial protein powder and liquid fertilizer, and includes the following steps: The fermentation broth prepared by any one of claims 7 to 9 is inactivated at high temperature and filtered to obtain bacterial cells and filtrate. The bacterial cells are dried and pulverized to obtain bacterial protein powder; The filtrate is concentrated to a solid content of 10wt%~20wt% to obtain liquid fertilizer.

Images