Improving production of phosphonate compounds in streptomyces based on genetic engineering strategies
By employing genetic engineering strategies, including gene cluster doubling and promoter engineering, the yield of phosphonic acid compounds in Streptomyces was increased, solving the problem of low yield in wild-type strains and achieving a significant increase in yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF SCI & TECH
- Filing Date
- 2026-02-13
- Publication Date
- 2026-06-05
AI Technical Summary
Wild-type strains suffer from problems such as being unculturable, having silenced biosynthetic gene clusters, and low yields of target products in the production of phosphonic acid compounds, which limits their widespread application.
Using a genetic engineering strategy, the target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into a vector and conjugated to construct a recombinant plasmid. By utilizing multicopy sites and strong promoter engineering, the copy number and transcription level of the gene cluster were increased, thereby enhancing the synthetic capacity of natural products.
It significantly increased the yield of phosphonic acid compound NC47-5, up to 9.1 times, solving the problem of low yield and laying the foundation for subsequent separation and purification.
Smart Images
Figure CN122146736A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology and relates to a method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies. Background Technology
[0002] With the increasing application of natural products in pharmaceuticals, agriculture, and environmental protection, phosphonic acid compounds, as an important class of natural products, possess extremely high metabolic stability and bioavailability in organisms due to their unique carbon-phosphorus (CP) bond structure, making them a key area of research and development. Phosphonic acid compounds, such as fosfomycin, glufosinate, and FR900098, exhibit significant biological activities, including antibacterial, antitumor, and antiparasitic effects. Fosfomycin, as a classic carbon-phosphorus antibiotic, remains an important drug for treating drug-resistant bacterial infections, while glufosinate is widely used in agriculture as a green pesticide for pest and disease control, with huge market demand.
[0003] However, in the production of phosphonic acid compounds, wild-type strains often face challenges such as being unculturable, having silenced biosynthetic gene clusters, and experiencing low yields of target products, which limit their widespread application. Therefore, there is an urgent need for a method to increase the yield of phosphonic acid compounds. Summary of the Invention
[0004] The purpose of this invention is to overcome the defects of silenced or low expression of related genes in wild fungi, and to provide a genetic engineering strategy to increase the yield of phosphonic acid compounds in Streptomyces.
[0005] The objective of this invention can be achieved through the following technical solutions: The technical solution of this invention is to provide a method for increasing the yield of phosphonic acid compounds in Streptomyces based on a genetic engineering strategy, selected from any one or a combination of two of the following steps S1-1 to S1-3 or S2-1 to S2-3: S1-1. The target gene cluster expressing phosphonic acid compound NC47-5 was cloned into the vector to construct a recombinant plasmid expressing phosphonic acid compound NC47-5. S1-2. Transform the recombinant plasmid obtained in step S1-1 into Escherichia coli and conjugate it with Streptomyces containing multiple copy sites to obtain recombinant bacteria expressing the phosphonic acid compound NC47-5. S1-3. Ferment and culture the recombinant bacteria obtained in step S1-2 to increase the yield of phosphonic acid compound NC47-5. S2-1. The target gene cluster expressing the phosphonic acid compound NC47-5 is cloned into the vector, and the promoter is... kasOp* Cloned to the target gene cluster YqcI / YcgGRecombinant plasmids expressing the phosphonic acid compound NC47-5 were constructed by pre-gene and / or pre-Asparagine synthetase gene. S2-2, Transform the recombinant plasmid obtained in step S2-1 into Escherichia coli and conjugate it with Streptomyces to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5; S2-3. Ferment and culture the recombinant bacteria obtained in step S2-2 to increase the yield of phosphonic acid compound NC47-5.
[0006] In some specific embodiments, steps S1-1 and S2-1 involve using ExoCET recombination technology to clone the target gene cluster expressing the phosphonic acid compound NC47-5 into the p15A backbone vector.
[0007] Preferably, in steps S1-1 and S2-1, the target gene cluster expressing the phosphonic acid compound NC47-5 is cloned into the p15A backbone vector using ExoCET recombination technology. SacII Enzyme cleavage site.
[0008] In some specific embodiments, the nucleotide sequence of the p15A backbone vector is shown in SEQ ID NO.1.
[0009] In some specific embodiments, in steps S1-1 and S2-1, the recombinant plasmid is further integrated with a conjugation transfer element.
[0010] In some specific embodiments, the conjugation transfer element is a ΦC31 integrase system.
[0011] Preferably, the bonding transfer element is cloned onto the p15A skeleton carrier. SpeI Enzyme cleavage site.
[0012] In some specific embodiments, steps S1-2 and S2-2, the method for constructing recombinant bacteria expressing phosphonic acid compound NC47-5, is as follows: transforming Escherichia coli with the recombinant plasmid to obtain Escherichia coli carrying the recombinant plasmid; performing triparental conjugation transfer of Escherichia coli carrying the recombinant plasmid, Escherichia coli carrying the pUB307 plasmid, and Streptomyces to construct recombinant bacteria.
[0013] In some specific embodiments, in step S1-2, the Streptomyces containing multiple copy sites is... Streptomyces albus B4.
[0014] In some specific implementations, the fermentation process in steps S1-3 and S2-3 is as follows: The recombinant bacteria were first inoculated into TSB medium and cultured at 30°C and 220 rpm to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium and cultured at 30°C.
[0015] In some specific embodiments, in step S2-1, the promoter kasOp* The nucleotide sequence is shown in SEQ ID NO.2.
[0016] In some specific embodiments, in step S2-2, the Streptomyces is... Streptomyces albus J1074.
[0017] Compared with the prior art, the present invention has the following advantages: This invention improves the yield of the phosphonic acid natural product NC47-5 by doubling the target gene cluster expressing the phosphonic acid compound NC47-5 and / or by adding a strong promoter through promoter engineering, with a maximum increase of 9.1 times, laying the foundation for further isolation and purification.
[0018] The gene cluster doubling strategy employed in this invention involves targeting the gene cluster in Streptomyces containing multiple copy sites. Streptomyces albus Heterologous expression in B4 increases the copy number of gene clusters related to the synthesis of the target natural product, further enhancing the synthetic capacity of the natural product. The synthesis of natural products typically depends on enzymes and regulatory factors in multiple gene clusters, and doubling the gene clusters can effectively increase the expression of key enzymes, increase the throughput of the synthetic pathway, and thus increase the total yield of the product.
[0019] The promoter engineering technique used in this invention is a technology for precisely regulating gene expression. By modifying the gene promoter region, the transcription level of the target gene can be effectively improved, thereby activating silent gene clusters and increasing yield. Attached Figure Description
[0020] Figure 1 This is a comparison of two-dimensional NMR data in Example 1.
[0021] Figure 2 The nuclear magnetic resonance spectrum of NC47-5, a phosphonic acid compound, was obtained in Example 2 by using a target gene cluster doubling strategy. 31 P NMR data graph.
[0022] Figure 3 The nuclear magnetic resonance spectra of NC47-5, a phosphonic acid compound, were obtained in Examples 3 and 4 by adding a strong promoter to improve its yield. 31 P NMR data graph.
[0023] Figure 4The diagram shows the target gene cluster and the promoter addition locations in Examples 3 and 4. Detailed Implementation
[0024] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are implemented based on the technical solution of the present invention, providing detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0026] Unless otherwise specified, the materials and processes used in the following embodiments and Comparative Example 1 are conventional materials and processes used in the art to achieve the corresponding functions.
[0027] (1) PEP17 liquid culture medium: Weigh out 30 g, 5 g, 10 g, 10 g, 2 g, 2 g, 3 g, 0.1 g, 0.01 g, 0.001 g, and 0.0001 g of anhydrous glucose, peptone, dry yeast, soybean meal, potassium dihydrogen phosphate, sodium chloride, calcium carbonate, anhydrous magnesium sulfate, ferrous sulfate, nickel chloride, and cobalt chloride respectively. Make up to 1 L with deionized water and finally add 8% soybean oil by volume.
[0028] (2) TSB medium: Weigh 17.0g tryptone, 3.0g soybean peptone, 2.5g dipotassium hydrogen phosphate, 5.0g sodium chloride and 2.5g glucose respectively, and make up to 1 L with deionized water. The final pH is 7.3±0.2.
[0029] (3) All Streptomyces involved in this invention are derived from publicly available information: Streptomyces albus B4 is from the literature DOI: 10.1021 / acs.jafc.4c02463; Streptomyces albus J1074 is derived from the literature DOI: 10.1111 / 1751-7915.12116; Streptomyces albus B2P1 is derived from the literature DOI: 10.1016 / j.ymben.2018.09.004.
[0030] (4) p15A backbone vector, the nucleotide sequence of which is shown in SEQ ID NO.1: (5) Strong promoter kasOp* The nucleotide sequence is shown in SEQ ID NO.2: GGAACGATCGTTGGCTGTGTTCACATTCGAACCGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGGTATCTGAAAGGGGATACGC Example 1: Identification of phosphonic acid compound NC47-5 as a novel product for the expression of the target gene cluster. Constructing Streptomyces expressing target gene clusters Streptomyces albus J1074 includes the following steps: (1) The target gene cluster NC47 was cloned into the p15A backbone vector (nucleotide sequence as shown in SEQ ID NO.1) using ExoCET recombination technology. SacII The recombinant plasmid p15A-NC47 was constructed by cutting the enzyme sites; subsequently, the conjugation transfer element ΦC31 integrase system was integrated into the p15A backbone vector (nucleotide sequence shown in SEQ ID NO.1) using Redαβ recombination technology. SpeI Recombinant plasmid p15A-NC47-M was constructed by identifying restriction enzyme sites. The recombinant plasmid p15A-NC47-M was then transformed into *E. coli* to obtain *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-M, denoted as [insert species here]. E.coli DH 10B:: p15A-NC47-M.
[0031] (2) E.coli DH 10B:: p15A-NC47-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus J1074 underwent triparental conjugation transfer to obtain recombinant bacteria, denoted as... S. albus J1074::p15A-NC47; (3) S. albus J1074:: p15A-NC47 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0032] Simultaneously, Streptomyces expressing the p15A backbone vector were constructed. Streptomyces albus J1074 includes the following steps: (1) The p15A backbone vector (nucleotide sequence as shown in SEQ ID NO.1) was transformed into Escherichia coli to obtain Escherichia coli carrying the recombinant plasmid p15A-M, denoted as E.coliDH 10B:: p15A-M.
[0033] (2) E.coli DH 10B:: p15A-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus J1074 underwent triparental conjugation transfer to obtain recombinant bacteria, denoted as... S. albus J1074::p15A-M; (3) S. albus J1074:: p15A-M was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0034] The results are as follows Figure 1 As shown in the figure below (PEP_ S. albus Compared to J1074(p15A-M)), the above figure (PEP_ S . albus J1074(NC47-M) produced a new phosphonic acid compound, NC47-5.
[0035] Example 2: This embodiment provides a method for increasing the yield of the phosphonic acid compound NC47-5 through a target gene cluster doubling strategy, including the following steps: (1) The target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A backbone vector (nucleotide sequence as shown in SEQ ID NO.1) using the ExoCET recombination technology. SacII By identifying the restriction enzyme sites, the recombinant plasmid p15A-NC47 expressing the phosphonic acid compound NC47-5 was constructed. Subsequently, the conjugation transfer element ΦC31 integrase system was integrated into the p15A backbone vector (nucleotide sequence shown in SEQ ID NO.1) using Redαβ recombination technology. SpeI Recombinant plasmid p15A-NC47-M was constructed by identifying restriction enzyme sites. The recombinant plasmid p15A-NC47-M was then transformed into *E. coli* to obtain *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-M, denoted as [insert species here]. E.coli DH 10B:: p15A-NC47-M.
[0036] (2) E.coli DH 10B:: p15A-NC47-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus B4 underwent triparental conjugation transfer to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5, denoted as B4. S. albus B4:: p15A-NC47; (3) S. albus B4:: p15A-NC47 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0037] The results are as follows Figure 2 As shown, this embodiment (PEP17_) S. albus The yield of the phosphonic acid compound NC47-5 from B4(NC47-M) was 0.82 mg / L, significantly higher than that of conventional Streptomyces chassis such as... S. albus Comparative Example 1 of J1074 (PEP17_ S . albus J1074(NC47-M)) produced 0.09 mg / L of the phosphonic acid compound NC47-5 and other multicopyable Streptomyces chassis such as S. albus Comparative Example 2 of B2P1 (PEP17_) S. albus The yield of phosphonic acid compound NC47-5 of B2P1(NC47-M) was 0 mg / L.
[0038] Example 3: This embodiment provides a method for enhancing expression by adding a promoter. YqcI / YcgG A gene-based strategy to increase the yield of the phosphonic acid compound NC47-5 includes the following steps: (1) The target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A backbone vector (nucleotide sequence as shown in SEQ ID NO.1) using the ExoCET recombination technology. SacII By identifying the restriction enzyme sites, the recombinant plasmid p15A-NC47 expressing the phosphonic acid compound NC47-5 was constructed. Subsequently, the conjugation transfer element ΦC31 integrase system was integrated into the p15A backbone vector (nucleotide sequence shown in SEQ ID NO.1) using Redαβ recombination technology. SpeI Restriction sites were identified, and recombinant plasmid p15A-NC47-M was constructed. The strong promoter was then recombined using RecET and Redαβ recombination techniques. kasOp* (Denotes it as k1) Add to the target gene cluster YqcI / YcgG Before gene expression, a recombinant plasmid p15A-NC47-k1-M was constructed to enhance gene expression. This plasmid p15A-NC47-k1-M was then transformed into *E. coli*, yielding *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-k1-M, denoted as . E.coli DH 10B:: p15A-NC47-k1-M.
[0039] like Figure 4As shown, this is the insertion site for the k1 promoter.
[0040] (2) E.coli DH 10B:: p15A-NC47-k1-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus J1074 underwent triparental conjugation transfer to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5, denoted as J1074. S. albus J1074:: p15A-NC47-k1.
[0041] (3) S. albus B4:: p15A-NC47-k1 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0042] like Figure 3 As shown, this embodiment (PEP17_) S. albus The yield of the phosphonic acid compound NC47-5 from J1074(NC47-k1-M) was 0.62 mg / L, significantly higher than that of the comparative example 1 (PEP17_) without a promoter. S. albus Yield of phosphonic acid compound NC47-5 (J1074(NC47-M)).
[0043] Example 4: This embodiment provides a method for increasing the yield of the phosphonic acid compound NC47-5 by adding a promoter to enhance the expression of the Asparagine synthetase gene, including the following steps: (1) The target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A backbone vector (nucleotide sequence as shown in SEQ ID NO.1) using the ExoCET recombination technology. SacII By identifying the restriction enzyme sites, the recombinant plasmid p15A-NC47 expressing the phosphonic acid compound NC47-5 was constructed. Subsequently, the conjugation transfer element ΦC31 integrase system was integrated into the p15A backbone vector (nucleotide sequence shown in SEQ ID NO.1) using Redαβ recombination technology. SpeI Restriction sites were identified, and recombinant plasmid p15A-NC47-M was constructed. The strong promoter was then recombined using RecET and Redαβ recombination techniques. kasOp*(Derived as k2) This plasmid was added to the target gene cluster before the Asparagine synthetase gene to enhance its expression, resulting in the recombinant plasmid p15A-NC47-k2-M. The recombinant plasmid p15A-NC47-k2-M was then transformed into *E. coli* to obtain *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-k2-M, denoted as... E.coli DH 10B:: p15A-NC47-k2-M.
[0044] like Figure 4 As shown, this is the insertion site for the k2 promoter.
[0045] (2) E.coli DH 10B:: p15A-NC47-k2-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus J1074 underwent triparental conjugation transfer to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5, denoted as J1074. S. albus J1074:: p15A-NC47-k2; (3) S. albus B4:: p15A-NC47-k2 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0046] like Figure 3 As shown, this embodiment (PEP17_) S. albus The yield of the phosphonic acid compound NC47-5 from J1074(NC47-k2-M) was 0.91 mg / L, significantly higher than that of comparative example 1 (PEP17_) without a promoter. S. albus Yield of phosphonic acid compound NC47-5 (J1074(NC47-M)).
[0047] Comparative Example 1: Compared with Example 1, most of them are the same, the difference being that the Streptomyces in step (2) is used instead. Streptomyces albus B4 was replaced with Streptomyces. Streptomyces albus J1074, the specific steps are as follows: (1) The target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A plasmid using the ExoCET recombination technology. SacII By identifying enzyme cleavage sites, a recombinant plasmid p15A-NC47 expressing the phosphonic acid compound NC47-5 was constructed. Subsequently, the ΦC31 integrase system, a conjugation transfer element, was integrated into the p15A plasmid using Redαβ recombination technology. SpeIRecombinant plasmid p15A-NC47-M was constructed by identifying restriction enzyme sites. The recombinant plasmid p15A-NC47-M was then transformed into *E. coli* to obtain *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-M, denoted as [insert species here]. E.coli DH 10B:: p15A-NC47-M.
[0048] (2) E.coli DH 10B:: p15A-NC47-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus J1074 underwent triparental conjugation transfer to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5, denoted as J1074. S. albus J1074:: p15A-NC47; (3) S. albus J1074:: p15A-NC47 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0049] Comparative Example 2: Compared with Example 1, most of them are the same, the difference being that the Streptomyces in step (2) is used instead. Streptomyces albus B4 was replaced with another Streptomyces strain containing multiple copy sites. Streptomyces albus B2P1, the specific steps are as follows: (1) The target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A plasmid using the ExoCET recombination technology. SacII By identifying enzyme cleavage sites, a recombinant plasmid p15A-NC47 expressing the phosphonic acid compound NC47-5 was constructed. Subsequently, the ΦC31 integrase system, a conjugation transfer element, was integrated into the p15A plasmid using Redαβ recombination technology. SpeI Recombinant plasmid p15A-NC47-M was constructed by identifying restriction enzyme sites. The recombinant plasmid p15A-NC47-M was then transformed into *E. coli* to obtain *E. coli* bacteria carrying the recombinant plasmid p15A-NC47-M, denoted as [insert species here]. E.coli DH 10B:: p15A-NC47-M.
[0050] (2) E.coli DH 10B:: p15A-NC47-M, Escherichia coli and Streptomyces carrying pUB307 Streptomyces albus B2P1 underwent triparental conjugation transfer to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5, denoted as... S. albus B2P1:: p15A-NC47; (3)S. albus B2P1:: p15A-NC47 was inoculated into TSB medium and cultured at 30℃ and 220rpm for 2 days to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium at an inoculation rate of 2.5% and cultured at 30℃ for 7 days.
[0051] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.
Claims
1. A method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies, characterized in that, Choose any one or a combination of two of the following steps S1-1 to S1-3 or S2-1 to S2-3: S1-1. The target gene cluster expressing phosphonic acid compound NC47-5 was cloned into the vector to construct a recombinant plasmid expressing phosphonic acid compound NC47-5. S1-2. Transform the recombinant plasmid obtained in step S1-1 into Escherichia coli and conjugate it with Streptomyces containing multiple copy sites to obtain recombinant bacteria expressing the phosphonic acid compound NC47-5. S1-3. Ferment and culture the recombinant bacteria obtained in step S1-2 to increase the yield of phosphonic acid compound NC47-5. S2-1. The target gene cluster expressing the phosphonic acid compound NC47-5 is cloned into the vector, and the promoter is... kasOp* Cloned to the target gene cluster YqcI / YcgG Recombinant plasmids expressing the phosphonic acid compound NC47-5 were constructed by pre-gene and / or pre-Asparagine synthetase gene. S2-2, Transform the recombinant plasmid obtained in step S2-1 into Escherichia coli and conjugate it with Streptomyces to obtain a recombinant bacterium expressing the phosphonic acid compound NC47-5; S2-3. Ferment and culture the recombinant bacteria obtained in step S2-2 to increase the yield of phosphonic acid compound NC47-5.
2. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, In steps S1-1 and S2-1, the target gene cluster expressing the phosphonic acid compound NC47-5 was cloned into the p15A backbone vector using ExoCET recombination technology.
3. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, In steps S1-1 and S2-1, the nucleotide sequence of the p15A backbone vector is shown in SEQ ID NO.
1.
4. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, In steps S1-1 and S2-1, the recombinant plasmid also integrates a binding transfer element.
5. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 4, characterized in that, The conjugation transfer element is the ΦC31 integrase system.
6. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, Steps S1-2 and S2-2 describe the construction method of recombinant bacteria expressing the phosphonic acid compound NC47-5 as follows: the recombinant plasmid is transformed into Escherichia coli to obtain Escherichia coli carrying the recombinant plasmid; the Escherichia coli carrying the recombinant plasmid, the Escherichia coli carrying the pUB307 plasmid, and Streptomyces are then transferred using a triparental conjugation method to construct the recombinant bacteria.
7. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, In step S1-2, the Streptomyces containing multiple copy sites is... Streptomycesalbus B4.
8. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, The fermentation process for steps S1-3 and S2-3 is as follows: The recombinant bacteria were first inoculated into TSB medium and cultured at 30°C and 220 rpm to obtain seed culture solution. The seed culture solution was then inoculated into PEP17 liquid medium and cultured at 30°C.
9. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, Step S2-1, the promoter kasOp* The nucleotide sequence is shown in SEQ ID NO.
2.
10. The method for increasing the yield of phosphonic acid compounds in Streptomyces based on genetic engineering strategies according to claim 1, characterized in that, In step S2-2, the Streptomyces is... Streptomycesalbus J1074.