Aspartate ligase mutants and their use in the production of nicotinamide

By coupling aspartate ligase and polyphosphate phosphotransferase through site-directed mutagenesis, the conversion activity of nicotinic acid was improved, solving the problem of high nicotinic acid content and realizing the preparation of nicotinamide with high efficiency and low cost, which is suitable for industrial production.

CN122146629APending Publication Date: 2026-06-05HANGZHOU VIABLIFE BIOTECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HANGZHOU VIABLIFE BIOTECH CO LTD
Filing Date
2026-04-27
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

The existing nicotinamide preparation process has a high nicotinic acid content, which leads to the risk of skin allergies, and the low efficiency of biological enzyme catalysis increases the preparation cost, making it unsuitable for industrial production.

Method used

Develop an aspartate ligase mutant to enhance nicotinic acid conversion activity through site-directed mutagenesis and couple it with polyphosphate phosphotransferase to achieve ATP recycling and reduce the amount of ATP required.

Benefits of technology

It improves the production efficiency and yield of nicotinamide while significantly reducing the preparation cost, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146629A_ABST
    Figure CN122146629A_ABST
Patent Text Reader

Abstract

The application discloses an aspartate ligase mutant and application thereof in production of nicotinamide, and belongs to the technical field of enzyme engineering. The aspartate ligase mutant is obtained by mutation on the basis of wild-type aspartate ligase shown in SEQ ID NO. 5, and at least includes the 104th site. The aspartate ligase mutant has higher catalytic activity in catalyzing synthesis of nicotinamide from nicotinic acid, and can significantly improve the production efficiency of nicotinamide. Coupling of the aspartate ligase mutant with polyphosphate phosphate transferase can also realize ATP cycle regeneration, reduce the addition amount of ATP, and further greatly reduce the preparation cost of nicotinamide. Therefore, the mutant is suitable for industrial production, and has good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and more specifically, to an aspartate ligase mutant and its application in the production of nicotinamide. Background Technology

[0002] Nicotinamide, also known as nicotinamide, belongs to the B vitamins and is widely distributed in nature, with abundant content in cereal germ, dried yeast, meat, and peanuts. Nicotinamide is an important component of the coenzymes nicotinamide adenine dinucleotide and nicotinamide adenine dinucleotide phosphate, directly participating in various redox reactions in the body. Nicotinamide can be used to treat skin diseases, diabetes, and neurological disorders. It is also used as a feed additive to improve the disease resistance and growth rate of livestock and poultry, which is its largest application area. Furthermore, nicotinamide is widely used as a cosmetic ingredient in the cosmetic industry. Therefore, the demand for nicotinamide is increasing daily.

[0003] Nicotinamide can be prepared by chemical synthesis, mainly by synthesizing 3-cyanopyridine from 3-methylpyridine via ammonia oxidation, followed by chemical hydrolysis to synthesize nicotinamide. However, this method has low yield, low purity, and harsh reaction conditions, and has been gradually phased out. Bioconversion, on the other hand, offers advantages such as high specificity, environmental friendliness, mild reaction conditions, and the elimination of the need for multi-step separation and purification, making it more in line with current development requirements.

[0004] Currently, the main biological route for the preparation of nicotinamide uses 3-cyanopyridine as a substrate, which is converted to nicotinamide by nitrile hydratase. Binfeng Li constructed a nitrile hydratase gene library and screened for the highly active nitrile hydratase NHT-120, which can successfully convert 3-cyanopyridine to nicotinamide. Chinese patent CN109593750B discloses a nitrile hydratase mutant. The obtained new mutant enzyme has better temperature tolerance and product tolerance. By converting 3-cyanopyridine with recombinant E. coli of the mutant, the yield and concentration of nicotinamide were significantly improved.

[0005] However, the nicotinamide preparation process reported above easily generates a certain amount of nicotinic acid, which can cause skin allergies in users, affecting its further promotion and application in daily chemical products. To address this, Chinese patent CN11468538A introduces an amination-promoting enzyme to convert nicotinic acid into nicotinamide, reducing the nicotinic acid content in the system. However, this amination-promoting enzyme has low catalytic efficiency and requires the addition of expensive cofactors, increasing the cost of preparing high-quality nicotinamide and making it unsuitable for industrial production.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide an aspartate ligase mutant and its application in the production of nicotinamide. This aspartate ligase mutant has higher nicotinic acid conversion activity. By using the fermentation method of this invention, the amount of ATP added can be reduced, thereby increasing yield and efficiency while significantly reducing costs.

[0008] This invention is implemented as follows: In a first aspect, the present invention provides an aspartate ligase mutant, which is obtained by mutating the wild-type aspartate ligase (AAL) shown in SEQ ID NO.5, and the mutation site includes at least position 104. The mutation at position 104 is aspartic acid mutated to valine, asparagine, glutamic acid, or threonine.

[0009] The present invention chose an aspartate ligase with the amino acid sequence shown in SEQ ID NO. 5 (nucleotide sequence shown in SEQ ID NO. 6) as the basis for mutation because, in the preliminary screening experiments, Aeromonas dhakensis The aspartate ligase from (Genbank accession CAD7554179.1) exhibits higher enzymatic activity in nicotinamide production compared to aspartate ligases from other sources. Therefore, this enzyme was subsequently modified using site-directed mutagenesis. During the modification process, it was discovered that the mutation site for AAL was selected from at least one of positions 104, 183, 213, 248, and 296.

[0010] The mutation at position 104 is as follows: aspartic acid is mutated to valine, asparagine, glutamic acid or threonine, also denoted as D104V, D104N, D104E or D104T.

[0011] The mutation at position 183 is as follows: lysine is mutated to histidine, asparagine, methionine, serine, or leucine, also denoted as K183H, K183N, K183M, K183S, or K183L.

[0012] The mutation at position 213 is as follows: valine is mutated to tyrosine, phenylalanine, or proline, also denoted as V213Y, V213F, or V213P.

[0013] The mutation at position 248 is as follows: glutamic acid is mutated into methionine, leucine, isoleucine, or lysine, also denoted as E248M, E248L, E248I, or E248K.

[0014] The mutation at position 296 is as follows: glycine is mutated into valine, methionine, or glutamine, also denoted as G296V, G296M, or G296Q.

[0015] In some embodiments, the aspartate ligase mutant is obtained by mutating the 104th aspartic acid to valine, asparagine, glutamic acid, or threonine based on the wild-type aspartate ligase.

[0016] In some embodiments, the aspartate ligase mutant is obtained by mutating the 104th aspartic acid to threonine and the 183rd lysine to histidine, asparagine, methionine, serine, or leucine based on the wild-type aspartate ligase.

[0017] In some embodiments, the aspartate ligase mutant is obtained by mutating the wild-type aspartate ligase to replace the 104th aspartic acid with threonine, the 183rd lysine with asparagine, and the 213th valine with tyrosine, phenylalanine, or proline.

[0018] In some embodiments, the aspartate ligase mutant is obtained by mutating the wild-type aspartate ligase by replacing the 104th aspartic acid with threonine, the 183rd lysine with asparagine, the 213th valine with phenylalanine, and the 248th glutamic acid with methionine, leucine, isoleucine, or lysine.

[0019] Preferably, the aspartate ligase mutant is based on the wild-type aspartate ligase, with the following mutations: aspartic acid at position 104 is replaced with threonine, lysine at position 183 is replaced with asparagine, valine at position 213 is replaced with phenylalanine, glutamic acid at position 248 is replaced with leucine, and glycine at position 296 is replaced with valine, methionine, or glutamine.

[0020] More preferably, the aspartate ligase mutant is based on the wild-type aspartate ligase, with the following mutations: aspartic acid at position 104 is replaced by threonine, lysine at position 183 is replaced by asparagine, valine at position 213 is replaced by phenylalanine, glutamic acid at position 248 is replaced by leucine, and glycine at position 296 is replaced by methionine. Its amino acid sequence is shown in SEQ ID NO.7, and its nucleotide sequence is shown in SEQ ID NO.8.

[0021] In a second aspect, the present invention provides biomaterials related to the above-mentioned aspartate ligase mutant, which are any one of the following (1)-(4): (1) The nucleic acid molecule encoding the above-mentioned aspartate ligase mutant; (2) An expression cassette containing the nucleic acid molecule described in (1); (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (4) Recombinant bacteria containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

[0022] Thirdly, the present invention also provides a method for preparing the above-mentioned aspartate ligase mutant, comprising: ligating the nucleotide sequence of the aspartate ligase mutant to an expression vector, transforming the obtained recombinant vector into a host cell, culturing the host cell, inducing expression of the aspartate ligase mutant, and then obtaining the above-mentioned aspartate ligase mutant after separation and purification.

[0023] In some embodiments, the expression vector is pET28a(+) and the host cell is Escherichia coli. E.coli BL21(DE3). However, both the expression vector and the host cell can be other conventional choices in the field, and those skilled in the art can adjust them according to the actual situation and needs.

[0024] The above-mentioned aspartate ligase mutant or biological material can be used to catalyze the synthesis of nicotinamide from nicotinic acid or to prepare products that catalyze the synthesis of nicotinamide from nicotinic acid. Therefore, the present invention can also provide a biocatalyst for catalyzing the synthesis of nicotinamide from nicotinic acid, as well as a method for catalyzing the synthesis of nicotinamide from nicotinic acid.

[0025] Fourthly, the present invention can also provide a biocatalyst comprising the aforementioned aspartate ligase mutant or recombinant bacteria. A more conventional approach is to directly use the recombinant bacteria expressing the aforementioned aspartate ligase in the synthesis reaction, or to lyse the recombinant bacteria, collect the supernatant containing the aforementioned aspartate ligase, and then use it in the synthesis reaction. Therefore, the aforementioned aspartate ligase mutant or recombinant bacteria serves as the main active ingredient, catalyzing the conversion of nicotinic acid to nicotinamide.

[0026] The above-mentioned biocatalyst may also contain excipients or carriers conventionally added in the art, and the present invention does not specifically limit this.

[0027] In some embodiments, the biocatalyst further includes polyphosphate phosphotransferase (PPT). Coupling the aspartate ligase mutant to PPT enables ATP recycling, reducing the amount of ATP required and thus significantly lowering the cost of nicotinamide production. Specifically, current production methods require 412 g / L of ATP to convert 100 g / L of nicotinic acid; using the ATP recycling method of this invention, the amount of ATP required is reduced to 1 g / L.

[0028] In some embodiments, the amino acid sequence of the polyphosphate phosphotransferase is shown in SEQ ID NO.9, and the nucleotide sequence is shown in SEQ ID NO.10.

[0029] Fifthly, the present invention can also provide a method for catalytic synthesis of nicotinamide from nicotinic acid, the synthetic route of which is as follows: Figure 1As shown, the process includes: adding recombinant bacteria expressing the above-mentioned aspartate ligase mutant or its lysed supernatant to a transformation system containing nicotinic acid to react and obtain nicotinamide.

[0030] In some embodiments, the conversion system includes an aspartate ligase mutant, polyphosphate phosphotransferase, nicotinic acid, ATP, an ammonia source, and phosphate buffer.

[0031] In some embodiments, the transformation system comprises: 10-1000 mM nicotinic acid, 0.1-3 mM ATP, 20-1200 mM NH4Cl, 2-180 g / L sodium polyphosphate, 0.2-5 g / L aspartate ligase mutant or wet cells, and 0.2-5 g / L polyphosphate phosphotransferase or wet cells.

[0032] In some embodiments, the reaction conditions are: pH = 7.5~8.0, and temperature = 30~40°C.

[0033] The present invention has the following beneficial effects: The aspartate ligase mutant of this invention exhibits high catalytic activity in the synthesis of nicotinamide from nicotinic acid, significantly improving the production efficiency of nicotinamide. Furthermore, coupling it with polyphosphate phosphotransferase enables ATP recycling, reducing the amount of ATP required and thus substantially lowering the production cost of nicotinamide. Therefore, the mutant of this invention is suitable for industrial production and has promising application prospects. Attached Figure Description

[0034] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 This invention presents a synthetic route for synthesizing nicotinamide using nicotinic acid as a substrate. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0037] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0038] This invention uses high-performance liquid chromatography (HPLC) to analyze substrate and product concentrations. The specific analytical method is as follows: The conversion solution was analyzed using a Shimadzu 2030C high-performance liquid chromatograph (HPLC). The chromatographic conditions were as follows: mobile phase: methanol:water (1:1), Inertsustain C18 column (4.6×250 mm, 5 μm), flow rate: 1 mL / min, column temperature: 30℃, injection volume: 20 μL, and detection wavelength: 259 nm.

[0039] Example 1 This example demonstrates enzyme screening. 1. Enzyme source and construction of recombinant bacteria Aspartate ligases were obtained from the NCBI database, and were derived from... Cyclobacterium marinum (GenBank login number AEL26599.1) Enterobacter soli (GenBank login number AEN67132.1) and Aeromonas dhakensis (GenBank accession number CAD7554179.1), and named CmAAL, EsAAL, and AdAAL respectively. Based on the amino acid sequence and codon optimization according to the codon preference of E. coli, the three nucleotide sequences were synthesized by total synthesis using conventional genetic engineering methods, as shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6 respectively; the amino acid sequences encoding the enzymes are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5 respectively.

[0040] A 6×His-tag was added to the end of the nucleotide sequence, and NdeI and XhoI restriction sites were added to both ends. The gene was cloned into the NdeI and XhoI sites corresponding to pET28a(+) to obtain recombinant expression plasmids pET28a-CmAAL, pET28a-EsAAL, and pET28a-AdAAL. These three plasmids were then transformed into E. coli. Escherichia coli Recombinant bacteria were obtained from BL21(DE3) competent cells. Escherichia coli BL21(DE3) / pET28a-CmAAL Escherichia coli BL21(DE3) / pET28a-EsAAL and Escherichia coli BL21(DE3) / pET28a-AdAAL.

[0041] 2. Inducible expression of aspartate aminotransferase and polyphosphate phosphotransferase from different sources The polyphosphate phosphotransferase PPT (nucleotide sequence as shown in SEQ ID NO.10, amino acid sequence as shown in SEQ ID NO.9) is synthesized from the whole genome and obtained from [source missing]. Burkholderia vietnamiensis Recombinant polyphosphate phosphotransferase strains E.coli BL21(DE3) / pET28a-PPT.

[0042] Recombinant *E. coli* was inoculated into LB medium containing 50 mg / L kanamycin and cultured at 37°C and 200 rpm for 12 h to obtain a seed culture. The seed culture was then inoculated into fresh LB medium at a 2% inoculation rate and cultured at 37°C and 200 rpm until the bacterial concentration reached OD500. 600nm When the concentration reaches 0.7, add 0.5 mM IPTG, induce at 28℃ for 15 h, centrifuge at 8000 rpm for 10 min, discard the supernatant, wash the wet bacterial cells twice with 0.9% physiological saline, centrifuge, and set aside.

[0043] 3. Comparison of recombinant bacterial enzyme activities Enzyme activity assay: The wet bacterial cells were sonicated. 1 g of the prepared wet bacterial cells were resuspended in 50 mL of 50 mM K2HPO4-KH2PO4 buffer (pH 8.0) and sonicated for 15 min at 35 W to prepare a sonicated suspension. The suspension was centrifuged and the supernatant was collected. 1 mL of the supernatant was used for the reaction.

[0044] Reaction system: 50mM K2HPO4-KH2PO4 buffer (pH 8.0), 5 g / L nicotinic acid, 23 g / L ATP, 3 g / L ammonium chloride and 100 μL AAL lysate supernatant, totaling 1 mL.

[0045] Reaction conditions: The reaction was carried out at 30℃ for 2 min. Samples were taken and the yield of nicotinamide was determined by HPLC.

[0046] Enzyme activity is defined as the amount of enzyme required to produce 1 μmol of nicotinamide per minute at 30°C and pH 8.0.

[0047] Table 1 Comparison of the activities of various recombinases

[0048] Based on the enzyme activity results above, it can be seen that the enzyme originates from... Aeromonas dhakensis The enzyme activity of AdAAL was the highest, so AdAAL was used for subsequent studies.

[0049] Example 2 This example demonstrates the construction and screening of AdAAL unit point mutants. 1. Construction of mutants Site-directed mutagenesis primers were designed based on the parental AdAAL sequence (amino acid sequence SEQ ID NO. 5, nucleotide sequence SEQ ID NO. 6). Using rapid PCR technology, a single mutation was introduced at position 104 using recombinant pET28a-AdAAL as a template. The primers are as follows: Forward primer 104D: GGACGAG NNN CGTCTGACCCCGATCCATTCCG- SEQ ID NO.11; Reverse primer 104D: TCAGACG NNN CTCGTCCGGACGCAGAGCTTTC - SEQ ID NO. 12.

[0050] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 104D (10 μM) 2 μL, reverse primer 104D (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0051] PCR amplification conditions: 95℃ for 5 min; (95℃ for 20 s, 60℃ for 15 s, 72℃ for 1.5 min) 30 cycles; 72℃ for 10 min.

[0052] 2. Mutant Transformation Expression PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37°C for 1 h and then inactivated at 65°C for 1 min. 10 μL of the PCR product was then added to... E.coli In BL21(DE3) competent cells, heat shock transformation was performed, followed by incubation at 37℃ and 200 rpm for 1 h. The bacterial culture was then plated and incubated at 37℃ for 12 h.

[0053] 3. High-throughput screening of positive transformants Reaction mixture: 50 mM K₂HPO₄-KH₂PO₄ buffer (pH 8.0), 5 g / L nicotinic acid, 23 g / L ATP, 3 g / L ammonium chloride; 200 μL of LB medium containing 50 mg / L kanamycin was added to each well of a 96-well plate. Different single colonies were picked and cultured at 37℃ and 200 rpm. 600To a final concentration of 0.5-0.6, add IPTG to the culture medium, and induce expression at 28℃ for 12 h. Centrifuge at 20℃ and 4200 rpm for 10 min, and discard the supernatant. Add 100 μL of the reaction mixture to a 96-well plate containing bacterial cells, mix well, and react at 30℃ for 2 min. Terminate the reaction with dilute hydrochloric acid, take a sample, and determine the nicotinamide yield of the system by HPLC. (Using recombinant bacteria...) E.coli The reaction of BL21(DE3) / pET28a-AdAAL was used as a control, and the nicotinamide yield ratio was taken. E.coli The enzyme activity of mutant strains with high BL21(DE3) / pET28a-AdAAL response was accurately measured.

[0054] 4. Precise determination of enzyme activity in positive transformants The procedure was the same as in Example 1, “Comparison of Recombinant Bacterial Enzyme Activity”.

[0055] The results of this embodiment are as follows: Of the 231 recombinant transformant strains initially screened, 4 mutant strains with increased enzyme activity were selected. Further precise enzyme activity determination was then performed on these mutants, and the specific results are shown in Table 2. Analysis determined that the reason the enzyme activity of the remaining 227 recombinant strains remained unchanged or decreased was due to a mutation at position 104 (aspartic acid (D) in which an amino acid other than V, N, E, and T was replaced.

[0056] Table 2 Enzyme activity assay of single-point mutant recombinant bacteria

[0057] The AdAAL mutant with the highest increase in enzyme activity, -D104T, was designated AdAAL-1, and recombinant bacteria were obtained. E.coli BL21(DE3) / pET28a-AdAAL-1.

[0058] Example 3 This example demonstrates the construction and screening of AdAAL dual-site mutants. Site-directed mutagenesis primers were designed based on the mutant AdAAL-1 sequence constructed in Example 2. Using rapid PCR technology, a single mutation was introduced at position 183 using recombinant pET28a-AdAAL-1 as a template. The primers are as follows: Forward primer 183K: ACGCA NNN GGTCGCGAACGCGCTATCGCTAAA- SEQ ID NO.13; Reverse primer 183K: TTCGCGACC NNN TGCGTCCAGGTCCGGGTAAC - SEQ ID NO. 14.

[0059] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 183K (10 μM) 2 μL, reverse primer 183K (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0060] PCR amplification conditions: 95℃ for 5 min; (95℃ for 20 s, 60℃ for 15 s, 72℃ for 1.5 min) 30 cycles; 72℃ for 10 min.

[0061] PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37°C for 1 h and then inactivated at 65°C for 1 min. 10 μL of the PCR product was then added to... E.coli In BL21(DE3) competent cells, heat shock transformation was performed, followed by incubation at 37°C and 200 rpm for 1 h. The bacterial culture was then plated and incubated at 37°C for 12 h. The mutants were then subjected to initial screening (the procedure was the same as "high-throughput screening of positive transformants" in Example 2).

[0062] The wet bacterial cells were ultrasonically disrupted, and their enzyme activity was accurately measured (the procedure was the same as in "Comparison of Recombinant Bacterial Enzyme Activity" in Example 1).

[0063] The results of this embodiment are as follows: Of the 196 recombinant transformant strains initially screened, 5 mutant strains with increased enzyme activity were identified. Further precise enzyme activity determination was then performed on these strains, and the specific results are shown in Table 3. Analysis determined that the reason the enzyme activity of the remaining 191 recombinant strains remained unchanged or decreased was due to a mutation at position 183 (lysine (K) in which an amino acid other than H, N, M, S, and L was replaced.

[0064] Table 3 Enzyme activity assay of recombinant bacteria with double-point mutations

[0065] The AdAAL mutant with the highest increase in enzyme activity, -D104T-K183N, was designated AdAAL-2, and recombinant bacteria were obtained. E.coli BL21(DE3) / pET28a-AdAAL-2.

[0066] Example 4 This embodiment describes the construction and screening of AdAAL three-point mutants. Site-directed mutagenesis primers were designed based on the mutant AdAAL-2 sequence constructed in Example 3. Using rapid PCR technology, a single mutation was introduced at position 213 using recombinant pET28a-AdAAL-2 as a template. The primers are as follows: Forward primer 213V: TCATGATNNN CGCGCCCCGGACTACGACGACT- SEQ ID NO.15; Reverse primer 213V: GGGCGCG NNN ATCATGACGTTCGCCATGGGAC-SEQ ID NO. 16.

[0067] PCR reaction system: 25 μL of 2×FastPfu Fly Reaction Mix, 2 μL of forward primer 213V (10 μM), 2 μL of reverse primer 213V (10 μM), 1 μL of template DNA, 1 μL of FastPfu Fly DNA Polymerase, and ddH2O added to a final volume of 50 μL.

[0068] PCR amplification conditions: 95℃ for 5 min; (95℃ for 20 s, 60℃ for 15 s, 72℃ for 1.5 min) 30 cycles; 72℃ for 10 min.

[0069] PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37°C for 1 h and then inactivated at 65°C for 1 min. 10 μL of the PCR product was then added to... E.coli In BL21(DE3) competent cells, heat shock transformation was performed, followed by incubation at 37°C and 200 rpm for 1 h. The bacterial culture was then plated and incubated at 37°C for 12 h. The mutants were then subjected to initial screening (the procedure was the same as "high-throughput screening of positive transformants" in Example 2).

[0070] The wet bacterial cells were ultrasonically disrupted, and their enzyme activity was accurately measured (the procedure was the same as in "Comparison of Recombinant Bacterial Enzyme Activity" in Example 1).

[0071] The results of this embodiment are as follows: Of the 201 recombinant transformant strains initially screened, 3 mutant strains with increased enzyme activity were identified. Further precise enzyme activity determination was then performed on these mutants, and the specific results are shown in Table 4. Analysis determined that the reason the enzyme activity of the remaining 198 recombinant strains remained unchanged or decreased was due to a mutation at position 213 (valine (V) in which an amino acid other than Y, F, and P was replaced.

[0072] Table 4 Enzyme activity assay of the three-point mutant recombinant bacteria

[0073] The AdAAL mutant with the highest increase in enzyme activity, -D104T-K183N-V213F, was designated AdAAL-3, and recombinant bacteria were obtained. E.coli BL21(DE3) / pET28a-AdAAL-3.

[0074] Example 5 Construction and screening of AdAAL four-site mutants Site-directed mutagenesis primers were designed based on the mutant AdAAL-3 sequence constructed in Example 4. Using rapid PCR technology, a single mutation was introduced at position 248 using recombinant pET28a-AdAAL-3 as a template. The primers are as follows: Forward primer 248E: GCTTC NNN ATCTCTAGCATGGGCATTCGTGTT-SEQ ID NO.17; Reverse primer 248E: GCTAGAGAT NNN GAAGCTATCCTGCAGAACCGG- SEQ ID NO. 18.

[0075] PCR reaction system: 25 μL of 2×FastPfu Fly Reaction Mix, 2 μL of forward primer 248E (10 μM), 2 μL of reverse primer 248E (10 μM), 1 μL of template DNA, 1 μL of FastPfu Fly DNA Polymerase, and ddH2O added to a final volume of 50 μL.

[0076] PCR amplification conditions: 95℃ for 5 min; (95℃ for 20 s, 60℃ for 15 s, 72℃ for 1.5 min) 30 cycles; 72℃ for 10 min.

[0077] PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37°C for 1 h and then inactivated at 65°C for 1 min. 10 μL of the PCR product was then added to... E.coli In BL21(DE3) competent cells, heat shock transformation was performed, followed by incubation at 37°C and 200 rpm for 1 h. The bacterial culture was then plated and incubated at 37°C for 12 h. The mutants were then subjected to initial screening (the procedure was the same as "high-throughput screening of positive transformants" in Example 2).

[0078] The wet bacterial cells were ultrasonically disrupted, and their enzyme activity was accurately measured (the procedure was the same as in "Comparison of Recombinant Bacterial Enzyme Activity" in Example 1).

[0079] The results of this embodiment are as follows: Of the 215 recombinant transformant strains initially screened, 4 mutant strains with increased enzyme activity were identified. Further precise enzyme activity determination was then performed on these mutants, and the specific results are shown in Table 5. Analysis determined that the reason the enzyme activity of the remaining 211 recombinant strains remained unchanged or decreased was due to a mutation at position 248 (glutamic acid (E) in which an amino acid other than M, L, I, and K was replaced.

[0080] Table 5 Enzyme activity assay of the four-point mutant recombinant bacteria

[0081] The AdAAL mutant with the highest increase in enzyme activity, -D104T-K183N-V213F-E248L, was designated AdAAL-4, and recombinant bacteria were obtained. E.coli BL21(DE3) / pET28a-AdAAL-4.

[0082] Example 6 This example demonstrates the construction and screening of five-site mutants of AdAAL. Site-directed mutagenesis primers were designed based on the mutant AdAAL-4 sequence constructed in Example 5. Using rapid PCR technology, a single mutation was introduced at position 296 using recombinant pET28a-AdAAL-4 as a template. The primers are as follows: Forward primer 296G: TGGTATC NNN CAGTCCCGCCTGGCGATGCTGC- SEQ ID NO.19; Reverse primer 296G: GGGACTG NNN GATACCACCGCCGATGGTCTGA-SEQ ID NO. 20.

[0083] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 296G (10 μM) 2 μL, reverse primer 296G (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0084] PCR amplification conditions: 95℃ for 5 min; (95℃ for 20 s, 60℃ for 15 s, 72℃ for 1.5 min) 30 cycles; 72℃ for 10 min.

[0085] PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37°C for 1 h and then inactivated at 65°C for 1 min. 10 μL of the PCR product was then added to... E.coli In BL21(DE3) competent cells, heat shock transformation was performed, followed by incubation at 37°C and 200 rpm for 1 h. The bacterial culture was then plated and incubated at 37°C for 12 h. The mutants were then subjected to initial screening (the procedure was the same as "high-throughput screening of positive transformants" in Example 2).

[0086] The wet bacterial cells were ultrasonically disrupted, and their enzyme activity was accurately measured (the procedure was the same as in "Comparison of Recombinant Bacterial Enzyme Activity" in Example 1).

[0087] The results of this embodiment are as follows: Of the 196 recombinant transformant strains initially screened, 3 mutant strains with increased enzyme activity were identified. Further precise enzyme activity determination was then performed on these mutants, and the specific results are shown in Table 6. Analysis determined that the reason the enzyme activity of the remaining 193 recombinant strains remained unchanged or decreased was due to a mutation at position 296 (glycine (G) in which an amino acid other than V, M, and Q was replaced.

[0088] Table 6 Enzyme activity assay of the five-point mutant recombinant bacteria

[0089] The AdAAL mutant with the highest increase in enzyme activity, -D104T-K183N-V213F-E248L-G296M, was designated AdAAL-5, and recombinant bacteria were obtained. E.coli BL21(DE3) / pET28a-AdAAL-5.

[0090] Example 6 In this embodiment, nicotinamide is prepared by dual-enzyme coupling of aspartate amino ligase AdAAL and polyphosphate phosphotransferase PPT to nicotinic acid. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL and E.coli After BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL supernatant and PPT supernatant. In a 50 mL system, the following were added: bacterial AdAAL wet weight (added as supernatant) 2 g / L, bacterial PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, and transformation time 1 h.

[0091] HPLC analysis showed that the remaining nicotinic acid was 98.5 g / L, the nicotinamide yield was 1.4 g / L, and the nicotinamide yield was 1.4%.

[0092] Example 7 In this embodiment, nicotinamide is prepared by dual-enzyme coupling of aspartate amino ligase AdAAL-1 and polyphosphate phosphotransferase PPT to nicotinic acid. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL-1 and E.coliAfter BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL-1 supernatant and PPT supernatant. In a 50 mL system, the following were added: AdAAL-1 wet weight (added as supernatant) 2 g / L, PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, transformation time 1 h.

[0093] HPLC analysis showed that the remaining nicotinic acid was 96.3 g / L, the nicotinamide yield was 3.5 g / L, and the nicotinamide yield was 3.5%.

[0094] Example 8 In this embodiment, nicotinamide is prepared by dual-enzyme coupling of aspartate amino ligase AdAAL-2 and polyphosphate phosphotransferase PPT to nicotinic acid. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL-2 and E.coli After BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL-2 supernatant and PPT supernatant. In a 50 mL system, the following were added: AdAAL-2 wet weight (added as supernatant) 2 g / L, PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, and transformation time 1 h.

[0095] HPLC analysis showed that the remaining nicotinic acid was 91.5 g / L, the nicotinamide yield was 8.4 g / L, and the nicotinamide yield was 8.5%.

[0096] Example 9 In this embodiment, nicotinamide is prepared by dual-enzyme coupling of aspartate amino ligase AdAAL-3 and polyphosphate phosphotransferase PPT to nicotinic acid. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL-3 and E.coliAfter BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL-3 supernatant and PPT supernatant. In a 50 mL system, the following were added: AdAAL-3 wet weight (added as supernatant) 2 g / L, PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, transformation time 1 h.

[0097] HPLC analysis showed that the remaining nicotinic acid was 67.2 g / L, the nicotinamide yield was 32.9 g / L, and the nicotinamide yield was 33.2%.

[0098] Example 10 In this embodiment, nicotinamide is prepared by dual-enzyme coupling of aspartate amino ligase AdAAL-4 and polyphosphate phosphotransferase PPT to nicotinic acid. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL-4 and E.coli After BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL-4 supernatant and PPT supernatant. In a 50 mL system, the following were added: AdAAL-4 wet weight (added as supernatant) 2 g / L, PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, and transformation time 1 h.

[0099] HPLC analysis showed that the residual amount of nicotinic acid was 28.1 g / L, the yield of nicotinamide was 71.6 g / L, and the yield of nicotinamide was 72.3%.

[0100] Example 11 The preparation of nicotinamide from nicotinic acid via dual-enzyme coupling of aspartate amino ligase AdAAL-5 and polyphosphate phosphotransferase PPT. According to the induction expression method described in Example 1, E.coli BL21(DE3) / pET28a-AdAAL-5 and E.coliAfter BL21(DE3) / pET28a-PPT induction expression was completed, bacterial cells were collected. Following the ultrasonic disruption method described in Example 1, both bacterial cells were ultrasonically disrupted to obtain AdAAL-5 supernatant and PPT supernatant. In a 50 mL system, the following were added: AdAAL-5 wet weight (added as supernatant) 2 g / L, PPT wet weight (added as supernatant) 2 g / L, nicotinic acid 100 g / L, ATP 1 g / L, sodium polyphosphate 150 g / L, ammonium chloride 50 g / L, pH 8.0, temperature 30℃, shaker speed 200 rpm, and transformation time 1 h.

[0101] HPLC analysis showed that the remaining amount of nicotinic acid was almost undetectable, and the nicotinamide yield was 99.2 g / L, with a yield greater than 99.9%.

[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An aspartate ligase mutant, characterized in that, The aspartate ligase mutant was obtained by mutation based on the wild-type aspartate ligase shown in SEQ ID NO. 5; The mutation modes of the mutant include: the aspartic acid at position 104 is mutated to valine, asparagine, glutamic acid or threonine.

2. The aspartate ligase mutant according to claim 1, characterized in that, The mutation mode of the aspartate ligase mutant also includes mutation of at least one of the positions 183, 213, 248 and 296; Preferably, the lysine at position 183 is mutated to histidine, asparagine, methionine, serine, or leucine. Preferably, the valine at position 213 is mutated to tyrosine, phenylalanine, or proline; Preferably, the glutamic acid at position 248 is mutated to methionine, leucine, isoleucine, or lysine. Preferably, the glycine at position 296 is mutated into valine, methionine, or glutamine.

3. The aspartate ligase mutant according to claim 2, characterized in that, The mutation mode of the mutant is as follows: aspartic acid at position 104 is mutated to threonine, and lysine at position 183 is mutated to histidine, asparagine, methionine, serine, or leucine; or The mutation mode of the mutant is as follows: aspartic acid at position 104 is mutated to threonine, lysine at position 183 is mutated to asparagine, and valine at position 213 is mutated to tyrosine, phenylalanine, or proline; or The mutation mode of the mutant is as follows: aspartic acid at position 104 is mutated to threonine, lysine at position 183 is mutated to asparagine, valine at position 213 is mutated to phenylalanine, and glutamic acid at position 248 is mutated to methionine, leucine, isoleucine, or lysine; or The mutation mode of the mutant is as follows: aspartic acid at position 104 is mutated to threonine, lysine at position 183 is mutated to asparagine, valine at position 213 is mutated to phenylalanine, glutamic acid at position 248 is mutated to leucine, and glycine at position 296 is mutated to valine, methionine, or glutamine.

4. The aspartate ligase mutant according to claim 3, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.

7.

5. A biomaterial related to the aspartate ligase mutant according to any one of claims 1 to 4, characterized in that, It can be any one of the following (1)-(4): (1) A nucleic acid molecule encoding the aspartate ligase mutant according to any one of claims 1-4; (2) An expression cassette containing the nucleic acid molecule described in (1); (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (4) Recombinant bacteria containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

6. A method for preparing the aspartate ligase mutant according to any one of claims 1 to 4, characterized in that, include: The recombinant bacteria described in claim 5 are inoculated into a fermentation medium and cultured to obtain the aspartate ligase mutant.

7. The use of the aspartate ligase mutant according to any one of claims 1 to 4 or the biomaterial according to claim 5 in any one of the following: (1) Catalytic synthesis of nicotinic acid into nicotinamide; (2) Prepare products for the synthesis of nicotinamide from catalytic nicotinic acid.

8. A biocatalyst, characterized in that, Includes the aspartate ligase mutant according to any one of claims 1 to 4 or the recombinant bacteria according to claim 5; Preferably, the biocatalyst further includes polyphosphate phosphotransferase; Preferably, the amino acid sequence of the polyphosphate phosphotransferase is shown in SEQ ID NO.

9.

9. A method for catalytic synthesis of nicotinamide from nicotinic acid, characterized in that, include: Recombinant bacteria expressing the aspartate ligase mutant according to any one of claims 1 to 4, or their lysed supernatant, are added to a transformation system containing nicotinic acid to react and obtain nicotinamide.

10. The method according to claim 9, characterized in that, The transformation system contains the aspartate ligase mutant, polyphosphate phosphotransferase, nicotinic acid, ATP, ammonia source, and phosphate buffer. Preferably, the transformation system comprises: 10-1000 mM nicotinic acid, 0.1-3 mM ATP, 20-1200 mM NH4Cl, 2-180 g / L sodium polyphosphate, 0.2-5 g / L aspartate ligase mutant or wet cells, and 0.2-5 g / L polyphosphate phosphotransferase or wet cells; Preferably, the reaction conditions are: pH=7.5~8.0, temperature=30~40℃.