Lung organoid culture medium and uses thereof

By preparing a culture medium for lung organoids from adult rodent stem cells, a model capable of simulating viral infection in its natural host was constructed. This addresses the shortcomings of existing viral infection research models and enables efficient drug screening and research into viral pathogenesis mechanisms.

CN122146586APending Publication Date: 2026-06-05BIOGENOUS BIOTECH INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610163240.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing cell and animal models for hantavirus infection research cannot effectively simulate human physiological conditions and gene expression differences. The lack of suitable viral infection research models limits the effectiveness of drug screening and evaluation.

Method used

By preparing a culture medium for lung organoids from adult rodent stem cells, including basal medium, G27, hEGF, BMP inhibitor, ROCK inhibitor, L-glutamine, HEPES, antibiotics, and other components, a lung organoid viral infection model that can simulate the infection of the natural host of the virus was constructed.

Benefits of technology

It provides a reproducible and standardized viral infection model that can be used for research on viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, and drug development, simulating the infection of viruses in natural hosts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides a lung organ culture medium and application thereof, and particularly, the culture medium comprises a basic culture medium, G27, hEGF, a BMP inhibitor, a ROCK inhibitor, L-glutamine, HEPES, an antibiotic, and at least one selected from the group consisting of nicotinamide, a Wnt agonist, N-acetylcysteine and a TGF-beta inhibitor. The lung organ and the virus infection model thereof cultured by the culture medium are a good-repeatability and standardized infection model, can fully simulate the virus infection condition of a natural virus host, and are suitable for research on a virus pathogenesis, high-throughput screening of antiviral drugs, toxicity evaluation and drug research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and cell engineering technology. Specifically, this invention relates to lung organoid culture medium and its application. More specifically, this invention relates to a culture medium and its use, a method for preparing lung organoids, lung organoids, a method for constructing a lung organoid virus infection model, and a lung organoid virus infection model. Background Technology

[0002] Hantavirus (HV) belongs to the order Bunyavirales, family Hantaviridae, and genus Orthohantavirus. HV is an enveloped, single-stranded, negative-sense RNA virus. The virus particles are round or oval, with a diameter of approximately 80-120 nm. The viral genome consists of three segments: large (L), middle (M), and small (S). The L segment, approximately 6.3 kb to 6.5 kb in length, encodes the viral RNA-dependent RNA polymerase (RdRP). The M segment, approximately 3.6 kb to 3.7 kb in length, encodes the viral glycoprotein precursor (GPC), which is further processed to produce the transmembrane glycoproteins N (GN) and C (GC). The S segment, 1.6–2.0 kb in length, encodes the viral nucleocapsid protein (NP). Hantavirus infection can cause hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary syndrome (HPS). In Asia, Hantaan virus (HTNV) and Seoul virus (SEOV) are the predominant strains.

[0003] Organoids are cell clusters derived from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or adult stem cells (ASCs) from primary tissues, cultured in vitro in three dimensions. They possess self-renewal and self-organizing capabilities, and their structure and function are highly similar to the source tissues or organs. By replicating their in vivo growth microenvironment, stem cells can proliferate, differentiate, and self-assemble in vitro, producing cell types and structures similar to primary tissues. The high biomimicry of organoids has led to their widespread application in disease model development, drug screening, and regenerative medicine research.

[0004] Currently, basic research on related diseases is primarily based on cell and animal models. Traditional cell lines, with their limited cell types, lack interaction and physiological correlation between different lineages and cannot capture key host-virus interactions, often resulting in experimental results that do not reflect real-world conditions. Animal models, on the other hand, are difficult to humanize, and many genes exhibit expression differences across species, limiting their applicability. Furthermore, there are currently no suitable animal models available. Therefore, further research is needed to develop a hantavirus infection research model to provide a better system for virological research and drug screening and evaluation. Summary of the Invention

[0005] This application is based on the inventor's discoveries and understanding of the following facts and problems: Brown rats and yellow-breasted rats, as the most widely distributed rodents, are also important natural hosts of hantavirus. Organoids bridge the gap between 2D cell culture and animal models by providing a culturable system, allowing manipulation of cell cultures and better mimicking in vivo cellularity and physiology. This invention, through extensive creative work, screened a culture medium for constructing a viral infection model of lung organoids from adult stem cells derived from rodents. Unexpectedly, it was discovered that this model can be applied to antiviral drug screening and drug efficacy testing, which has significant scientific value.

[0006] Therefore, in a first aspect, the present invention provides a culture medium. According to embodiments of the present invention, the culture medium comprises: a basal medium, G27, hEGF, a BMP inhibitor, a ROCK inhibitor, L-glutamine, HEPES, an antibiotic; and at least one selected from nicotinamide, a Wnt agonist, N-acetylcysteine, and a TGF-β inhibitor. The culture medium proposed in this invention can be used for the culture of lung organoids, providing basic nutrition and survival support for lung organoid culture, maintaining stem cell characteristics and promoting proliferation, as well as guiding directed differentiation and spatial organization.

[0007] According to an embodiment of the present invention, the culture medium includes basal culture medium, hEGF, BMP inhibitor, TGF-β inhibitor, ROCK inhibitor, G27, L-glutamine, HEPES, and antibiotics.

[0008] According to an embodiment of the present invention, the culture medium includes basal culture medium, hEGF, BMP inhibitor, ROCK inhibitor, Wnt agonist, nicotinamide, G27, L-glutamine, HEPES, and antibiotics.

[0009] According to an embodiment of the present invention, the basal culture medium is Advanced DMEM / F12.

[0010] According to an embodiment of the present invention, the culture medium further comprises at least one of the following features: the Wnt agonist comprises at least one of Want-3a and R-Spondin 1; the BMP inhibitor is Noggin; the TGF-β inhibitor is A83-01; the ROCK inhibitor is Y-27632; and the antibiotic comprises at least one of penicillin and streptomycin.

[0011] According to embodiments of the present invention, the final concentration of G27 in the culture medium is 1×; and / or the final concentration of hEGF in the culture medium is 20 ng / mL to 80 ng / mL; and / or the final concentration of N-acetylcysteine ​​in the culture medium is 0.2 mM to 4 mM; and / or the final concentration of nicotinamide in the culture medium is 2 mM to 20 mM; and / or the final concentration of L-glutamine in the culture medium is 0.2 mM to 10 mM; and / or the final concentration of HEPES in the culture medium is 1 mM to 35 mM; and / or the final concentration of the antibiotic in the culture medium is 20 μg / mL to 300 μg / mL; and / or the final concentration of the Wnt agonist in the culture medium is 120 ng / mL to 1100 ng / mL; and / or the final concentration of the BMP inhibitor in the culture medium is 20 ng / mL to 300 ng / mL; and / or the final concentration of the TGF-β inhibitor in the culture medium is 200 ng / mL. nM~800 nM; and / or the final concentration of the ROCK inhibitor in the culture medium is 0.5 μM~20 μM.

[0012] According to embodiments of the present invention, the final concentration of hEGF in the culture medium is 30 ng / mL to 70 ng / mL; and / or the final concentration of N-acetylcysteine ​​in the culture medium is 0.5 mM to 2 mM; and / or the final concentration of nicotinamide in the culture medium is 5 mM to 15 mM; and / or the final concentration of L-glutamine in the culture medium is 1 mM to 5 mM; and / or the final concentration of HEPES in the culture medium is 5 mM to 25 mM; and / or the final concentration of the antibiotic in the culture medium is 60 μg / mL to 200 μg / mL; and / or the final concentration of Want-3a in the culture medium is 60 ng / mL to 200 ng / mL; and / or the final concentration of Noggin in the culture medium is 200 ng / mL to 700 ng / mL; and / or the final concentration of the BMP inhibitor in the culture medium is 60 ng / mL to 200 μg / mL. ng / mL; and / or the final concentration of the TGF-β inhibitor in the culture medium is 350 nM to 700 nM; and / or the final concentration of the ROCK inhibitor in the culture medium is 1 μM to 15 μM.

[0013] In a second aspect, the present invention provides the use of the aforementioned culture medium in lung organoid culture. Lung organoids cultured using the culture medium provided by the present invention are stable and can provide a reproducible and standardized infection model for viral infection.

[0014] In a third aspect, the present invention provides a method for preparing lung organoids, comprising: performing a first homogenization treatment on adult stem cells and matrix gel; and performing a first culture treatment on the product of the first homogenization treatment in the aforementioned culture medium. The lung organoids obtained by the preparation method proposed according to the present invention are a highly reproducible and standardized infection model, which can be used for disease model establishment, drug screening, regenerative medicine research, etc.

[0015] According to an embodiment of the present invention, the volume of the matrix adhesive accounts for not less than 70% of the volume of the first homogenized product.

[0016] According to an embodiment of the present invention, the method further includes subculturing the first culture product.

[0017] According to an embodiment of the present invention, the adult stem cells are derived from the lung tissue of rodents; the rodents include brown rats, yellow-breasted rats, black rats, house mice, striped field mice, deer mice, and field mice.

[0018] According to embodiments of the present invention, the rodents include brown rats and yellow-breasted rats.

[0019] According to an embodiment of the present invention, the subculturing process includes dissociating the first culture product using at least one of mechanical dissociation, enzymatic dissociation, and chemical dissociation; and subjecting the dissociated product to a second culture treatment.

[0020] According to an embodiment of the present invention, the subculturing process includes dissociating the first culture treatment using a mechanical dissociation method.

[0021] In a fourth aspect, the present invention provides a lung organoid prepared by the method described above. The lung organoid proposed in this invention is a reproducible and standardized infection model that can be used for disease model establishment, drug screening, regenerative medicine research, and other fields.

[0022] In a fifth aspect, the present invention proposes a method for constructing a lung organoid virus infection model, comprising: co-culturing the aforementioned lung organoids and viral infection fluid in the aforementioned culture medium. The viral infection model constructed according to the method proposed in this invention can fully simulate the viral infection situation in the natural host of the virus, providing a powerful tool for the study of viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, toxicity evaluation, and drug development.

[0023] According to an embodiment of the present invention, the virus is Hantavirus; the virus includes one of Hantavirus, Seoul virus, Dobrava virus, Pumara virus, Andean virus, and Sinopharm virus.

[0024] According to an embodiment of the present invention, the virus is Hantan virus; the infection ratio of the virus to the lung organoids is MOI=1.

[0025] In a sixth aspect, this invention proposes a lung organoid virus infection model, prepared by the methods described above. The lung organoid virus infection model proposed in this invention can fully simulate the viral infection situation in the natural host of the virus, providing a powerful tool for the study of viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, toxicity evaluation, and drug development.

[0026] The beneficial effects of this invention are at least as follows: The culture medium proposed in this invention can be used for the culture of lung organoids, providing basic nutrition and survival support, maintaining stem cell characteristics, promoting proliferation, and guiding directed differentiation and spatial organization. The lung organoids and their viral infection model obtained from the culture medium are a reproducible and standardized infection model that can fully simulate the viral infection situation in the natural host of the virus. It is suitable for research on viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, toxicity evaluation, and drug development. Attached Figure Description

[0027] Figure 1 This is a graph showing the test results of the lung organoid culture medium composition of yellow-breasted rats and brown rats according to an embodiment of the present invention, wherein... Figure 1 A represents the test results of the culture medium composition of yellow-breasted rat lung organoids; Figure 1 B represents the results of the composition test of the culture medium for brown rat lung organoids.

[0028] Figure 2 This is a diagram showing the results of stable passage of lung organoids in yellow-breasted rats and brown rats according to embodiments of the present invention, wherein... Figure 2 A represents the results of continuous and stable passage of lung organoids from yellow-breasted rats; Figure 2 B represents the results of continuous and stable passage of lung organoids from brown rats.

[0029] Figure 3 These are images showing the results of lung organoid cell type identification in yellow-breasted rats and brown rats according to embodiments of the present invention. Figure 3 A represents the cell type identification result of lung organoids from yellow-breasted rats; Figure 3 B represents the cell type identification result of the lung organoids of brown rats.

[0030] Figure 4 This is a graph showing the detection results of viral copy number at different time points after lung organoids of yellow-breasted rats and brown rats were infected with HTNV virus, according to an embodiment of the present invention. Figure 4 A represents the result of detecting the intracellular viral copy number in the lung organoids of yellow-breasted rats after infection with HTNV virus; Figure 4 B represents the result of viral copy number detection in the supernatant culture medium after yellow-breasted rat lung organoids were infected with HTNV virus; Figure 4 C represents the result of detecting the intracellular viral copy number after infection of brown rat lung organoids with HTNV virus; Figure 4 D represents the result of detecting the viral copy number in the supernatant culture medium after brown rat lung organoids were infected with HTNV virus.

[0031] Figure 5 This image shows the results of immunofluorescence staining of lung organoids from yellow-breasted rats and brown rats infected with the N protein of HTNV virus.

[0032] Figure 6 This is a graph showing the cytotoxicity analysis results of lung organoids from brown rats and yellow-breasted rats against the HTNV virus drugs ribavirin, favipiravir, and baloravir, according to embodiments of the present invention. Figure 6 A is an analysis of the cytotoxicity of ribavirin on lung organoids of yellow-breasted rats; Figure 6 B is an analysis of the cytotoxicity of ribavirin to the lung organoids of brown rats; Figure 6 C represents the cytotoxicity analysis of Barolave's lung organoids in yellow-breasted rats; Figure 6 D is the analysis of the cytotoxicity of Barolave's lung organoids in brown rats; Figure 6 E represents the analysis of the cytotoxicity of favipiravir on lung organoids of yellow-breasted rats; Figure 6 F represents the analysis of the cytotoxicity of favipiravir on the lung organoids of brown rats.

[0033] Figure 7 This is an analytical result graph showing the antiviral efficacy test of lung organoids from brown rats and yellow-breasted rats against the HTNV virus drugs ribavirin, favipiravir, and palolavir, according to embodiments of the present invention. Figure 7 A is a test of the antiviral efficacy of ribavirin on lung organoids of yellow-breasted rats; Figure 7B is a test of the antiviral efficacy of ribavirin against the lung organoids of brown rats; Figure 7 C represents the antiviral efficacy test of Barolawie on lung organoids of yellow-breasted rats; Figure 7 D represents the antiviral efficacy test of Barolawie on the lung organoids of brown rats; Figure 7 E represents the antiviral efficacy test of favipiravir on lung organoids of yellow-breasted rats; Figure 7 F represents the antiviral efficacy test of favipiravir on the lung organoids of brown rats.

[0034] Figure 8 The graph shows the test results of G27 and B27 in the lung organoid culture medium components of yellow-breasted rats and brown rats according to an embodiment of the present invention. Detailed Implementation

[0035] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0036] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0037] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0038] To facilitate understanding of this invention, certain technical and scientific terms are specifically explained and described below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. These explanations and descriptions are provided solely for the purpose of facilitating understanding and should not be construed as limiting the scope of protection of this invention.

[0039] In this article, the term "organoid" refers to tissue analogs formed by in vitro three-dimensional culture of adult stem cells or pluripotent stem cells, which can simulate real organs in terms of structure and function.

[0040] In this article, the term "multiple of infection" or "MOI" refers to the ratio of the number of viruses capable of infecting cells to the total number of cells in a system.

[0041] In this article, the term "abortion" refers to the loss of connection between cells and neighboring cells and the extracellular matrix when cells are digested from tissues or organoids are mechanically or enzymatically passaged; "abortion apoptosis" refers to the drastic contraction and tension imbalance of the cytoskeleton, which ultimately activates the apoptosis program.

[0042] The technical solution of this application will be described in detail below.

[0043] Culture media and their uses In some embodiments of the present invention, a culture medium is provided. According to embodiments of the present invention, the culture medium comprises: basal medium, G27, hEGF, BMP inhibitor, ROCK inhibitor, L-glutamine, HEPES, antibiotic; and at least one selected from nicotinamide, Wnt agonist, N-acetylcysteine, and TGF-β inhibitor.

[0044] According to embodiments of the present invention, the culture medium includes basal culture medium, hEGF, BMP inhibitor, TGF-β inhibitor and ROCK inhibitor; and at least one selected from G27, N-acetylcysteine, nicotinamide, L-glutamine, HEPES, antibiotics and Wnt agonists.

[0045] According to embodiments of the present invention, the culture medium comprises basal culture medium, hEGF, nicotinamide, Wnt agonist, BMP inhibitor, ROCK inhibitor; and at least one selected from G27, N-acetylcysteine, TGF-β inhibitor, L-glutamine, HEPES and antibiotics.

[0046] According to an embodiment of the present invention, the culture medium comprises basal medium, hEGF, BMP inhibitor, TGF-β inhibitor, ROCK inhibitor, G27, L-glutamine, HEPES, and antibiotics. The culture medium provides the necessary nutrients and survival support for the lung organoids of yellow-breasted rats.

[0047] According to an embodiment of the present invention, the culture medium comprises basal medium, hEGF, BMP inhibitor, ROCK inhibitor, Wnt agonist, nicotinamide, G27, L-glutamine, HEPES, and antibiotics. The culture medium provides the necessary nutrients and survival support for the lung organoids of brown rats.

[0048] The basal culture medium is Advanced DMEM / F12; the culture medium further includes at least one of the following characteristics: the Wnt agonist includes at least one of Want-3a and R-Spondin 1; the BMP inhibitor is Noggin; the TGF-β inhibitor is A83-01; the ROCK inhibitor is Y-27632; and the antibiotic includes at least one of penicillin and streptomycin. The culture medium proposed in this invention can be used for the culture of lung organoids, providing basic nutrition and survival support for lung organoid culture, maintaining stem cell characteristics and promoting proliferation, as well as guiding directed differentiation and spatial organization.

[0049] The basal culture medium provides a nutritionally complete, stable, and 3D-supporting environment for organoid culture. G27 promotes cell development and maturation and enhances the overall viability of organoids. hEGF (human epidermal growth factor) drives cell proliferation, maintains stem cell activity, and promotes survival in organoid culture, providing the fundamental guarantee for the successful establishment and long-term expansion of organoids in vitro. N-acetylcysteine ​​has antioxidant and cell proliferation-promoting effects in organoids. Nicotinamide maintains stem cell viability, promotes proliferation, and regulates metabolism. L-glutamine provides carbon, nitrogen, and energy sources in organoid culture, participates in nucleotide and protein synthesis, and promotes cell proliferation. HEPES is a potent pH buffer used to maintain the stability of the culture medium pH, ensuring an extremely stable physicochemical environment and providing a fundamental guarantee for the effective operation of all the aforementioned growth factors, nutrients, and additives. The antibiotic provides broad-spectrum prevention against bacterial contamination.

[0050] The signaling additives can mimic the microenvironment for in vivo development and homeostasis maintenance, guiding stem cells or progenitor cells to self-organize into microorganisms with specific structures and functions. According to embodiments of the present invention, the Wnt agonist Want-3a and R-Spondin 1 can synergistically maintain stem cell self-renewal and long-term organoid growth by activating the Wnt / β-catenin signaling pathway; the BMP inhibitor Noggin, in organoid culture medium, inhibits the BMP signaling pathway, maintaining stem cell characteristics and promoting organoid formation and long-term expansion; the TGF-β inhibitor A83-01 is a selective TGF-β type I receptor (ALK4 / 5 / 7) small molecule inhibitor that blocks TGF-β / Smad2 / 3 signaling in organoid culture medium, maintaining the proliferation and undifferentiated state of stem cells or progenitor cells; the ROCK inhibitor Y-27632 inhibits ROCK activity, preventing phosphorylation of myosin light chains, thus relaxing the cytoskeleton, reducing cell tension, inhibiting apoptosis triggered by anodic apoptosis, and significantly improving cell survival. The signaling additives described above work synergistically with the previously mentioned components to provide basic nutrition and survival support for the culture of lung organoids.

[0051] According to embodiments of the present invention, the G27 comprises antioxidants (vitamin E, glutathione, and superoxide dismutase), growth factors and hormones (BDNF, bFGF), vitamins (excluding vitamin A), and fatty acids required by neurons. The G27 can promote cell development and maturation in organoid culture and enhance the overall vitality of organoids. Compared to traditional B27, the G27 retains the advantages of traditional B27 additives while further improving the cell culture effect through customized nutritional components. It precisely simulates the in vivo tissue cell growth environment, helping to maintain the normal growth and development of organoids and cells in vitro.

[0052] According to an embodiment of the present invention, the final concentration of G27 in the culture medium is 1×.

[0053] According to embodiments of the present invention, the final concentration of hEGF in the culture medium is 20 ng / mL to 80 ng / mL. Exemplarily, the final concentration of hEGF in the culture medium is 20 ng / mL, 30 ng / mL, 40 ng / mL, 50 ng / mL, 60 ng / mL, 70 ng / mL, 80 ng / mL, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of hEGF in the culture medium is preferably 30 ng / mL to 70 ng / mL, and more preferably 40 ng / mL to 60 ng / mL.

[0054] According to embodiments of the present invention, the final concentration of N-acetylcysteine ​​in the culture medium is 0.2 mM to 4 mM. Exemplarily, the final concentration of N-acetylcysteine ​​in the culture medium is 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of N-acetylcysteine ​​in the culture medium is preferably 0.5 mM to 2 mM, more preferably 0.8 mM to 1.5 mM.

[0055] According to embodiments of the present invention, the final concentration of the nicotinamide in the culture medium is 2 mM to 20 mM. Exemplarily, the final concentration of the nicotinamide in the culture medium is 2 mM, 5 mM, 8 mM, 10 mM, 12 mM, 14 mM, 16 mM, 18 mM, 20 mM, or any range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of the nicotinamide in the culture medium is preferably 5 mM to 15 mM, more preferably 8 mM to 12 mM.

[0056] According to embodiments of the present invention, the final concentration of L-glutamine in the culture medium is 0.2 mM to 10 mM. Exemplarily, the final concentration of L-glutamine in the culture medium is 0.2 mM, 0.5 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of L-glutamine in the culture medium is preferably 1 mM to 5 mM, more preferably 1.5 mM to 3.5 mM.

[0057] According to embodiments of the present invention, the final concentration of HEPES in the culture medium is 1 mM to 35 mM. Exemplarily, the final concentration of HEPES in the culture medium is 1 mM, 5 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, or any range between two of the above values. According to some preferred embodiments of the present invention, the final concentration of HEPES in the culture medium is preferably 5 mM to 25 mM, more preferably 10 mM to 20 mM.

[0058] According to embodiments of the present invention, the final concentration of the antibiotic in the culture medium is 20 μg / mL to 300 μg / mL. Exemplarily, the final concentration of the antibiotic in the culture medium is 20 μg / mL, 40 μg / mL, 60 μg / mL, 80 μg / mL, 100 μg / mL, 120 μg / mL, 140 μg / mL, 160 μg / mL, 180 μg / mL, 200 μg / mL, 250 μg / mL, 300 μg / mL, or any range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of the antibiotic in the culture medium is preferably 60 μg / mL to 200 μg / mL, more preferably 80 μg / mL to 120 μg / mL.

[0059] According to embodiments of the present invention, the final concentration of Want-3a in the culture medium is 20 ng / mL to 300 ng / mL. Exemplarily, the final concentration of Want-3a in the culture medium is 20 ng / mL, 40 ng / mL, 60 ng / mL, 80 ng / mL, 100 ng / mL, 120 ng / mL, 140 ng / mL, 160 ng / mL, 180 ng / mL, 200 ng / mL, 250 ng / mL, 300 ng / mL, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of Want-3a in the culture medium is preferably 60 ng / mL to 200 ng / mL, more preferably 80 ng / mL to 120 ng / mL.

[0060] According to embodiments of the present invention, the final concentration of Noggin in the culture medium is 100 ng / mL to 800 ng / mL. Exemplarily, the final concentration of Noggin in the culture medium is 100 ng / mL, 200 ng / mL, 300 ng / mL, 400 ng / mL, 500 ng / mL, 600 ng / mL, 700 ng / mL, 800 ng / mL, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of Noggin in the culture medium is preferably 200 ng / mL to 700 ng / mL; more preferably 400 ng / mL to 600 ng / mL.

[0061] According to embodiments of the present invention, the final concentration of the BMP inhibitor in the culture medium is 20 ng / mL to 300 ng / mL. Exemplarily, the final concentration of the BMP inhibitor in the culture medium is 20 ng / mL, 40 ng / mL, 60 ng / mL, 80 ng / mL, 100 ng / mL, 120 ng / mL, 140 ng / mL, 160 ng / mL, 180 ng / mL, 200 ng / mL, 250 ng / mL, 300 ng / mL, or a range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of the BMP inhibitor in the culture medium is preferably 60 ng / mL to 200 ng / mL, more preferably 80 ng / mL to 120 ng / mL.

[0062] According to embodiments of the present invention, the final concentration of the TGF-β inhibitor in the culture medium is 200 nM to 800 nM. Exemplarily, the final concentration of the TGF-β inhibitor in the culture medium is 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 750 nM, 800 nM, or any range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of the TGF-β inhibitor in the culture medium is preferably 350 nM to 700 nM, more preferably 400 nM to 600 nM.

[0063] According to embodiments of the present invention, the final concentration of the ROCK inhibitor in the culture medium is 0.5 μM to 20 μM. Exemplarily, the final concentration of the ROCK inhibitor in the culture medium is 0.5 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 10 μM, 15 μM, 20 μM, or any range between any two of the above values. According to some preferred embodiments of the present invention, the final concentration of the ROCK inhibitor in the culture medium is preferably 1 μM to 15 μM, more preferably 2 μM to 8 μM.

[0064] In some embodiments of the present invention, the use of the aforementioned culture medium in lung organoid culture is proposed. Lung organoids cultured using the culture medium provided by the present invention are stable and can provide a reproducible and standardized infection model for viral infection.

[0065] Lung organoids and their preparation methods In some embodiments of the present invention, a method for preparing lung organoids is proposed, comprising: subjecting adult stem cells to a first homogenization treatment with matrix gel; and subjecting the product of the first homogenization treatment to a first culture treatment in the aforementioned culture medium. According to embodiments of the present invention, the volume of the matrix gel accounts for not less than 70% of the volume of the product of the first homogenization treatment.

[0066] The matrix gel provides a three-dimensional physical scaffold and structural support during organoid culture, while simultaneously mimicking the ecosystem of the in vivo stem cell microenvironment, allowing stem cells to continuously self-renew and differentiate in the 3D organoids. The lung organoids obtained using the method proposed in this invention are a reproducible and standardized infection model, which can be used for disease model establishment, drug screening, regenerative medicine research, and other fields.

[0067] According to an embodiment of the present invention, the method further includes passage treatment of the first culture product, so that the organoids continue to grow and expand during the culture process.

[0068] According to an embodiment of the present invention, the adult stem cells are derived from the lung tissue of rodents.

[0069] According to embodiments of the present invention, the rodents include brown rats, yellow-breasted rats, black rats, house mice, striped field mice, deer mice, and field mice.

[0070] According to embodiments of the present invention, the rodents include brown rats and yellow-breasted rats. The lung organoids obtained through induced differentiation and culture of adult stem cells from brown rats and yellow-breasted rats are produced through the co-development of multiple lineages. Mature lung organoids contain various cell types, including basal cells, ciliated cells, goblet cells, Club cells, and type II alveolar epithelial cells, and are derived from brown rats and yellow-breasted rats, consistent with their natural host.

[0071] According to an embodiment of the present invention, the subculturing process includes dissociating the first culture product using at least one of mechanical dissociation, enzymatic dissociation, and chemical dissociation; and subjecting the dissociated product to a second culture treatment.

[0072] The mechanical dissociation method uses mechanical force (such as blowing, shearing, grinding) to physically tear organoid masses into smaller fragments. It is simple to operate, low in cost, and has little impact on cell activity, without introducing any external substances to affect the experiment. The enzymatic dissociation method uses specific proteases (such as trypsin-EDTA, collagenase, Accutase) to degrade the extracellular matrix and intercellular junction proteins. The enzymatic dissociation method has the advantages of high efficiency, uniformity, high reproducibility, and wide applicability. The chemical dissociation method uses chemical chelating agents (such as EDTA) to disrupt intercellular junctions, which is a mild and controllable auxiliary method.

[0073] According to an embodiment of the present invention, the subculturing process includes dissociating the first culture treatment using a mechanical dissociation method.

[0074] According to embodiments of the present invention, the method may further include organoid identification, such as quality control testing.

[0075] The quality control tests include morphological identification using optical microscopy or fluorescence microscopy / confocal microscopy; identification and localization of specific cell types (such as stem cells and differentiated cells) at the protein level using immunofluorescence staining; observation of the overall cell morphology of organoids using histological staining (such as hematoxylin-eosin staining); rapid and quantitative detection of the mRNA expression level of specific genes using real-time quantitative PCR; and identification of organoid functions, including cell function, drug screening, and damage repair function. The tests may further include identification of the genetic stability and safety of organoids, such as karyotype analysis to detect whether abnormalities in chromosome number and structure occur during long-term culture, STR analysis for identification and cross-contamination detection to ensure the correct origin of organoids, and microbial testing to ensure that organoids are free from contamination by mycoplasma, bacteria, fungi, etc.

[0076] In some embodiments of the present invention, a lung organoid is proposed, which is prepared by the methods described above. The lung organoid proposed in this invention is a reproducible and standardized infection model that can be used for disease model establishment, drug screening, regenerative medicine research, and other fields.

[0077] Lung organoid virus infection model and construction method In some embodiments of the present invention, a method for constructing a lung organoid virus infection model is proposed, comprising: co-culturing the aforementioned lung organoids and viral infection fluid in the aforementioned culture medium. The viral infection model constructed according to the method proposed in this invention can fully simulate the viral infection situation in the natural host of the virus, providing a powerful tool for the study of viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, toxicity evaluation, and drug development.

[0078] According to an embodiment of the present invention, the virus is a Hantavirus.

[0079] According to embodiments of the present invention, the virus includes one of Hantan virus, Seoul virus, Dobrava virus, Pumara virus, Andean virus, and Sinopharm virus.

[0080] According to an embodiment of the present invention, the virus is Hantan virus; the ratio of the number of infected viruses to the number of lung organoids is MOI=1, and the specific formula for calculating the amount of virus added in this article is: virus volume (μL) = (cell volume × MOI × 1000) / virus titer (unit is PFU / mL).

[0081] The established model can be applied to the study of the mechanism of Hantan virus and drug development, providing a new strategy for preventing Hantan virus infection.

[0082] According to embodiments of the present invention, the method may further include virus infection identification, re-identification of organoid model characteristics and functions, and model applicability verification. The identification includes determining the virus infection titer, or quantitatively reflecting the copy number of the viral genome within organoid cells using quantitative real-time PCR; determining viral protein expression or performing cell localization using immunofluorescence staining or Western blotting; and directly observing viral particles within organoid cells using transmission electron microscopy.

[0083] The re-identification of the characteristics and functions of the organoid model includes the identification of the presence and changes of various cell types and the determination of the basic functions of the organoids through immunofluorescence staining; the model applicability verification includes drug screening verification, antibody neutralization test verification, etc.

[0084] In some embodiments of this invention, a lung organoid virus infection model is proposed, prepared by the methods described above. The lung organoid virus infection model proposed in this invention can fully simulate the viral infection situation in the natural host of the virus, providing a powerful tool for the study of viral pathogenesis mechanisms, high-throughput screening of antiviral drugs, toxicity evaluation, and drug development.

[0085] The reagents or instruments involved in this invention are shown in Table 1, and are all conventional products that can be obtained commercially.

[0086] Table 1:

[0087] Embodiments of the present invention will now be described in more detail, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the invention, and should not be construed as limiting the invention.

[0088] Example 1: Screening of lung organoid culture medium components The culture medium composition was screened and grouped as follows: Full-factor control group (M9): complete culture medium containing all growth factors (N-acetylcysteine, nicotinamide, Y-27632, A83-01, hEGF, Noggin, R-Spondin 1, Want-3a); Single-factor deletion groups (M1-M8): each group had only one growth factor removed, with other components identical to the full-factor control group; each group had 3 replicates, with approximately 1 × 10⁶ cells inoculated per well. 5 Organoids were collected. Lung organoids from yellow-breasted rats and brown rats obtained previously were scraped off, washed once with PBS, centrifuged at 300×g for 5 min, and repeated once. Then, 1 mL of digestion solution was added, and the mixture was incubated at 37℃ for 5 min. After digestion, 500 μL of FBS or Advanced DMEM was added to stop the digestion, and the mixture was centrifuged at 300×g for 5 min. The mixture was washed once with PBS, centrifuged at 300×g for 5 min, and repeated once. After washing, the supernatant was discarded, and the precipitate was retained. The precipitate was mixed with matrix gel and plated into 24-well plates (30 μL of matrix gel and cell mixture per well, with the matrix gel volume accounting for no less than 70% of the mixture volume). After completion, the plates were incubated at 37℃ for 15 min to allow the matrix gel to solidify. 500 μL of the corresponding culture medium was added to each well, and the culture medium was changed every 2 days. Daily observation (days 0-6) was performed, and photographs were taken daily using an inverted microscope (4× objective lens) to record the morphological characteristics and survival status of the organoids (such as size and whether necrosis occurred). The above steps were repeated for subculturing.

[0089] The experimental results are attached. Figure 1 As shown, the culture medium described in this invention can provide the necessary nutrients and survival support for the lung organoids of yellow-breasted rats and brown rats.

[0090] Example 2: Construction of lung organoids from adult stem cells Lung tissues from normal yellow-breasted rats and brown rats were collected and washed in sterile PBS culture dishes. The tissues were then placed in 1.5 mL EP tubes and cut into small pieces approximately 2 mm in diameter. The tissues were then transferred to digestion solution using a 1 mL pipette. The mixture was incubated at 37°C for 60 min (inverting and mixing every 10 min). Digestion was terminated by adding 500 μL of FBS or Advanced DMEM. The mixture was vigorously pipetted and filtered through a 40 μm cell sieve to obtain a single-cell suspension. The suspension was centrifuged at 150 × g for 3 min. 1 mL of erythrocyte lysis buffer was added to lyse the erythrocytes. The cells were washed with PBS and centrifuged at 200 × g for 3 min, repeated once. After washing, the supernatant was discarded, and the precipitate was retained. The precipitate was mixed with matrix gel and plated into 24-well plates (30 μL of the matrix gel and cell mixture per well, with the matrix gel volume comprising at least 70% of the mixture volume). After completion, place in a 37°C incubator for 15 minutes to allow the matrix gel to solidify; add 500 μL of culture medium to each well, and change the culture medium every 2 days.

[0091] The experimental results are attached. Figure 2 As shown, the lung organoids of yellow-breasted rat and brown rat constructed in this invention have a continuous and stable passage ability.

[0092] Example 3: Identification of organoid cell types using laser confocal microscopy Scrape off the lung organoids obtained from the previously obtained yellow-breasted rat and brown rat, wash once with PBS, centrifuge at 300×g for 5 min, repeat once, add 1 mL of 4% paraformaldehyde to each tube, and fix at room temperature for 1 h. Do not exceed 10 h; discard the fixative, add 1 mL of PBS, and wash three times to completely remove paraformaldehyde residue. This step must be performed in a fume hood; add 500 μL of PBST to each tube, let stand for 15 min for membrane permeabilization; discard the PBST, and wash three times with PBS. Block with 5% BSA (prepared with PBS) and incubate at room temperature for 1 h. Remove the blocking solution and add primary antibody dilution buffer CC10 (SantaCruz, sc-365992) / Cytokeratin 5 (SantaCruz, sc-32721) / Mucin 5B (SantaCruz, sc-21768) / SFTPC (Proteintech, 10774-1AP) / Acetyl-a-Tubulin (SantaCruz, sc-23950), generally prepared with blocking buffer (1% BSA), dilution ratio, and incubate overnight at 4°C. Aspirate the primary antibody solution, wash 3 times with PBS, add the corresponding secondary antibody solution, generally prepared with blocking buffer (1% BSA), and incubate at room temperature in the dark for 1 h. Wash 3 times with PBS, add 50 μL of DAPI, and incubate at room temperature in the dark for 30 min. Aspirate the DAPI solution (100 μg / mL), wash 3 times with PBS, aspirate as much supernatant as possible, and observe fluorescence using a laser confocal microscope.

[0093] Specific experimental results are attached. Figure 3 As shown, there are five cell types in lung organoids: basal cells, ciliated cells, Club cells, goblet cells, and alveolar type II cells.

[0094] Example 4: HTNV virus infection of lung organoids The HTNV virus was diluted with the lung organoid culture medium proposed in this invention, and the MOI was set to 1 to prepare the virus infection solution. The specific formula for calculating the virus addition volume is: Virus volume (μL) = (cell mass × MOI × 1000) / virus titer (unit: PFU / mL). Two groups were set up: a mock group and a virus infection group (HTNV).

[0095] Lung organoids obtained from yellow-breasted rats and brown rats were scraped off, washed once with PBS, and centrifuged at 300×g for 5 min; incubated at 37℃ for 2 h; after infection, the viral infection solution in the centrifuge tubes was aspirated to obtain lung organoids infected with HTNV virus; 2 mL of PBS solution was added to each well, and the liquid in the well was gently agitated with a pipette for washing, centrifuged at 300×g for 5 min, and repeated once; after washing, the supernatant was discarded, and the precipitate was retained, mixed with matrix gel, and plated into 48-well plates (15 μL of matrix gel and cell mixture per well, with the matrix gel volume accounting for no less than 70% of the mixture volume); after completion, the plates were incubated at 37℃ for 15 min to allow the matrix gel to solidify; 250 μL of lung organoid culture medium was added to each well, and the plates were cultured further. After 72 h, lung organoids were collected for real-time quantitative PCR, fixation, and immunofluorescence staining observation.

[0096] Example 5: Detection of HTNV virus copy number in organoids and supernatant by real-time quantitative PCR Organoids from the virus-infected group described in Example 4 were collected at 0 h, 24 h, 48 h, 72 h, 96 h, and 120 h post-infection and placed into 1.5 mL EP tubes without nuclease. 500 μL of Trizol was added to each tube; 100 μL of chloroform was added, and the tubes were vigorously shaken for 15 s and incubated at room temperature for 5 min. After incubation, the tubes were centrifuged at 12000×g for 15 min at 4 °C. After centrifugation, the supernatant was pipetted into a new 1.5 mL EP tube without nuclease, and an equal volume of isopropanol was added. The tubes were inverted and thoroughly mixed, and then incubated at -20 °C for 20 min. After incubation, the tubes were centrifuged at 12000×g for 10 min at 4 °C. The supernatant was discarded, and 1 mL of 75% ethanol was added and vortexed for 10 s. Then, the tubes were centrifuged at 12000×g for 10 min at 4 °C. The ethanol was removed, and the tubes were allowed to air dry at room temperature for 5-10 min to allow residual ethanol to evaporate. Dissolve the white precipitate in 40-50 μL of nuclease-free water to obtain an RNA solution; measure the RNA concentration; use a kit (Vazyme, HiScript). R II. One-Step qRT-PCR (SYBR Green Kit) and primers (76118-S-1084-F ACATCTGAGGAGAAGCTACGG; 76118-S-1197-R GGCAACCATGAAGAGCACAA) were added in the amounts shown in Table 2, and viral copy number was detected. The qPCR program is shown in Table 3.

[0097] Table 2:

[0098] Table 3:

[0099] Through calculation and analysis, the relative expression levels of HTNV virus-specific genes were obtained, thereby reflecting the infection and replication status of the virus in organoids.

[0100] Supernatant culture medium was collected from the virus infection group described in Example 4 at 0 h, 24 h, 48 h, 72 h, 96 h, and 120 h post-infection and placed into 1.5 mL EP tubes without nuclease. Nucleic acid was extracted from the supernatant using the kit (Vazyme, Virus DNA / RNA Extraction Kit 2.0 (Prepackaged)) with the amounts shown in Table 4. Follow these automated extraction steps: Add 150 μL of sample to the wells in columns 1 and 7 of the 96-well plate reagent (note the effective working well positions); place the 96-well plate into the nucleic acid extractor, attach the magnetic rod sleeve, and confirm that the magnetic rod sleeve is properly installed; edit the program in Table 4 below to perform automated extraction: Table 4:

[0101] After the automated process is complete, transfer the elution buffer from wells in columns 6 and 12 (note the effective working well positions) to clean nuclease-free centrifuge tubes. Real-time quantitative PCR was used to detect the HTNV virus copy number in organoids, with primers and their addition amounts as in Example 5. The relative expression levels of HTNV virus-specific genes were calculated and analyzed to reflect the viral infection and replication status in organoids.

[0102] Specific experimental results are attached. Figure 4 As shown in the figure, the expression level of viral mRNA in mouse lung organoids and supernatant culture medium increases with time after infection with HTNV virus, suggesting that HTNV virus can infect mouse lung organoids and replicate in them.

[0103] Example 6: Detection of Virus Infection Efficiency Using Laser Confocal Microscopy Lung organoids scraped from yellow-breasted rats and brown rats 48 h post-HTNV virus infection were washed once with PBS, centrifuged at 300×g for 5 min, and repeated once. 1 mL of 4% paraformaldehyde was added to each tube, and the tubes were incubated at room temperature for 1 h for fixation. The incubation period should not exceed 10 h. The fixative was discarded, and 1 mL of PBS was added, followed by washing three times to thoroughly remove any paraformaldehyde residue. This step must be performed in a fume hood. 500 μL of PBST was added to each tube, and the tubes were incubated for 15 min for transmembrane permeation. The PBST was discarded, and the tubes were washed three times with PBS. Block with 5% BSA (prepared with PBS) and incubate at room temperature for 1 h; remove the blocking solution, add primary antibody dilution buffer (HTNV virus NP polyclonal antibody), generally prepared with blocking buffer (1% BSA), dilution ratio, and incubate overnight at 4°C; aspirate the primary antibody solution, wash 3 times with PBS, add the corresponding secondary antibody solution, generally prepared with blocking buffer (1% BSA), and incubate at room temperature in the dark for 1 h; wash 3 times with PBS, add 50 μL DAPI, and incubate at room temperature in the dark for 30 min; aspirate the DAPI solution (100 μg / mL), wash 3 times with PBS, and aspirate as much supernatant as possible; observe fluorescence using a laser confocal microscope.

[0104] Specific experimental results are attached. Figure 5 As shown, obvious fluorescence can be observed after lung organoids are cultured with virus-infected fluid, indicating that HTNV virus can efficiently infect lung organoids and carry out active replication and protein expression within cells.

[0105] Example 7: Toxicity of the compound to lung organoids in brown rats and yellow-breasted rats Lung organoids from yellow-breasted rats and brown rats were embedded in Matrigel, plated in 48-well plates, and cultured in 300 μL of lung organoid culture medium. The lung organoids were mixed with different test drug solutions (ribavirin, favipiravir, and baloravir) at an initial concentration of 200 μM, with six concentration gradients and five-fold dilutions, each gradient having three replicate wells. Control wells (without drug) and blank control wells were also included. The cells were cultured at 37°C and 5% CO2 for 5 days. The number of viable cells in 3D culture was quantified using the CellTiter-Glo® 3D CellViability Assay kit, and the half-maximal toxicity concentration (CC50) was calculated. 50 The initial concentration of the compound was 200 μM. Six concentration gradients were set up and diluted 5-fold. Three replicate wells were set up for each concentration gradient. Positive control wells without the drug and blank control wells without the drug and organoids were also set up.

[0106] Specific experimental results are attached. Figure 6As shown, the results indicate that ribavirin, favipiravir, and baloravir have no significant toxicity to organoids at effective concentrations and exhibit good biocompatibility windows. However, the toxicity of baloravir to lung organoids shows a dose-dependent effect.

[0107] Example 8: Infection model used for antiviral efficacy testing HTNV virus was used to infect lung organoids of yellow-breasted rats and brown rats for 2 h. The organs were washed twice with culture medium to remove unbound virus. The lung organoids were then re-embedded in matrix gel, plated in 48-well plates, and cultured in 300 μL of lung organoid culture medium.

[0108] In the drug detection experiment, organoids were pre-infected with HTNV (MOI=1) for 2 h, followed by the addition of a virus-drug mixture (ribavirin, favipiravir, and baloravir) to the culture. Samples were harvested at 120 h. The organoids were collected in nuclease-free 1.5 mL EP tubes by resuspending the matrix gel containing the organoids in 300 μL Trizol. 60 μL of chloroform was added, and the mixture was vigorously shaken for 15 s and incubated at room temperature for 5 min. After incubation, the tubes were centrifuged at 12000 g for 15 min at 4 °C. After centrifugation, the supernatant was pipetted into a new 1.5 mL nuclease-free EP tube, and an equal volume of isopropanol was added. The tubes were inverted and thoroughly mixed, then incubated at -20 °C for 20 min. After incubation, the tubes were centrifuged at 12000 g for 10 min at 4 °C. The supernatant was discarded, and 1 mL of 75% ethanol was added. The tubes were vortexed for 10 s, then centrifuged at 12000 g for 10 min at 4 °C. min; remove all ethanol, and allow to evaporate at room temperature for 5-10 min. Add 40-50 μL of nuclease-free water to dissolve the white precipitate, obtaining an RNA solution; measure the RNA concentration.

[0109] The primers and their amounts, as well as the qPCR reaction procedure, for the method of detecting viral copy number are the same as those shown in Example 5.

[0110] The relative expression levels of HTNV virus-specific genes were calculated and analyzed to reflect the infection and replication status of the virus in organoids. The initial compound concentration was 200 μM, with six concentration gradients and five-fold dilutions. Each concentration gradient had three replicate wells. Positive control wells were included, along with negative control wells (infected with the virus but without the drug), and positive control wells (not infected with the virus and without the drug).

[0111] Specific experimental results are attached. Figure 7 As shown, the results indicate that ribavirin, favipiravir, and baloravir have good antiviral effects in the lung organoid infection model proposed in this invention, demonstrating that the non-organoid virus infection model constructed in this invention can be used for the identification, screening, and efficacy determination of antiviral drugs.

[0112] Comparative Example 1: Difference in Effects Between G27 and B27 The influence of culture medium composition on group design includes: Control group: No B27 and G27 were added, but the medium contained all other growth factors (N-acetylcysteine, nicotinamide, Y-27632, A83-01, hEGF, Noggin, R-Spondin 1, Want-3a). Compared with the B27 and G27 groups, the missing components were made up by an equal amount of basal medium. B27 group: B27 was added, and other components were completely the same as the control group. G27 group: G27 was added, and other components were completely the same as the control group.

[0113] Each group has 3 replicates, with approximately 1×10⁶ cells inoculated per well. 5 Organoids: Scrape lung organoids from yellow-breasted rats and brown rats obtained in Example 2 above, wash once with PBS, centrifuge at 300×g for 5 min, repeat once; then add 1 mL of digestion solution, incubate at 37℃ for 5 min, add 500 μL of FBS or Advanced DMEM to stop digestion, centrifuge at 300×g for 5 min; wash once with PBS, centrifuge at 300×g for 5 min, repeat once; after washing, discard the supernatant and retain the precipitate. Mix the precipitate with matrix gel and plate it into 24-well plates (30 μL of matrix gel and cell mixture per well, with the matrix gel volume accounting for no less than 70% of the mixture volume). After completion, incubate at 37℃ for 15 min to allow the matrix gel to solidify; add 500 μL of the corresponding culture medium per well, and change the culture medium every 2 days. Daily observation (days 0-6): take pictures daily with an inverted microscope to record the morphological characteristics and survival status of the organoids (such as size, whether necrosis has occurred); repeat the above steps for subculturing.

[0114] The experimental results are attached. Figure 8 As shown, the culture medium described in this invention, with G27, provides better nutritional components and survival support for lung organoids of yellow-breasted rats and brown rats compared to B27.

[0115] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0116] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A culture medium, characterized in that, include: The basal medium, G27, hEGF, BMP inhibitor, ROCK inhibitor, L-glutamine, HEPES, antibiotic; and at least one selected from nicotinamide, Wnt agonist, N-acetylcysteine ​​and TGF-β inhibitor.

2. The culture medium according to claim 1, characterized in that, The culture medium includes basal medium, hEGF, BMP inhibitor, TGF-β inhibitor, ROCK inhibitor, G27, L-glutamine, HEPES, and antibiotics.

3. The culture medium according to claim 1, characterized in that, The culture medium includes basal medium, hEGF, BMP inhibitor, ROCK inhibitor, Wnt agonist, nicotinamide, G27, L-glutamine, HEPES, and antibiotics.

4. The culture medium according to claim 1, characterized in that, The basic culture medium was Advanced DMEM / F12; The culture medium further includes at least one of the following characteristics: The Wnt agonist includes at least one of Want-3a and R-Spondin 1; The BMP inhibitor is Noggin; The TGF-β inhibitor is A83-01; The ROCK inhibitor is Y-27632; The antibiotics include at least one of penicillin and streptomycin.

5. The culture medium according to any one of claims 1, characterized in that, The final concentration of G27 in the culture medium is 1×; and / or The final concentration of hEGF in the culture medium is 20 ng / mL to 80 ng / mL; and / or The final concentration of N-acetylcysteine ​​in the culture medium is 0.2 mM to 4 mM; and / or The final concentration of the nicotinamide in the culture medium is 2 mM to 20 mM; and / or The final concentration of L-glutamine in the culture medium is 0.2 mM to 10 mM; and / or The final concentration of HEPES in the culture medium is 1 mM to 35 mM; and / or The antibiotic is present at a final concentration of 20 μg / mL to 300 μg / mL in the culture medium; and / or The Wnt agonist is present at a final concentration of 120 ng / mL to 1100 ng / mL in the culture medium; and / or The final concentration of the BMP inhibitor in the culture medium is 20 ng / mL to 300 ng / mL; and / or The final concentration of the TGF-β inhibitor in the culture medium is 200 nM to 800 nM; and / or The final concentration of the ROCK inhibitor in the culture medium is 0.5 μM to 20 μM.

6. Use of the culture medium according to any one of claims 1 to 5 in lung organoid culture.

7. A method for preparing lung organoids, characterized in that, include: The adult stem cells were first mixed with the matrix gel. The first homogenized product is subjected to a first culture treatment in the culture medium described in any one of claims 1 to 5.

8. The method according to claim 7, characterized in that, The volume of the matrix adhesive accounts for no less than 70% of the volume of the first homogenized product.

9. The method according to claim 7, characterized in that, The method further includes subculturing the first culture product; Optionally, the subculture treatment includes dissociating the first culture product using at least one of mechanical dissociation, enzymatic dissociation, and chemical dissociation; and subjecting the dissociated product to a second culture treatment. Preferably, the subculturing process includes dissociating the first culture treatment using a mechanical dissociation method.

10. The method according to claim 7, characterized in that, The adult stem cells are derived from the lung tissue of rodents; Optionally, the rodents include at least one of the following: brown rat, yellow-breasted rat, black rat, house mouse, striped field mouse, deer mouse, and field mouse; Preferably, the rodents include at least one of the brown rat and the yellow-breasted rat.

11. A lung organoid, characterized in that, The lung organoids are prepared by the method described in any one of claims 7 to 10.

12. A method for constructing a lung organoid virus infection model, characterized in that, include: The lung organoids of claim 11 and the viral infection fluid are co-cultured in the culture medium of any one of claims 1 to 5.

13. The method according to claim 12, characterized in that, The virus in question is Hantavirus; Optionally, the virus includes one of Hantan virus, Seoul virus, Dobrava virus, Pumara virus, Andean virus, and Sinopharm virus; Preferably, the virus is the Hantan virus; Optionally, the ratio of the number of viruses to the number of infected lung organoids is MOI=1.

14. A lung organoid virus infection model, characterized in that, Prepared by the method according to any one of claims 12-13.