A gene for inositol monophosphatase SgIMP1 in *Styrax styrax* that enhances plant tolerance to aluminum toxicity and low phosphorus stress, and its application.
By heterologously overexpressing the SgIMP1 gene of *Arabidopsis thaliana*, the problem of insufficient tolerance of the plant to aluminum toxicity and low phosphorus stress was solved, and the plant's ability to withstand aluminum toxicity and low phosphorus stress was significantly enhanced, thus improving its growth capacity in acidic soils.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI
- Filing Date
- 2026-02-12
- Publication Date
- 2026-05-26
AI Technical Summary
Existing technologies have failed to effectively improve plant tolerance to aluminum toxicity and low phosphorus stress, limiting the crop production potential in acidic soils.
The inositol monophosphatase gene SgIMP1 was identified from Guyana pentaphyllum, and the gene was heterologously overexpressed in Arabidopsis thaliana using transgenic technology to increase the expression level of SgIMP1 in plants, thereby enhancing their inositol content and phosphatase activity.
Transgenic plants that heterologously express SgIMP1 significantly enhanced their tolerance to aluminum toxicity and low phosphorus stress, increased inositol content and phosphatase activity, providing a scientific basis for improving the adaptability of crops in strongly acidic soils.
Smart Images

Figure CN121718558B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a *Styrax chinensis* inositol monophosphatase gene that can enhance plant tolerance to aluminum toxicity and low phosphorus stress. SgIMP1 And its applications. Background Technology
[0002] Acidic soils (pH < 5.5) account for approximately 50% of the world's potential arable land. Aluminum toxicity and low phosphorus stress are two major problems limiting crop production in acidic soils. These stresses are particularly pronounced in strongly acidic soils (pH < 4.5), where most crops yield poorly, resulting in the underutilization of the production potential of these marginal lands. Therefore, breeding new crop varieties with strong tolerance to aluminum toxicity and low phosphorus stress is of great significance for tapping the production potential of strongly acidic soils and ensuring food security.
[0003] Pioneer plants are products of natural selection, capable of establishing themselves and thriving in extreme environments (such as high salinity, drought, and high temperatures). They are ideal materials for studying adaptive evolution and provide valuable stress-resistance gene resources for crop improvement. Guyana pendulum bean (… Stylosanthes guianensis Stylosanthes kirilowii, commonly known as stylosanthes, is a pioneer leguminous plant adapted to strongly acidic soils, exhibiting both aluminum toxicity tolerance and low phosphorus stress tolerance. In tropical and subtropical regions, Stylosanthes kirilowii is widely cultivated as a forage and green manure crop, effectively restoring degraded farmland and improving soil fertility. Identifying the key genes in Stylosanthes kirilowii's aluminum toxicity tolerance and low phosphorus stress tolerance can be used to improve the adaptability of other plants to strongly acidic soils.
[0004] Inositol is an important signaling molecule that plays a crucial role in plant growth, development, and environmental adaptation. Inositol monophosphatase (IMP) is a key enzyme in inositol biosynthesis. Studies have shown that inositol monophosphatase in Arabidopsis thaliana... AtVTC4 and inositol monophosphatase in tomatoes SlIMP3 In the biosynthesis of inositol and related derivatives (such as ascorbic acid), IMP family genes have been shown to play important roles in salt and drought tolerance in multiple plant species. Currently, no IMP family genes have been reported to function in plant tolerance to aluminum toxicity and low phosphorus stress. This invention identifies an IMP family gene in *Stylosanthes* that is upregulated by aluminum toxicity and low phosphorus stress treatment, and names it... SgIMP1 This invention utilizes heterologous overexpression in Arabidopsis thaliana. SgIMP1 This gene enhances the tolerance of transgenic Arabidopsis to aluminum toxicity and low phosphorus stress, and can be used to improve the plant's tolerance to aluminum toxicity and low phosphorus stress. Summary of the Invention
[0005] This invention provides a *Styrax chinensis* inositol monophosphatase gene that can enhance plant resistance to aluminum toxicity and low phosphorus stress. SgIMP1 And its applications, to overcome the above problems.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] This invention provides a *Styrax styrax* inositol monophosphatase gene that can enhance plant resistance to aluminum toxicity and low phosphorus stress. SgIMP1 The SgIMP1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0008] Furthermore, the aforementioned SgIMP1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 2.
[0009] Another aspect of the present invention provides a *Styrax chinensis* inositol monophosphatase gene that can enhance plant resistance to aluminum toxicity and low phosphorus stress. SgIMP1 Applications in improving resistance to aluminum toxicity and low phosphorus stress.
[0010] Furthermore, a method to improve the plant's tolerance to aluminum toxicity and low phosphorus stress is to: increase the levels of the aforementioned... SgIMP1 Gene expression levels.
[0011] Furthermore, improve the plants described SgIMP1 The method for measuring gene expression is: constructing overexpression structures using transgenic technology. SgIMP1 A recombinant plant expression vector was used to transfer the gene into plants via Agrobacterium-mediated transformation, thereby increasing the inositol content and phosphatase activity of the plants, enabling them to acquire... SgIMP1 The gene and the protein it encodes possess the functions of aluminum toxicity resistance and low phosphorus stress resistance.
[0012] Furthermore, the plant in question is Arabidopsis thaliana.
[0013] The beneficial effects of this invention are:
[0014] This invention discloses an inositol monophosphatase gene derived from Stylosanthes styracifolium. SgIMP1 This gene has a biological function of enhancing plant tolerance to aluminum toxicity and low phosphorus stress; experiments have confirmed that heterologous expression... SgIMP1 The transgenic plants containing this gene showed a significant increase in inositol content and were effectively enhanced in their tolerance to aluminum toxicity stress and low phosphorus stress. This gene can serve as an important gene for the transgenic improvement of crops, providing a scientific basis and technical support for the subsequent development of new crop germplasm suitable for cultivation in strongly acidic soils. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1 This is a gel electrophoresis image of total RNA from the roots of *Stylos sinensis* in normal phosphorus and low phosphorus treatments, control and aluminum toxicity treatments in Example 1 of this invention.
[0017] Figure 2 In Example 1 of this invention, the roots of *Stylosanthes cusia* under normal phosphorus and low phosphorus treatments... SgIMP1 The relative expression levels;
[0018] Figure 3 The roots of *Styrax chinensis* in Example 1 of this invention were compared with those treated with aluminum poisoning. SgIMP1 The relative expression levels;
[0019] Figure 4 The results of the phylogenetic tree analysis of SgIMP1 and six different species of IMP family members in Example 2 of this invention;
[0020] Figure 5 The results of purification and biochemical enzymatic property analysis of the SgIMP1 recombinant protein in Example 3 of this invention are shown below. Figure 5 A represents the SDS-PAGE purification and identification results of the GST:SgIMP1 fusion protein. Figure 5 B represents the substrate specificity and specific activity of the SgIMP1 recombinant protein against D-inositol 1-phosphate and sodium phytate.
[0021] Figure 6 The results of subcellular localization analysis of SgIMP1:GFP in Example 4 of this invention;
[0022] Figure 7 Heterologous overexpression in Example 5 of this invention SgIMP1 Electrophoresis diagram for identifying positive transgenic Arabidopsis thaliana lines;
[0023] Figure 8 In Example 6 of this invention, wild-type (WT) and heterologous overexpression were performed. SgIMP1 Comparison of phosphatase activities between transgenic Arabidopsis lines (OE1, OE2);
[0024] Figure 9 In Example 7 of this invention, wild-type (WT) and heterologous overexpression were performed. SgIMP1 Comparison of inositol content in transgenic Arabidopsis thaliana lines (OE1, OE2);
[0025] Figure 10 In Example 8 of this invention, wild-type (WT) and heterologous overexpression were performed. SgIMP1 Phenotypic and physiological parameters of transgenic Arabidopsis lines (OE1, OE2) under normal phosphorus (NP) and low phosphorus (LP) treatments were analyzed. Figure 10 A is a phenotypic diagram of plant growth. Figure 10 B represents the statistical results of aboveground dry weight (biomass). Figure 10 C represents the statistical results of total phosphorus content in the aboveground parts;
[0026] Figure 11 In Example 9 of this invention, wild-type (WT) and heterologous overexpression were performed. SgIMP1 Transgenic Arabidopsis thaliana lines (OE1, OE2) in control ( Phenotypic and growth index analysis results under Al) and aluminum poisoning treatment (+Al), among which Figure 11 A shows the plant growth phenotypes under aluminum toxicity treatment (+Al). Figure 11 B represents the statistical results of the primary root length under aluminum poisoning treatment (+Al). Figure 11 C represents the statistical results of the whole plant fresh weight (biomass) under aluminum toxicity treatment (+Al). Figure 11 D represents the control treatment. Plant growth phenotype diagram below (Al). Figure 11 E represents the control treatment ( Statistical results of principal root length under Al) Figure 11 F represents the control treatment ( Statistical results of whole plant fresh weight (biomass) under Al). Detailed Implementation
[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] The *Stylosanthes* material used in the following examples was obtained from the Institute of Tropical Crop Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences, while the wild-type *Arabidopsis thaliana* was bred and preserved independently by our research group. The primers used in these examples were synthesized by Qingke Biotechnology Co., Ltd. The competent cells used in these examples were purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0029] Example:
[0030] Example 1: Stylosanthes pubescens SgIMP1 Analysis of gene expression patterns in response to low phosphorus and aluminum toxicity stress
[0031] 1. Hydroponic experiment of low-phosphorus treatment of Stylosanthes chinensis
[0032] The experiment on low phosphorus stress treatment of Stylosanthes chinensis was conducted using a hydroponic method, and the steps are as follows:
[0033] Remove the seed coat from Reyan No.5 seeds, heat shock at 80℃ for 3 min, sterilize with 10% (v / v) sodium hypochlorite (239305, Sigma-Aldrich) for 5 min, wash several times with distilled water, spread evenly in a petri dish lined with moist filter paper, and germinate in the dark for 2-3 days. Then, transfer to a modified Magnavaca nutrient solution (pH=5.8) for pre-culture for 14 days. The modified Magnavaca nutrient solution has the following component concentrations: 1000 μM potassium chloride, 1500 μM ammonium nitrate, 1000 μM calcium chloride, 200 μM magnesium sulfate, 500 μM magnesium nitrate, 155 μM magnesium chloride, 11.8 μM manganese chloride, 77 μM iron-HEDTA, 0.8 μM copper sulfate, 3.06 μM zinc sulfate, 1.07 μM sodium molybdate, 33 μM boric acid, and 300 μM or 5 μM potassium dihydrogen phosphate (KH₂PO₄). The chemical reagents used for the above nutrient solution components were purchased from Shanghai Yuanye Biotechnology Co., Ltd.
[0034] After the pre-culture, seedlings with uniform growth were selected and transferred to fresh modified Magnavaca nutrient solutions containing 300 μM KH₂PO₄ (normal phosphorus treatment group, denoted as NP) and 5 μM KH₂PO₄ (low phosphorus treatment group, denoted as LP) for further treatment. The LP treatment group received a supplemental nutrient solution containing 295 μM KCl to maintain a K balance between the two treatments. During the pre-culture and treatment periods, the nutrient solution was changed every 3 days, and the pH was adjusted to 5.8 using H₂SO₄ (C0680154025, Nanjing Reagent) or KOH (C0111510123, Nanjing Reagent). Root samples were harvested after 14 days of seedling treatment.
[0035] 2. The hydroponic experiment on aluminum toxicity treatment of Stylosanthes kirilowii, the steps are as follows:
[0036] The disinfection, germination, and pre-culture conditions for Stylosanthes Species No. 5 seeds were the same as those in the hydroponic experiment of low-phosphorus treatment of Stylosanthes Species in section 1 above. After 10 days of pre-culture, seedlings with uniform growth were selected and transplanted to either plants treated with 540 μM AlCl3 (W14271, source leaf) (aluminum toxicity treatment, +Al) or plants without AlCl3 (control). The root samples were treated with a fresh modified Magnavaca nutrient solution (with a KH2PO4 concentration of 45 μM, and other parameters the same as the modified Magnavaca nutrient solution described in section 1 above). During the treatment period, the modified Magnavaca nutrient solution was replaced with fresh solution every 3 days. In this experiment, the pH of the modified Magnavaca nutrient solution was first adjusted to 7.8 with KOH (to prevent premature hydrolysis of AlCl3 and precipitation), then AlCl3 was added and stirred to dissolve. Finally, the pH was adjusted to 4.0 with 1M HCl (87472, Supelco). Furthermore, the pH of the nutrient solution was calibrated to 4.0 daily during the treatment period. Root samples were collected after 10 days of treatment.
[0037] 3. Quantitative Real-Time PCR Analysis
[0038] Normal phosphorus (NP) and low phosphorus (LP) treatments, as well as the control group, were collected separately. Stylosanthes roots were treated with Al and aluminum toxicity (+Al) and ground into powder using liquid nitrogen as samples. Total RNA was extracted from the roots using a plant total RNA extraction kit (DP432, TIANGEN). The integrity of the total RNA was assessed by 1% agarose gel electrophoresis (1110GR100, BioFroxx), following the kit's instructions. cDNA synthesis was performed using the HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme). The synthesized cDNA was used as a template to select the Stylosanthes housekeeping gene. SgUBCE1 As an internal reference gene (sequence SEQ ID NO: 19), designed SgUBCE1 Quantitative PCR primers ( SgUBCE1 -RT-F:CAGATCAAGCTGCTGACGAA (SEQ ID NO: 3); SgUBCE1 -RT-R:GAACAAGCGATCATCAGGTTT (SEQ IDNO: 4)) and SgIMP1 Quantitative PCR primers for genes ( SgIMP1 -RT-F:GGAACAAAACGTGACAAGGCAACAT(SEQ IDNO: 5); SgIMP1-RT-R: TACAACACCTCCGGCTTCTCTAACA (SEQ ID NO: 6)); Quantitative PCR (RT-qPCR) was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) reagents. The instrument used was a QuantStudio 6 Flex qRT-PCR system (Applied Biosystems, USA). For specific operating procedures, please refer to the reagent and instrument manuals.
[0039] Total RNA integrity test results are as follows Figure 1 As shown, the 28S and 18S bands are clear and without diffusion, indicating that the extracted total RNA is of good quality. SgIMP1 RT-qPCR expression analysis results of genes under different treatments are as follows: Figure 2 and Figure 3 As shown, Figure 2 middle, The results indicate a significant difference between the normal phosphorus (NP) and low phosphorus (LP) treatments (Student's t-test). P <0.01), by Figure 2 It can be seen that under low phosphorus stress, the roots of Stylosanthes stylosum... SgIMP1 The relative expression level of the gene was significantly upregulated compared to normal phosphorus treatment; Figure 3 middle, Indicates comparison ( The difference between Al and aluminum poisoning treatment (+Al) is significant (Student's t -test, P <0.01), by Figure 3 It can be seen that under the stress of aluminum toxicity SgIMP1 The relative expression level of the gene in the roots of *Stylosanthes cuspidata* was also significantly higher than that in the control treatment. In summary, SgIMP1 Gene expression in the roots of Stylosanthes was induced by low phosphorus and aluminum toxicity stress, and showed a significant upregulation trend under both stress treatments.
[0040] Example 2: Stylosanthes pubescens SgIMP1 Gene cloning and phylogenetic tree analysis
[0041] Fresh *Stylosanthes stylosum* root samples were immediately ground into powder using liquid nitrogen. Total RNA was extracted and cDNA synthesized following the method in Example 1. Primers were designed. SgIMP1 -ORF-F: ATGGCTAACACTGATTCGCT (SEQ ID NO: 7) and SgIMP1-ORF-R: TCACTCTGTTTGGCGCAG (SEQ ID NO: 8), using cDNA as a template, amplified by PCR SgIMP1 Full-length CDS sequence of the gene. PCR amplification steps and system are as follows:
[0042] Preparation of the reaction mixture: 20 μL Phanta Flash Super-Fidelity DNA Polymerase (P521-d1, Vazyme), 1 μL each of forward and reverse primers, 2 μL cDNA template, and 16 μL ddH2O. Place the reaction mixture in a PCR instrument and set the following program: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 35 cycles; then complete extension at 72℃ for 5 minutes; store at 4℃.
[0043] The PCR product was purified using the FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme), and Sanger sequencing was performed using the aforementioned amplification primers to obtain... SgIMP1 Gene sequence information. The amino acid sequence of the SgIMP1 protein was deduced based on the nucleotide sequence. SgIMP1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. SgIMP1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 2.
[0044] 2. Phylogenetic analysis of SgIMP1 protein sequence
[0045] The SgIMP1 protein sequence was aligned with the protein sequences of all members of the IMP family from other plants, using default parameters, and a maximum likelihood phylogenetic tree was constructed. The results are as follows: Figure 4 The results showed that SgIMP1 has the highest homology with AtVTC4 protein in the Arabidopsis IMP protein family, suggesting that the two have similar biological functions.
[0046] Example 3: Expression, purification, and substrate-specific analysis of recombinant SgIMP1 protein
[0047] 1. Expression and purification of SgIMP1 protein
[0048] Using *Stylosanthes cuspidatum* cDNA as a template, primers were designed (GST-SgIMP-F: GATCCCGAATTCCCGGATGACCGTCTCCTCTGAAAG (SEQ ID NO: 9); GST-SgIMP-R: CGCTCGAGTCGACCCGGTCATACTTTTTTAGTACCAGCCTTG (SEQ ID NO: 10)) to amplify cDNA carrying the pGEX6P3 vector adapter. SgIMP1 Full-length CDS; the pGEX6P3 vector was digested with restriction endonuclease SmaI (R0141V, NEB), and the amplified vector was simultaneously digested. SgIMP1 The full-length CDS fragment was digested with the corresponding enzymes; the pGEX6P3 vector and... SgIMP1 Gene linking, construction SgIMP1 Recombinant protein expression vector pGEX6P3- with sequence fused to GST tag SgIMP1 .
[0049] The constructed pGEX6P3- SgIMP1 The vector was transformed into *Escherichia coli* BL21 (EC1001, Weidi Biotechnology) via heat shock. An appropriate amount of bacterial culture was added to 200 mL of LB liquid medium and cultured in a shaker at 37°C until OD (Organic Degree) was reached. 600 The concentration was set to 0.8, then 0.8 mM IPTG was added and the mixture was transferred to a shaker at 28°C for 6 h of further incubation. The bacterial culture was then centrifuged at 6000 rpm for 10 min, the supernatant was removed, and the bacterial cells were collected. The precipitate was resuspended in 20 mL of binding buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, 5 mM DTT), and the bacterial cells were disrupted using an ultrasonic homogenizer. The supernatant was collected after centrifugation at 12000 rpm for 20 min. The protein was then purified using a GST fusion protein purification kit (70601-K10, BEAVER, China), following the instructions in the product manual. The purified GST was then... SgIMP1 The fusion protein was analyzed by SDS-PAGE, with the unpurified total protein (collected supernatant) as a reference to determine protein purity.
[0050] The results are as follows Figure 5 As shown in Figure A, compared with the total protein channels, the protein channels purified by the two-step method of the kit showed clear and single protein bands with a molecular weight of approximately 56 KD, indicating that the GST:SgIMP1 fusion protein was successfully induced to express in E. coli and the target protein with good purification effect was obtained.
[0051] 2. Substrate specificity analysis of SgIMP1 recombinant protein
[0052] The concentration of the purified GST:SgIMP1 fusion protein was determined using the Coomassie Brilliant Blue assay with bovine serum albumin (A1933, Sigma) as a standard. Substrate solutions with concentrations of 2 mM sodium phytate (Phy-P) (B21664, Yuan Ye) or 2 mM D-inositol 1-phosphate (D-Ins 1-P) (D333623, Aladdin) were prepared using 50 mM sodium acetate (241245, Sigma-Aldrich) solution (pH=5.6, containing 5 mM MgCl2) as solvent. The reaction mixture was then added as follows: 50 μL substrate solution + protein sample solution (containing 0.5 μg protein), followed by a final volume of 100 μL with 50 mM sodium acetate solution. The control reaction mixture consisted of 50 μL substrate + 50 μL 50 mM sodium acetate solution. The prepared reaction system was placed at 37°C for 15 min, and the phosphorus content in the reaction product was determined using an inorganic phosphorus test kit (C006-1-1, Nanjing Jiancheng Bioengineering Institute).
[0053] The results are as follows Figure 5 As shown in Figure B, GST:SgIMP1 exhibits higher specific activity for D-inositol 1-phosphate (D-Ins 1-P) substrates compared to sodium phytate (Phy-P) substrates (Figure B). Indicates a significant difference, Student's t -test, P <0.001). This result indicates that the SgIMP1 protein can catalyze the dephosphorylation of D-Ins 1-P, and releases a higher content of inorganic phosphorus, thereby producing free inositol.
[0054] Example 4: Subcellular localization analysis of SgIMP1 protein
[0055] 1. Recombinant expression vector pCXSN-GFP- SgIMP1 Construction
[0056] Using the plant expression vector pCXSN-GFP as the vector backbone, a design was developed. SgIMP1 Primers, ( SgIMP1 -GFP-F: TACTCGAGGGGGATCATGGCTAACACTGATTCGCT (SEQ ID NO: 11); SgIMP1 -GFP-R: TGCTCACCATGGATCCCACTCTGTTTGGCGCAGT (SEQ ID NO: 12) is used to... SgIMP1The coding gene was inserted downstream of the GFP tag in the vector to construct a fusion expression vector. BamHI restriction endonuclease (R0136V, NEB) was used to inhibit the expression. pCXSN-GFP The plasmid was digested with a single enzyme, and the linearized vector fragment was recovered using a gel extraction kit for later use.
[0057] SgIMP1 Fragment preparation: Using cDNA from *Stylosanthes cusia* root slices as a template, PCR amplification was performed. SgIMP1 The fragment was pre-denatured at 95℃ for 3 min, denatured at 95℃ for 15 s, annealed at 56℃ for 30 s, extended at 72℃ for 30 s, for 35 cycles, and finally extended at 72℃ for 5 min. It was then stored at 4℃. The fragment was recovered using a gel recovery kit (DC301-01, Novizan). SgIMP1 Fragments; obtained through homologous recombination SgIMP1 The fragment was inserted between the two multiple cloning sites (BamHI) of pCXSN-GFP to obtain the recombinant expression vector pCXSN-GFP. - SgIMP1 The recombinant product was transformed into DH5α competent E. coli cells; positive single colonies were selected, and PCR was performed using 2×RapidTaq Master Mix (P222-01, Novizan). The reaction program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ final extension for 5 min, and storage at 4℃. PCR-positive colonies were further sequenced for identification. After confirming the sequencing results, the recombinant plasmid was extracted using a plasmid extraction kit (DC201-01, Novizan) for subsequent experiments.
[0058] 2. Extraction and transformation of Arabidopsis thaliana protoplasts
[0059] Select healthy Arabidopsis thaliana Col-0 plants that are 4-5 weeks old and have green leaves. Take fully extended leaves and immerse them in a 0.4 mol / L mannitol (M813423, Macklin) solution. Cut the leaves into 1 mm wide shreds with a sterile blade and transfer them into an Erlenmeyer flask containing the enzymatic hydrolysate. The hydrolysate consists of: 1.5% cellulase R-10 (MX7352, Yakult), 0.5% pectinase R-10 (MX7354, Yakult), 0.4 mol / L mannitol, 20 mmol / L KCl, and 20 mmol / L MES (M6159, Maklin), pH 5.7. Hydrolyze the leaves at 23℃ and 45 rpm for 3-4 h. Filter the liquid in the Erlenmeyer flask through a 120-mesh nylon filter cloth into a new 50 mL centrifuge tube. Centrifuge at 100 g for 3 min at room temperature (centrifuge speed set to 3 for both vertical and horizontal speeds; follow this setting for subsequent centrifugation steps). Gently aspirate the supernatant, add 20 mL of W5 solution, mix gently, centrifuge for 3 min, discard the supernatant, wash once more with 20 mL of W5, add another 20 mL of W5, and incubate on ice for 30 min. Centrifuge again, discard the supernatant, add an appropriate amount of MMG solution (standard plant protoplast resuspension) as needed, mix gently, and adjust the protoplast concentration to 1×10⁻⁶. 6 Protoplasts were prepared at 1 cell / mL and then placed on ice for later use.
[0060] Take the cryopreserved recombinant plasmid pCXSN-GFP- SgIMP1 Thaw the protoplasts, using the empty vector pCXSN-GFP as a control. The amount of plasmid used in each transformation reaction system was set at 8-10 μg. Using a pipette tip with the tip removed, pipette 200 μL of protoplasts was first mixed with the measured amount of plasmid, and then an equal volume (sum of plasmid and protoplast volumes) of PEG solution (P820919, Maklin) was added. The mixture was quickly and gently mixed, and the mixture was incubated at room temperature for 5-10 min for transformation. After transformation, 2 volumes of W5 solution were added to terminate the reaction. The protoplasts were centrifuged and the supernatant was discarded. The protoplasts were then washed twice with 3 volumes of W5 solution to remove residual PEG. Finally, an appropriate amount (200-800 μL) of W5 solution was added, and the mixture was placed flat under low light overnight to induce protein expression.
[0061] 3. Observe GFP fluorescence under a laser confocal microscope.
[0062] pCXSN-GFP- SgIMP1 After the fusion vector (recombinant vector) and the empty vector pCXSN-GFP were transformed into Arabidopsis protoplasts, the GFP signal fluorescence was observed under a confocal microscope. The results are as follows: Figure 6As shown, the GFP signal of the empty vector pCXSN-GFP is diffusely distributed throughout the cell, while the pCXSN-GFP- SgIMP1 The GFP fluorescence signal of the fusion vector is concentrated in the cytoplasmic region, indicating that... SgIMP1 Proteins are mainly located in the cytoplasm.
[0063] Example 5 Heterologous Overexpression SgIMP1 Obtaining transgenic Arabidopsis thaliana lines
[0064] 1. Construction of plant overexpression vectors
[0065] Using the plant overexpression vector pCXSN as the backbone, specific primers (OE-pCXSN-) were designed. SgIMP1 -F:AGATCTTCCAATACTTATGGCTAACACTGATTCGCT (SEQ ID NO: 13); OE-pCXSN- SgIMP1 -R: TGGATCCCCAATACTTCACTCTGTTTGGCGCAG (SEQ ID NO: 14) , using *Stylosanthes cuspidata* cDNA as a template, PCR amplification SgIMP1 The full-length CDS sequence of the gene was used to insert into the pCXSN vector to construct the recombinant expression vector. The PCR reaction system consisted of 20 μL Phanta Flash Super-Fidelity DNA Polymerase (P521-d1, Vazyme), 1 μL each of forward and reverse primers, 2 μL template, and 16 μL ddH2O. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 56℃ annealing for 30 seconds, and 72℃ extension for 30 seconds, for a total of 35 cycles; followed by a complete extension at 72℃ for 5 minutes; and storage at 4℃.
[0066] Using the restriction endonuclease Xcm I (R0533V, NEB) to... pCXSN The vector was digested with enzymes in a 50 μL solution: 10 μL (5 μg) pCXSN vector plasmid, 2.5 μL Xcm I, 5 μL restriction enzyme buffer, and 30 μL ddH2O. The mixture was incubated at 37°C for 2 h. The PCR product and the digested vector were purified. The pCXSN vector and the digested vector were then digested using the homologous recombinase ClonExpress II One Step Cloning Kit (C112-01, Vazyme). SgIMP1 Gene fragment ligation was performed, and the ligation product was transformed into E. coli DH5α (DL1001, Vazyme) using the heat shock method and sequenced. After confirming that the sequence was correct, the recombinant plasmid was extracted using the FastPure Plasmid Mini Kit (DC201-01, Vazyme). pCXSN-SgIMP1 .
[0067] 2. pCXSN- SgIMP1 Importing Arabidopsis thaliana
[0068] (1) Transformation of Agrobacterium GV3101
[0069] pCXSN- SgIMP1 The recombinant plasmid was transformed into GV3101 competent cells (AC1001, Weidi Biotechnology). The specific steps are as follows: Competent cells were removed at -80℃ and placed on ice for later use. 1000 ng of plasmid was added to 100 μL of competent cells and gently stirred to mix. The cells were then incubated on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min. The centrifuge tube was removed from the ice box, and 1000 μL of LB liquid medium was added. The cells were incubated at 28℃ with shaking for 60 min. Collect bacterial cells by centrifugation at 4000 rpm, retain 100 μL of supernatant, remix, and spread on LB agar plates containing rifampicin (R105455, Aladdin) and kanamycin (K742567, Aladdin). Incubate at 28°C until colonies grow. Pick single colonies for PCR identification. Select positive colonies and inoculate them into 5 mL of LB liquid medium. Incubate at 190 rpm / min for 12 h at 28°C. Transfer 0.5 mL of bacterial solution to a sterile 1.5 mL EP tube, add an equal volume of 50% glycerol, mix well, and store at -80°C for later use.
[0070] (2) Preparation of materials for Arabidopsis thaliana
[0071] Wild-type Arabidopsis thaliana (WT, Col-0) seeds were directly sown in a water-absorbing mixed soil (vermiculite: nutrient soil = 1:1) and placed in a plant room for cultivation (22℃, photoperiod 16 h / 8 h = light / dark) for 7 days. Afterward, seedlings were individually transplanted into fresh mixed soil and cultivated for approximately one month. When the plants had bolted to about 7-8 cm and produced numerous inflorescences, Agrobacterium infection was performed.
[0072] (3) Preparation of Agrobacterium infection solution
[0073] Remove the pCXSN- which has been transferred and stored at -80℃. SgIMP1 Agrobacterium GV3101, a recombinant plasmid, was streaked onto LB agar plates containing 50 mg / L Rif and 50 mg / L Kan using an inoculation loop. The plates were then incubated in the dark at 28°C for 48 h. Single colonies with good growth were inoculated into 5 mL of LB liquid medium containing Rif and Kan and incubated at 200 rpm in the dark at 28°C for 24 h. The colonies were then transferred to 100 mL of LB liquid medium for expansion until OD was reached. 600The pH was 1.6–2.0; then, centrifuged at 3000 rpm for 10 min, discarding the supernatant and collecting the bacterial cells. 25 mL of 0.5 x MS Salt (pH=5.7) was added to each tube to resuspend the bacterial cells. The bacterial suspensions of two tubes containing the same plasmid were combined, centrifuged at 3000 rpm for 10 min, and the supernatant was discarded. 50 mL of infiltration buffer was added to resuspend the bacterial cells. The infiltration buffer contained 5% w / v sucrose (R015039, Ron), 0.22% w / v MS Salt (M519, Phytotech), 0.05% MES (M6159, Maklin), 0.044 μM 6-BA (B9395, Sigma-Aldrich), and 20% v / v SilwetL-77 (CS9791, Coollab, pH=5.7). Finally, the combined bacterial suspension was resuspended in 400 mL of infiltration buffer to prepare the infection solution.
[0074] (4) Transgenic Arabidopsis thaliana
[0075] Select healthy, flowering Arabidopsis thaliana plants (water them the day before transformation to keep them moist). Use the inflorescence inoculation method to immerse the inflorescences, leaves, and basal buds of wild-type Arabidopsis thaliana in the inoculation solution. After standing for 5 minutes, wrap the Arabidopsis thaliana in plastic wrap and place it in the dark for 24 hours. Remove the plastic wrap and cultivate it under normal culture conditions until seed harvest (transform once a week during the cultivation period, for a total of 2 transformations).
[0076] After harvesting T0 generation seeds from the transformed Arabidopsis, approximately 100 μL of seeds were taken for propagation identification. The specific steps were as follows: The entire operation was carried out in a clean bench. First, the seeds were washed twice with sterile secondary water, then rinsed three times with 70% ethanol (Xiaoganweishi (Shandong) Medical Technology Co., Ltd.), and the ethanol was removed by centrifugation. Next, the seeds were washed with 3% sodium hypochlorite for 1 min, the sodium hypochlorite was removed by centrifugation, and the seeds were rinsed six times with sterile water. Finally, the seeds were resuspended in sterile water and evenly sown on MS medium containing 30 mg / mL hygromycin (10843555001, Roche). After being treated at 4℃ for 2 days to break dormancy, the seeds were transferred to a plant light incubator with a photoperiod of 16 h / 8 h (light / dark) and a temperature of 22℃. After about 2 weeks, the surviving T1 generation seedlings were transferred to the substrate to continue growing. After the plants grew larger, a small number of leaves were harvested for DNA extraction and PCR amplification experiments to identify positive plants.
[0077] (5) Identification of transgenic Arabidopsis thaliana
[0078] The above-mentioned transgenic Arabidopsis thaliana was screened for multiple generations using hygromycin (30 mg / mL) to obtain the T3 generation transgenic Arabidopsis thaliana lines. Genomic DNA was then extracted and confirmed by PCR amplification and electrophoresis experiments. SgIMP1The gene has been integrated into the Arabidopsis genome. pCXSN The universal primers for the vector were used as identification primers, with Arabidopsis housekeeping genes as the primary target. AtEF 1α This is an internal reference gene; the specific primer sequences are shown below:
[0079] pCXSN-F: CGAATCTCAAGCAATCAAGCAT (SEQ ID NO: 15);
[0080] pCXSN-R: TCATCGCAAGACCGGCAAC (SEQ ID NO: 16);
[0081] AtEF-1α F: GTCGATTCTGGAAAGTCGACC (SEQ ID NO: 17);
[0082] AtEF-1α-R: AATGTCAATGGTGATACCACGC (SEQ ID NO: 18).
[0083] PCR and electrophoresis identification results are as follows Figure 7 As shown in the figure (WT represents the wild-type strain, and OE1 and OE2 represent two different overexpression lines), SgIMP1 Transgenic Arabidopsis thaliana plant lines AtEF-1α (This is an Arabidopsis thaliana internal reference gene). Compared with WT, both OE1 and OE2 can amplify genes containing this gene. SgIMP1 The specific bands of the gene indicate that these strains all carry the gene. SgIMP1 Genes; Arabidopsis housekeeping genes were amplified in WT, OE1, and OE2. AtEF 1α The fragments indicate that the genomic DNA extraction from each sample was reliable.
[0084] Example 6 Heterologous Overexpression SgIMP1 Increase phosphatase activity in transgenic Arabidopsis thaliana
[0085] The experimental steps for determining phosphatase activity are as follows:
[0086] 1. Sample extraction
[0087] Weigh 0.02 g of fresh Arabidopsis thaliana sample, add 0.2 mL of pre-cooled 50 mM Tris-HCl (BL514B, Biosharp) buffer (pH=7.0), grind thoroughly into a homogenate, centrifuge at 14000 rpm for 20 min at 4℃, and the supernatant is the sample extract (supernatant containing phosphatase).
[0088] 2. Standard Curve Creation
[0089] Dissolve 1 mM 4-nitrophenol in 50 mM Tris-HCl buffer (pH=7.0). p The standard solution (NP)(241326, Sigma-Aldrich) was diluted sequentially to concentrations of 0, 0.03, 0.06, 0.09, 0.12, 0.15, 0.18, 0.25, 0.3, 0.35, 0.4, and 0.5 mM, with a volume of 800 µL. The reaction was carried out at 37°C for 15 min, and then terminated by adding 800 µL of 0.5 M NaOH (A620617, Sangon Biotech). 405 The absorbance was measured and plotted on the x-axis. p A standard curve was plotted with NP concentration on the ordinate. Linear regression analysis was used to fit the data, yielding the equation for the standard curve.
[0090] 3. Sample determination
[0091] Prepare a solution containing 4 mM cyclohexyl p-nitrophenylphosphate using 50 mM Tris-HCl buffer (pH=7.0). p NPP (N3129, Sigma-Aldrich) substrate reaction solution. Add to 400 µL p After adding 20 µL of sample extraction buffer to the NPP substrate reaction solution, bring the total volume to 800 µL using 50 mM Tris-HCl buffer (pH=7.0). p The NPP substrate concentration was set to a final concentration of 2 mM. After reacting at 37°C for 15 min, the reaction was terminated by adding 800 µL of 0.5 M NaOH. At OD... 405 The absorbance was measured at nm, and the enzyme catalytic activity was calculated based on the standard curve equation. p NPP releases p The amount of NP substance.
[0092] 4. Sample protein concentration determination
[0093] The protein content in the sample was then determined using a total protein (TP) assay kit (A045-2-2, Nanjing Jiancheng).
[0094] 5. Enzyme activity calculation
[0095] Phosphatase activity can be calculated using the following formula:
[0096]
[0097] Phosphatase activity was measured in U per milligram of protein (U·mg). -1 The expression (protein) is represented by U, where U is the enzyme activity unit, and 1 U represents the release of 1 µmol of enzyme per minute.p NP.
[0098] Phosphatase activity results of different strains are as follows Figure 8 As shown in the figure (WT represents the wild type, and OE1 and OE2 are two transgenic Arabidopsis lines; the data in the figure are the mean ± standard error of three biological replicates, and the asterisk indicates that there is a significant difference between WT and OE1, OE2 (Student's t test), 0.001 ≤ P <0.01), heterologous overexpression SgIMP1 The transgenic lines OE1 and OE2 significantly increased the phosphatase activity of plants compared with WT, with transgenic lines OE1 and OE2 increasing by 83.84% and 92.93% respectively compared with WT.
[0099] Example 7 Heterologous Overexpression SgIMP1 Increasing the inositol content of transgenic Arabidopsis thaliana
[0100] Inositol content was determined using high-performance liquid chromatography (HPLC), and the experimental steps are as follows:
[0101] 1. Sample pretreatment
[0102] Take about 60 mg of Arabidopsis thaliana sample and place it in a stoppered conical flask. Accurately add 500 μL of 80% ethanol. Weigh the sample and sonicate it (power 250 W, frequency 25 kHz) for 30 min. Let it cool and weigh it again. Use 80% ethanol to make up the weight loss. Filter the sample and filter the filtrate through a 0.45 μm filter membrane to obtain the sample solution.
[0103] 2. Liquid Chromatography Conditions
[0104] The instrument used in this experiment was a Waters 2695 high-performance liquid chromatograph equipped with a Waters 2424 evaporative light detector. Column temperature: 35°C; flow rate: 1.0 mL / min; injection volume: 20 μL; column: ChromCore NH2, 5 μm, 4.6 250 mm; Mobile phase A: water; Mobile phase B: acetonitrile; Elution method: 80% B isocratic elution, elution time 35 min; Evaporation photodetector parameters: drift tube temperature 80℃, nebulizer 50%, gas 25 psi, gain 100.
[0105] Results of inositol content in different strains are as follows Figure 9As shown in the figure (WT represents the wild type, and OE1 and OE2 are two transgenic Arabidopsis lines); the data in the figure are the mean ± standard error of three biological replicates, and the asterisk indicates that there is a significant difference between the wild type WT and the transgenic Arabidopsis lines OE1 and OE2 (Student's t test), 0.01 ≤ P <0.05, 0.001 ≤ P <0.01), heterologous overexpression SgIMP1 The inositol content of the transgenic lines OE1 and OE2 was significantly higher than that of WT, increasing by 37.50% and 41.67% respectively.
[0106] Example 8 Heterologous Overexpression SgIMP1 Improving the tolerance of transgenic Arabidopsis to low phosphorus stress
[0107] 1. Pot experiment of transgenic Arabidopsis thaliana
[0108] Appropriate amounts of wild-type (WT) and transgenic Arabidopsis thaliana (OE1, OE2) seeds were placed in 1.5 mL centrifuge tubes, 1 mL of sterile water was added, and the tubes were placed in the dark for vernalization at 4°C for 2 days. Afterward, the seeds were sown in nutrient soil (nutrient soil: vermiculite = 1:1) for pre-culture for about one week. Seedlings with uniform growth were selected and transplanted to a nutrient-free substrate (nutrient-free soil: vermiculite = 1:1) for pot experiments. Two treatment groups were set up in the pot experiments: the normal phosphorus treatment was watered every two days with a 1 / 2 MS nutrient solution of 300 μmol / L KH2PO4 (pH=5.8); the low phosphorus treatment was watered every two days with a 1 / 2 MS nutrient solution of 10 μmol / L KH2PO4. After 18 days of treatment, aboveground samples were collected from each line for subsequent analysis.
[0109] 2. Determination of dry weight and total phosphorus content of transgenic Arabidopsis thaliana
[0110] After harvesting the above-mentioned transgenic Arabidopsis thaliana aerial samples, they were placed in an oven at 105°C for 15 minutes to kill the green, and then the oven temperature was adjusted to 65°C to dry to constant weight. After cooling, the dry weight was measured.
[0111] The phosphorus concentration of the sample was determined using the phosphomolybdic blue colorimetric method. The procedure was as follows: 0.002 g of dry sample was weighed into an ashing bottle, and a mixture of ethanol and concentrated sulfuric acid (95:5 volume ratio) was added to moisten the sample. The sample was carbonized on an electric furnace until no smoke was observed. Then, the sample was transferred to a muffle furnace and ashed at 600℃ for 8 h until it turned grayish-white. 500 μL of 100 mM HCl was added and shaken well. The sample was left to stand for 24 h (during which time the crucible was gently shaken several times to ensure complete dissolution). 300 μL of the supernatant from the ashing bottle was then transferred to a 1.5 mL centrifuge tube for later use. Finally, the phosphorus concentration of the sample was determined using a phosphorus assay kit (C006-1-1, Nanjing Jiancheng). The phosphorus content was calculated from the dry weight and phosphorus concentration (total phosphorus content of aerial parts (mg / plant) = phosphorus concentration (mg / g dry sample) × dry weight of aerial parts (g)).
[0112] The results are as follows Figure 10 As shown ( Figure 10 A: Plant growth phenotype; Figure 10 B: Dry weight of the above-ground parts; Figure 10 C: Aboveground phosphorus content. WT represents the wild type, and OE1 and OE2 are two transgenic Arabidopsis lines; the data in the figure are the mean ± standard error of three biological replicates, and the asterisk indicates a significant difference between wild-type WT and transgenic Arabidopsis lines OE1 and OE2 (Student's t test), 0.01 ≤ P <0.05, 0.001 ≤ P <0.01). Under low phosphorus treatment conditions, heterologous expression compared to WT... SgIMP1 The aboveground dry weight of transgenic Arabidopsis thaliana (OE1 and OE2) increased by 74.60% and 85.71%, respectively, and the aboveground phosphorus content increased by 57.97% and 69.57%, respectively. Similar results were observed under normal phosphorus treatment; compared to WT, the aboveground dry weight of OE1 and OE2 increased by 36.23% and 41.40%, respectively, and the aboveground phosphorus content increased by 33.71% and 38.68%, respectively. The increases under low phosphorus treatment were significantly higher than those under normal phosphorus treatment. These results indicate that heterologous overexpression of Stylosanthes stylosanthes... SgIMP1 The gene increased the biomass and phosphorus content of transgenic Arabidopsis thaliana, especially under low phosphorus stress, confirming that... SgIMP1 The gene can enhance the adaptation of transgenic plants (Arabidopsis thaliana) to low phosphorus stress, that is, it can enhance the tolerance of transgenic Arabidopsis thaliana to low phosphorus stress.
[0113] Example 9 Heterologous Overexpression SgIMP1 Improving the tolerance of transgenic Arabidopsis to aluminum toxicity stress
[0114] Plate culture experiment of transgenic Arabidopsis thaliana
[0115] First, wild-type (WT) and transgenic Arabidopsis thaliana (OE1, OE2) seeds were vernalized at 4℃. Then, the seeds were sterilized in a clean bench: twice with sterile water, three times with 70% ethanol, soaked in 3% NaClO for 1 min, and eight times with sterile water. Finally, they were spread evenly on substrates containing (+Al, aluminum toxicity treatment) or without 250 μM AlCl3 (… Al (control treatment) was cultured on 1 / 6 MS medium under the following conditions: 22±1℃, 16 h light / 8 h dark.
[0116] The specific culture medium formula is as follows: Macroelements: 316.67 mg / L 1 KNO3, 550 mg / L 1 NH4NO3, 123.33 mg / L 1 MgSO4·7H2O, 73.33 mg / L 1 CaCl2·2H2O; Trace elements: 0.14 mg / L 1 KI, 1.03 mg / L 1 H3BO3, 3.72 mg / L 1 MnSO4·4H2O, 1.43 mg / L 1 ZnSO4·7H2O, 0.04 mg / L 1 Na₂MoO₄·2H₂O, 0.004 mg / L 1 CuSO4·5H2O, 0.004 mg / L 1 CoCl2; Iron salt: 6.22 mg / L 1 Fe-EDTA (chemical reagents for both macro- and micro-elements were purchased from Shanghai Yuanye Biotechnology Co., Ltd.); Inorganic phosphorus source: 28.33 mg / L 1 KH2PO4 (S24278, source leaf); Vitamin: 1.67 mg L 1 VB1 (V675378, Maklin), 0.17 mg L 1VB5 (P275366, Aladdin), 0.17 mg L 1 VB6 (V8030, Solarbio), containing 1% (w / v) sucrose (R015039, Ron), was used to adjust the pH to 4.3 and solidified with 1% (w / v) agar. Phenotypic photography, fresh weight measurement, and taproot length determination were performed after 10 days of culture.
[0117] The results are as follows Figure 11 As shown ( Figure 11 A: Wild-type Arabidopsis thaliana (WT) treated with +Al (aluminum poisoning) and SgIMP1 Phenotypic diagrams of transgenic Arabidopsis thaliana (OE1, OE2); Figure 11 B: Under +Al (aluminum toxicity) treatment, wild Arabidopsis thaliana and SgIMP1 Length of the taproot in transgenic Arabidopsis thaliana; Figure 11 C: Wild-type Arabidopsis thaliana treated with +Al (aluminum poisoning) and SgIMP1 Fresh weight of super-transgenic Arabidopsis thaliana; Figure 11 D: In Wild-type Arabidopsis thaliana under Al (control) treatment and SgIMP1 Phenotypic diagram of transgenic Arabidopsis thaliana; Figure 11 E: In Under Al (control) treatment, wild-type Arabidopsis thaliana and SgIMP1 Length of the taproot in transgenic Arabidopsis thaliana; Figure 11 F: In Wild-type Arabidopsis thaliana under Al (control) treatment and SgIMP1 Fresh weight of transgenic Arabidopsis thaliana. One-way ANOVA was used to analyze differences; different lowercase letters indicate significant differences. P <0.05).
[0118] from Figure 11 As can be seen from A, under the +Al treatment conditions... SgIMP1 The transgenic Arabidopsis thaliana (OE1, OE2) lines exhibited superior growth phenotypes compared to wild-type Arabidopsis thaliana (WT); from Figure 11 As can be seen from B, the taproot lengths of OE1 and OE2 are 84.76% and 92.30% longer than those of WT, respectively. From... Figure 11 As can be seen from C, the fresh weight of OE1 and OE2 is 55.49% and 47.93% higher than that of WT, respectively. From Figure 11 D、 Figure 11 E and Figure 11 F shows that, Under Al (control) treatment, SgIMP1 The transgenic Arabidopsis lines showed no significant differences in phenotype, fresh weight, and taproot length compared to the WT lines. These results indicate that heterologous expression... SgIMP1It significantly improved the tolerance of transgenic Arabidopsis to aluminum toxicity stress.
[0119] In summary, the present invention discloses... SgIMP1 Genes can improve the plant's tolerance to the dual stresses of low phosphorus and aluminum toxicity by regulating inositol synthesis and phosphatase activity, providing high-quality genetic resources and clear application directions for the genetic improvement of crop stress resistance.
[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A gene for inositol monophosphatase in *Styrax chinensis* that enhances plant tolerance to aluminum toxicity and low phosphorus stress. SgIMP1 Its characteristics are, The SgIMP1 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The *Styrax chinensis* inositol monophosphatase gene according to claim 1, which can enhance plant resistance to aluminum toxicity and low phosphorus stress. SgIMP1 Its characteristics are, The SgIMP1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO:
2.
3. The *Styrax chinensis* inositol monophosphatase gene described in claim 1, which can enhance plant resistance to aluminum toxicity and low phosphorus stress. SgIMP1 Its application in improving resistance to aluminum toxicity and low phosphorus stress is characterized by... The method to improve resistance to aluminum toxicity and low phosphorus stress is to overexpress the aforementioned [specific ingredient] in Arabidopsis thaliana. SgIMP1 Gene.
4. The application according to claim 3, characterized in that, Overexpression of the above in Arabidopsis thaliana SgIMP1 The gene-based approach involves constructing overexpression structures using transgenic technology. SgIMP1 A recombinant plant expression vector was used, and then the recombinant plant expression vector was transferred into Arabidopsis thaliana via Agrobacterium-mediated transformation to increase the plant's inositol content and phosphatase activity, thereby enabling the plant to acquire... SgIMP1 The gene and the protein it encodes possess the functions of aluminum toxicity resistance and low phosphorus stress resistance.