A method for removing chaperone proteins and uses thereof

By using a combination of urea and KCl washing solution to remove approximately 60 kDa of chaperone protein from Arctic Express host bacteria, the problem of low purity during purification was solved, achieving efficient purification and quality improvement of recombinant proteins.

CN122145550APending Publication Date: 2026-06-05SHANGHAI SIXIN PHARM TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610574522.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-28
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

In the prior art, the approximately 60 kDa chaperone protein expressed by the Arctic Express host bacterium is easily captured along with the target recombinant protein during purification, resulting in low purity. Furthermore, conventional methods are difficult to remove it effectively, affecting the purity and quality of the recombinant protein.

Method used

The affinity chromatography column was washed with a wash buffer containing urea and KCl to remove approximately 60 kDa chaperone protein bound to the target recombinant protein. A multi-step purification process was then performed using binding buffer, wash buffer, and elution buffer.

Benefits of technology

It effectively removes various recombinant protein chaperone proteins of different molecular weights, significantly improves the purity of recombinant proteins, is easy to operate and low in cost, and is suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122145550A_ABST
    Figure CN122145550A_ABST
Patent Text Reader

Abstract

The application discloses a method for removing chaperone and application thereof. The method for removing chaperone comprises the following steps: after a sample containing a target recombinant protein is loaded on an affinity chromatography column, a washing liquid containing urea and KCl is used to flush the affinity chromatography column, so as to remove the chaperone combined with the target recombinant protein. The method of the application can effectively remove the chaperone of about 60 kDa from an escherichia coli host bacterium by combined washing of urea and KCl, and has the advantages of simple operation, low cost, good chaperone removal effect for various recombinant proteins with different molecular weights, wide universality, and the like, and can significantly improve the purity and quality of the recombinant protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medical testing technology and relates to a method for removing chaperone proteins and its application. Background Technology

[0002] Escherichia coli is one of the most commonly used hosts for recombinant protein expression, and many proteins readily form inclusion bodies during expression in E. coli. The Arctic Express cell line developed by Agilent Technologies can continue to survive and produce proteins at temperatures as low as 12°C, largely solving the protein solubility problem. However, the approximately 60 kDa chaperone protein expressed by the Arctic Express host bacteria is easily captured by affinity chromatography columns along with the target recombinant protein during purification, resulting in low purity of the final product and affecting yield, structure determination, optimal activity, and desired function.

[0003] There are many methods to reduce the formation of inclusion bodies during recombinant protein expression in *E. coli*. One method is to use host bacteria that express chaperone proteins, which are generally considered to assist in the folding of the target protein. For example, Novagen has developed the BL21(DE3) host bacterium, and Takara has developed a series of host bacteria such as pG-KJE8 / BL21, pGro7 / BL21, pKJE7 / BL21, pG-Tf2 / BL21, and pTf16 / BL21. BL21(DE3) expresses GroEL and GroES chaperone proteins. If these chaperone proteins co-purify with the target protein, the problem of chaperone protein residue can be solved by adding additional elution methods. For example, a combination solution of magnesium ions and adenosine triphosphate can elute and remove GroEL / GroES chaperone proteins.

[0004] At a low temperature of 12°C, BL21(DE3) hardly grows, but the Arctic Express host bacteria can effectively express the target protein at this temperature. Therefore, many recombinant protein expressions use Arctic Express. However, the approximately 60 kDa chaperone protein expressed by Arctic Express is easily captured along with the target protein during purification, reducing protein purity. Conventional elution with magnesium ions and adenosine triphosphate is completely ineffective in removing this 60 kDa chaperone protein. Chaperone proteins typically bind to the target protein, exhibiting protein-protein interactions, making them difficult to remove effectively in subsequent ion exchange or molecular sieve chromatography steps. Researchers have tried many methods, but these are at best specific to a particular protein, with significant limitations and restricted versatility.

[0005] Therefore, developing a simple and universal method that can effectively remove host bacteria-derived chaperone proteins is of great significance for improving the purity and quality of recombinant proteins. Summary of the Invention

[0006] In response to the shortcomings of existing technologies and practical needs, this invention provides a method for removing chaperone proteins and its application, in order to solve the problem that chaperone proteins derived from host bacteria are difficult to remove effectively and affect the purity of recombinant proteins in existing technologies.

[0007] To achieve this objective, the present invention employs the following technical solution: In a first aspect, the present invention provides a method for removing chaperone proteins, the method comprising: loading a sample containing a target recombinant protein onto an affinity chromatography column, and then rinsing the affinity chromatography column with a washing solution containing urea and KCl to remove the chaperone proteins bound to the target recombinant protein.

[0008] The method of this invention, through washing with a combination of urea and KCl, can effectively remove approximately 60 kDa chaperone proteins from Escherichia coli host bacteria. It is simple to operate, low in cost, and has good chaperone protein removal effect on various recombinant proteins of different molecular weights. It has wide applicability and can significantly improve the purity and quality of recombinant proteins.

[0009] Preferably, the final concentration of urea in the washing solution is 1-5 M, for example, 1 M, 2 M, 3 M, 4 M or 5 M.

[0010] Preferably, the final concentration of KCl in the washing solution is 0.1-0.5 M, for example, 0.1 M, 0.2 M, 0.3 M, 0.4 M or 0.5 M.

[0011] Preferably, the amount of washing solution used is the column volume of 5-10 affinity chromatography columns, such as the column volume of 5 affinity chromatography columns, the column volume of 8 affinity chromatography columns, or the column volume of 10 affinity chromatography columns.

[0012] Preferably, the affinity chromatography column is a nickel ion affinity chromatography column.

[0013] Preferably, the rinsing further includes rinsing the affinity chromatography column sequentially with binding buffer, rinsing buffer, and elution buffer.

[0014] Preferably, the binding buffer contains Tris-HCl at a final concentration of 25-75 mM (e.g., 25 mM, 50 mM, or 75 mM), NaCl at a final concentration of 100-200 mM (e.g., 100 mM, 150 mM, or 200 mM), and imidazole at a final concentration of 10-50 mM (e.g., 10 mM, 25 mM, or 50 mM).

[0015] Preferably, the rinsing buffer contains Tris-HCl at a final concentration of 25-75 mM (e.g., 25 mM, 50 mM, or 75 mM), NaCl at a final concentration of 100-200 mM (e.g., 100 mM, 150 mM, or 200 mM), and imidazole at a final concentration of 10-50 mM (e.g., 10 mM, 25 mM, or 50 mM).

[0016] Preferably, the elution buffer contains Tris-HCl at a final concentration of 25-75 mM (e.g., 25 mM, 50 mM, or 75 mM), NaCl at a final concentration of 100-200 mM (e.g., 100 mM, 150 mM, or 200 mM), and imidazole at a final concentration of 200-500 mM (e.g., 200 mM, 250 mM, or 500 mM).

[0017] Preferably, the amounts of the binding buffer, rinsing buffer, and elution buffer are each independently equal to the column volume of 3-5 affinity chromatography columns.

[0018] As a preferred technical solution, the method for removing chaperone proteins according to the present invention includes the following steps: (1) Lyse the host bacteria expressing the target recombinant protein and collect the supernatant of the lysate; (2) Load the supernatant of the lysis buffer obtained in step (1) onto the affinity chromatography column; (3) The affinity chromatography column is washed with a washing solution containing 1-5 M urea and 0.1-0.5 M KCl, the amount of which is 5-10 column volumes of the affinity chromatography column. (4) The affinity chromatography column is washed sequentially with binding buffer, washing buffer and elution buffer and the target recombinant protein is collected. The amount of binding buffer and washing buffer used is independently 3-5 column volumes of affinity chromatography column. The binding buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 10-50 mM. The washing buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 10-50 mM. The elution buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 200-500 mM.

[0019] Secondly, the present invention provides the application of the method for removing chaperone proteins described in the first aspect in the purification of recombinant proteins.

[0020] Compared with the prior art, the present invention has the following beneficial effects: (1) The method of the present invention can effectively remove the approximately 60 kDa chaperone protein from the host bacteria for various recombinant proteins of different molecular weights (20 kDa, 30 kDa, 50 kDa), and has wide applicability; (2) The method of the present invention can effectively remove chaperone proteins that bind to the target recombinant protein and significantly improve the purity of the target protein; (3) The method of the present invention is easy to operate and promote, and the reagents used are inexpensive and suitable for industrial production. Attached Figure Description

[0021] Figure 1 The image shows an SDS-PAGE electrophoresis result of the recombinant protein purification process in Example 1. Lane 1: whole cell lysis buffer; Lane 2: lysate supernatant; Lane 3: nickel column flow-through; Lane 4: elution with 2 M urea + 0.2 M KCl; Lane 5: rinsing with 20 mM imidazole; Lane 6: elution with 300 mM imidazole.

[0022] Figure 2 The image shows an SDS-PAGE electrophoresis result of the recombinant protein purification process in Example 2. Lane 1: whole cell lysis buffer; Lane 2: lysate supernatant; Lane 3: nickel column flow-through; Lane 4: elution with 1 M urea + 0.1 M KCl; Lane 5: rinsing with 20 mM imidazole; Lane 6: elution with 300 mM imidazole.

[0023] Figure 3 The image shows an SDS-PAGE electrophoresis result of the recombinant protein purification process in Example 3. Lane 1: lysate supernatant; Lane 2: nickel column flow-through; Lane 3: elution with 5 M urea + 0.5 M KCl; Lane 4: rinsing with 20 mM imidazole; Lane 5: elution with 300 mM imidazole. Detailed Implementation

[0024] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0025] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0026] The buffer formulation used in the examples is as follows: Lysis buffer: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0.

[0027] Binding buffer: 50 mM Tris-HCl, 150 mM NaCl, 5 mM imidazole, pH 8.0.

[0028] Washing buffer: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0.

[0029] Elution buffer: 50 mM Tris-HCl, 150 mM NaCl, 300 mM imidazole, pH 8.0.

[0030] Example 1 This example demonstrates the purification of a 50 kDa recombinant protein.

[0031] 1. Construction of recombinant plasmids The pET-28a recombinant plasmid with the target gene (SEQ ID NO.1) N-terminus tagged with histidine was synthesized by Qingke Biotechnology Co., Ltd. The recombinant protein is about 50 kDa in size.

[0032] HUMAN-ENOG (SEQ ID NO.1):

[0033] 2. Recombinant protein expression (1) The recombinant plasmid was transformed into the Escherichia coli Arctic Express expression host to obtain the expression bacteria.

[0034] (2) Inoculate the overnight cultured strain at a rate of 5% into a shake flask containing LB liquid medium, and incubate at 37°C and 225 rpm with shaking until OD. 600 It is 0.4-0.6.

[0035] (3) Set the temperature of the incubator to 12℃ and 225 rpm, and shake for 3 h.

[0036] (4) After 3 h, add 1 mM IPTG to induce incubation and continue to incubate at 12℃ for 16 h.

[0037] (5) On the second day, centrifuge and discard the LB medium, and collect the well-expressed bacterial cells.

[0038] 3. Recombinant protein purification (1) Take out the expressed Arctic Express cells from the -80℃ ultra-low temperature freezer and resuspend the cells in 10 times the volume of pre-cooled lysis buffer to completely resuspend the cells.

[0039] (2) Place the beaker containing the suspension from step (1) into an ice-water mixture and put it into an ultrasonic disruptor. The total ultrasonic disruption time is 30 min.

[0040] (3) Transfer the lysate after sonication in step (2) to a pre-cooled centrifuge tube, centrifuge at 4°C and 16,000 rpm for 30 min, and collect the supernatant after centrifugation.

[0041] (4) Ni Excel packing is placed in the gravity column, and the column is rinsed with binding buffer for 3 column volumes to balance the gravity column.

[0042] (5) Add the supernatant after centrifugation in step (3) to the balanced gravity column. The supernatant flows through the packing material under the action of gravity and the flow-through liquid is collected below the gravity column.

[0043] (6) Rinse the affinity column with 5 column volumes of washing buffer (the final concentration of urea in the washing buffer is 2 M and the final concentration of KCl is 0.2 M).

[0044] (7) Rinse 3 column volumes with binding buffer.

[0045] (8) Rinse 3 column volumes with rinsing buffer.

[0046] (9) Wash with elution buffer for 3 column volumes to elute the target protein.

[0047] 4. Results The SDS-PAGE electrophoresis results of the purified product are as follows: Figure 1 As shown in the figure. The results show that after washing and elution using the method of the present invention, approximately 60 kDa of chaperone protein was effectively removed, and the purity of the target recombinant protein was significantly improved.

[0048] Example 2 Purification of 30 kDa recombinant protein.

[0049] 1. Construction of recombinant plasmids The pET-28a recombinant plasmid with the target gene (SEQ ID NO.2) N-terminus tagged with histidine was synthesized by Qingke Biotechnology Co., Ltd. The recombinant protein is about 30 kDa in size.

[0050] MOUSE-STING (SEQ ID NO.2): .

[0051] 2. Recombinant protein expression (1) The recombinant plasmid was transformed into the Escherichia coli Arctic Express expression host to obtain the expression bacteria.

[0052] (2) Inoculate the overnight cultured strain at a rate of 5% into a shake flask containing LB liquid medium, and incubate at 37°C and 225 rpm with shaking until OD. 600 It is 0.4-0.6.

[0053] (3) Set the temperature of the incubator to 12℃ and 225 rpm, and shake for 3 h.

[0054] (4) After 3 hours, add 1 mM IPTG to induce incubation and continue to incubate at 12°C for 16 hours.

[0055] (5) On the second day, centrifuge and discard the LB medium, and collect the well-expressed bacterial cells.

[0056] 3. Recombinant protein purification (1) Take out the expressed Arctic Express cells from the -80℃ ultra-low temperature freezer and resuspend the cells in 10 times the volume of pre-cooled lysis buffer to completely resuspend the cells.

[0057] (2) Place the beaker containing the suspension from step (1) into an ice-water mixture and put it into an ultrasonic disruptor. The total ultrasonic disruption time is 30 min.

[0058] (3) Transfer the lysate after sonication in step (2) to a pre-cooled centrifuge tube, centrifuge at 4°C and 16,000 rpm for 30 min, and collect the supernatant after centrifugation.

[0059] (4) Ni Excel packing is placed in the gravity column, and the column is rinsed with binding buffer for 3 column volumes to balance the gravity column.

[0060] (5) Add the supernatant after centrifugation in step (3) to the balanced gravity column. The supernatant flows through the packing material under the action of gravity and the flow-through liquid is collected below the gravity column.

[0061] (6) Rinse the affinity column with 5 column volumes of washing buffer (the final concentration of urea in the washing buffer is 1 M and the final concentration of KCl is 0.1 M).

[0062] (7) Rinse 3 column volumes with binding buffer.

[0063] (8) Rinse 3 column volumes with rinsing buffer.

[0064] (9) Wash with elution buffer for 3 column volumes to elute the target protein.

[0065] 4. Results The SDS-PAGE electrophoresis results of the purified product are as follows: Figure 2 As shown in the figure. The results show that after washing and elution using the method of the present invention, approximately 60 kDa of chaperone protein was effectively removed, and the purity of the target recombinant protein was significantly improved.

[0066] Example 3 Purification of 20 kDa recombinant protein 1. Construction of recombinant plasmids The pET-28a recombinant plasmid with the target gene (SEQ ID NO.3) N-terminus tagged with histidine was synthesized by Qingke Biotechnology Co., Ltd. The recombinant protein is about 20 kDa in size.

[0067] MOUSEIL1RA (SEQ ID NO.3): ATGGGTCACCACCACCACCATCACGGTTCCGGTTCTGGTGAGAACCTGTACTTCCAGGGTAGAATCTGGGATACTAACCAGAAGACCTTTTACCTGAGAAACAACCAGCTCATTGCTGGGTACTTACAAGGACCAAATATCAAACTAGAAGAAAAGATAGACATGGTGCCTATTGACCTTCATAGTGTGTTCTTGGGCATCCACGGGGGCAAGCTGTGCCTGTCTTGTGCCAAGTCTGGA GATGATATCAAGCTCCAGCTGGAGGAAGTTAACATCACTGATCTGAGCAAGAACAAAGAAGAAGACAAGCGCTTTACCTTCATCCGCTCTGAGAAAGGCCCCACCACCAGCTTTGAGTCAGCTGCCTGTCCAGGATGGTTCCTCTGCACAACACTAGAGGCTGACCGTCCTGTGAGCCTCACCAACACACCGGAAGAGCCCCTTATAGTCACGAAGTTCTACTTCCAGGAAGACCAATAG.

[0068] 2. Recombinant protein expression (1) The recombinant plasmid was transformed into the Escherichia coli Arctic Express expression host to obtain the expression bacteria.

[0069] (2) Inoculate the overnight cultured strain at a rate of 5% into a shake flask containing LB liquid medium, and incubate at 37°C and 225 rpm with shaking until OD. 600 It is 0.4-0.6.

[0070] (3) Set the temperature of the incubator to 12℃ and 225 rpm, and shake for 3 h.

[0071] (4) After 3 h, add 1 mM IPTG to induce incubation and continue to incubate at 12℃ for 16 h.

[0072] (5) On the second day, centrifuge and discard the LB medium, and collect the well-expressed bacterial cells.

[0073] 3. Recombinant protein purification (1) Take out the expressed Arctic Express cells from the -80℃ ultra-low temperature freezer and resuspend the cells in 10 times the volume of pre-cooled lysis buffer to completely resuspend the cells.

[0074] (2) Place the beaker containing the suspension from step (1) into an ice-water mixture and put it into an ultrasonic disruptor. The total ultrasonic disruption time is 30 min.

[0075] (3) Transfer the lysate after sonication in step (2) to a pre-cooled centrifuge tube, centrifuge at 4°C and 16,000 rpm for 30 min, and collect the supernatant after centrifugation.

[0076] (4) Ni Excel packing is placed in the gravity column, and the column is rinsed with binding buffer for 3 column volumes to balance the gravity column.

[0077] (5) Add the supernatant after centrifugation in step (3) to the balanced gravity column. The supernatant flows through the packing material under the action of gravity and the flow-through liquid is collected below the gravity column.

[0078] (6) Rinse the affinity column with 5 column volumes of washing buffer (the final concentration of urea in the washing buffer is 5 M and the final concentration of KCl is 0.5 M).

[0079] (7) Rinse 3 column volumes with binding buffer.

[0080] (8) Rinse 3 column volumes with rinsing buffer.

[0081] (9) Wash with elution buffer for 3 column volumes to elute the target protein.

[0082] 4. Results The SDS-PAGE electrophoresis results of the purified product are as follows: Figure 3 As shown in the figure. The results show that after washing and elution using the method of the present invention, approximately 60 kDa of chaperone protein was effectively removed, and the purity of the target recombinant protein was significantly improved.

[0083] Example 4 The only difference between this embodiment and Embodiment 1 is that step (7) is not performed.

[0084] Results: The purity of the final target protein decreased compared to Example 1, but it did not affect the removal of the chaperone protein in step (6).

[0085] Example 5 The only difference between this embodiment and Embodiment 1 is that step (8) is not performed.

[0086] Results: The purity of the final target protein decreased compared to Example 1, but it did not affect the removal of the chaperone protein in step (6).

[0087] Example 6 The only difference between this embodiment and Embodiment 1 is that step (9) is not performed.

[0088] Results: Compared to Example 1, the target protein was not completely eluted, but it did not affect the removal of the chaperone protein in step (6).

[0089] Example 7 The only difference between this embodiment and embodiment 1 is that after step (7) is completed, step (9) is performed first, followed by step (8).

[0090] Results: After step (7) is completed, step (9) is performed first. 300 mM imidazole has eluted all the proteins on the affinity column. Then, step (8) is performed. 20 mM imidazole will not elute any other proteins. The purity of the target protein purified in Example 1 is reduced, but it will not affect the removal of the chaperone protein in step (6).

[0091] Comparative Example 1 The only difference between this comparative example and Example 1 is that the washing solution does not contain NaCl.

[0092] Result: The purity of the final target protein decreased, but the removal of the chaperone protein was not affected.

[0093] Comparative Example 2 The only difference between this comparative example and Example 1 is that the washing solution does not contain urea.

[0094] Results: Compared with Example 1, the removal effect of chaperone proteins was significantly reduced when KCl was used alone.

[0095] Comparative Example 3 The only difference between this comparative example and Example 1 is that the washing solution does not contain KCl.

[0096] Results: Compared with Example 1, the removal effect of chaperone protein was significantly reduced when using urea alone.

[0097] In summary, the method of the present invention, through washing with a combination of urea and KCl, can effectively remove approximately 60 kDa chaperone proteins from Escherichia coli host bacteria. It is simple to operate, low in cost, and has good chaperone protein removal effect on various recombinant proteins of different molecular weights. It has wide applicability and can significantly improve the purity and quality of recombinant proteins.

[0098] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for removing chaperone proteins, characterized in that, The method for removing chaperone proteins includes: after loading a sample containing the target recombinant protein onto an affinity chromatography column, rinsing the affinity chromatography column with a washing buffer containing urea and KCl to remove the chaperone protein bound to the target recombinant protein.

2. The method for removing chaperone proteins according to claim 1, characterized in that, The final concentration of urea in the washing solution is 1-5 M.

3. The method for removing chaperone proteins according to claim 1 or 2, characterized in that, The final concentration of KCl in the washing solution is 0.1-0.5 M.

4. The method for removing chaperone proteins according to any one of claims 1-3, characterized in that, The washing solution is used in an amount equivalent to 5-10 column volumes of affinity chromatography.

5. The method for removing chaperone proteins according to any one of claims 1-4, characterized in that, The affinity chromatography column is a nickel ion affinity chromatography column.

6. The method for removing chaperone proteins according to any one of claims 1-5, characterized in that, The rinsing process also includes rinsing the affinity chromatography column sequentially with binding buffer, rinsing buffer, and elution buffer.

7. The method for removing chaperone proteins according to claim 6, characterized in that, The binding buffer contains Tris-HCl at a final concentration of 25-75 mM, NaCl at a final concentration of 100-200 mM, and imidazole at a final concentration of 10-50 mM. The rinsing buffer contains Tris-HCl at a final concentration of 25-75 mM, NaCl at a final concentration of 100-200 mM, and imidazole at a final concentration of 10-50 mM. The elution buffer contains Tris-HCl at a final concentration of 25-75 mM, NaCl at a final concentration of 100-200 mM, and imidazole at a final concentration of 200-500 mM.

8. The method for removing chaperone proteins according to claim 6 or 7, characterized in that, The binding buffer, rinsing buffer, and elution buffer are each used in an amount that is independently equivalent to the column volume of 3-5 affinity chromatography columns.

9. The method for removing chaperone proteins according to any one of claims 1-8, characterized in that, The method for removing chaperone proteins includes the following steps: (1) Lyse the host bacteria expressing the target recombinant protein and collect the supernatant of the lysate; (2) Load the supernatant of the lysis buffer obtained in step (1) onto the affinity chromatography column; (3) The affinity chromatography column is washed with a washing solution containing 1-5 M urea and 0.1-0.5 M KCl, the amount of which is 5-10 column volumes of the affinity chromatography column. (4) The affinity chromatography column is washed sequentially with binding buffer, washing buffer and elution buffer and the target recombinant protein is collected. The amount of binding buffer and washing buffer used is independently 3-5 column volumes of affinity chromatography column. The binding buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 10-50 mM. The washing buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 10-50 mM. The elution buffer contains Tris-HCl with a final concentration of 25-75 mM, NaCl with a final concentration of 100-200 mM and imidazole with a final concentration of 200-500 mM.

10. The use of the method for removing chaperone proteins according to any one of claims 1-8 in the purification of recombinant proteins.