Cre-loxp combined with flp-frt-based screening marker recycling technology and application

By applying the Cre-LoxP and Flp-Frt recombination system to multi-round screening marker recovery technology in Schizochytrium, the problem of multi-gene editing in Schizochytrium has been solved, multi-round gene editing has been achieved, and production costs have been reduced.

CN122146738APending Publication Date: 2026-06-05NANJING NORMAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-24
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve multi-gene editing in Schizochytrium, and the lack of selection markers limits its application, especially the application of the Cre-LoxP combined with the Flp-Frt recombination system, which has not been reported.

Method used

The exogenous gene expression cassette was transformed into the genome of Schizochytrium using Agrobacterium-mediated transformation. Multiple rounds of screening marker recovery and editing were performed using the Cre-LoxP and Flp-Frt recombination systems, realizing the application of the Cre-LoxP and Flp-Frt recombination systems in Schizochytrium.

Benefits of technology

This study enabled the recycling of multiple gene edits in Schizochytrium, reduced production costs, and demonstrated the effective application of the Cre-LoxP and Flp-Frt recombination systems in Schizochytrium, showing economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146738A_ABST
    Figure CN122146738A_ABST
Patent Text Reader

Abstract

The application discloses a screening marker recovery technology based on a Cre-LoxP combined Flp-Frt recombination system and application. The Cre-Loxp recombination system comprises a Cre recombinase and a LoxP site, and the LoxP nucleic acid combination comprises LoxP71 and LoxP66 sequences which can be specifically recognized and recombined by the Cre recombinase; similarly, the Flp-Frt recombination system comprises a Flp recombinase and a Frt site, and the Frt site comprises a Frt32 sequence which can be specifically recognized and recombined by the Cre recombinase. Due to the lack of screening markers and inducible promoters in the Schizochytrium, the site-specific recombinase cannot be recovered after being integrated into the genome, and therefore, the application aims to combine the two specific recombinase systems, so that the screening markers and the site-specific recombinase can be recovered unlimited times, and thus, the multi-gene editing of the Schizochytrium can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and gene editing technology, specifically relating to a screening marker recycling technology and its application based on Cre-LoxP combined with Flp-Frt. Background Technology

[0002] The Cre-Loxp system mainly consists of Cre recombinase and Loxp recognition sites. Due to its high efficiency, strong specificity, and lack of the need for any auxiliary factors, it is widely used in gene-targeted integration / knockout, screening for highly efficient expression loci, and is an effective tool for mediating intracellular DNA recombination. Similar to the Cre-Loxp system, the Flp-Frt system consists of Flp recombinase and Frt recognition sites. Both systems belong to tyrosine recombinase editing systems. Their recombinases do not require any auxiliary factors to function, can specifically recognize Loxp or Frt sites, and achieve scarless gene editing with good stability.

[0003] Schizochytrium is a heterotrophic marine fungus that can rapidly accumulate polyunsaturated fatty acids such as docosahexaenoic acid (DHA) without photosynthesis, making it a potential strain for industrial DHA production. However, the optimization of fermentation conditions and limitations of single-gene editing technology have restricted further increases in DHA yield. The development of multi-gene editing technology will provide possibilities for further increasing DHA production in Schizochytrium. Patent document CN114426985B describes the introduction of the exogenous G418 resistance gene into Schizochytrium using Agrobacterium-mediated transformation, enabling the screening of positive transformants using G418. However, this method can only perform single-gene editing within Schizochytrium, and the lack of screening markers and inducible promoters limits its application to multi-gene editing in the fungus. Patent document CN104263661B utilizes electroporation to introduce the Cre-Loxp site-specific recombination system into Schizochytrium, enabling gene editing within the fungus and solving the problem of transgenic Schizochytrium containing resistance genes. Currently, there are no reports on methods and applications for multi-gene editing in Schizochytrium using screening marker recycling technology based on Cre-LoxP combined with Flp-Frt recombination system. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a screening, labeling, and recycling technology and application based on the Cre-LoxP combined with the Flp-Frt recombination system.

[0005] The technical solution adopted by this invention to solve its technical problem is as follows: The present invention provides a screening marker recovery technology based on the Cre-LoxP combined with the Flp-Frt recombination system. First, using Agrobacterium-mediated transformation, exogenous gene expression cassette 1 is transformed into the genome of *Schizochytridactylum*, enabling *Schizochytridactylum* to use resistance gene 1 for screening and integrate the Loxp site. Then, exogenous gene expression cassette 2 is transformed into the *Schizochytridactylum* genome, enabling *Schizochytridactylum* to use resistance gene 2 for screening and integrate the Frt site. Simultaneously, resistance gene 1 between the two Loxp sites can be recovered. Similarly, exogenous gene expression cassette 3 is transformed into the *Schizochytridactylum* genome, enabling *Schizochytridactylum* to use resistance gene 1 for screening and integrate the Loxp site. Simultaneously, resistance gene 2 between the two Frt sites can be recovered. This cycle is repeated to achieve the recovery of screening markers and the editing of multiple genes in *Schizochytridactylum*.

[0006] Furthermore, the original strain of Agrobacterium is AGL-1.

[0007] Preferably, the Agrobacterium is Agrobacterium AGL-1 that has been transformed into exogenous gene expression cassette 1, exogenous gene expression cassette 2, and exogenous gene expression cassette 3.

[0008] The exogenous gene expression cassette 1 consists of the Loxp66 sequence, the resistance gene 1, and the Loxp71 sequence, as shown in SEQ ID NO. 1; the exogenous gene expression cassette 2 consists of the Frt32 sequence, the resistance gene 2, the Cre recombinase expression cassette, and the Frt32 sequence, as shown in SEQ ID NO. 2; and the exogenous gene expression cassette 3 consists of the Lox66 sequence, the resistance gene 1, the Flp recombinase expression cassette, and the Lox71 sequence, as shown in SEQ ID NO. 3.

[0009] Among them, resistance gene 1 is the NeoR expression cassette for the G418 resistance gene, as shown in SEQ ID NO. 4; resistance gene 2 is the Nourse resistance gene expression cassette, as shown in SEQ ID NO. 5; the Lox66 sequence is shown in SEQ ID NO. 14: TACCGTTCGTATAATGTATGCTATACGAAGTTAT; the Lox71 sequence is shown in SEQ ID NO. 15: ATAACTTCGTATAATGTATGCTATACGAACGGTA; the Frt32 sequence is shown in SEQ ID NO. 16: GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC; the Cre recombinase expression cassette includes: the endogenous promoter P3626 of Schizochytrium, as shown in SEQ ID NO. 8, the terminator is the endogenous terminator T2845 of Schizochytrium, as shown in SEQ ID NO. 7, and the Cre recombinase gene sequence is shown in SEQ ID NO. 8. As shown in NO.9; the Flp recombinase expression cassette includes: the endogenous promoter P2902 of Schizochytrium, as shown in the sequence SEQ ID NO.10, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in the sequence SEQ ID NO.7, and the Flp recombinase gene sequence as shown in SEQ ID NO.11.

[0010] The G418 resistance gene NeoR expression cassette includes: the endogenous promoter P2845 of Schizochytrium, as shown in sequence SEQ ID NO.6, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in sequence SEQ ID NO.7, and the G418 resistance gene as shown in SEQ ID NO.12; the Nourse resistance gene expression cassette includes: the endogenous promoter P2845 of Schizochytrium, as shown in sequence SEQ ID NO.6, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in sequence SEQ ID NO.7, and the Nourse resistance gene as shown in SEQ ID NO.13.

[0011] The Schizochytrium strain is Schizochytrium HX-308 with accession number CCTCC M 209059, or other wild-type Schizochytrium.

[0012] Preferably, the method for transforming Schizochytrium with Agrobacterium specifically includes the following steps:

[0013] (1) Construction of recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66:

[0014] Using pZPK as a vector, the promoter P2845 (as shown in SEQ ID NO.6), the G418 resistance gene NeoR (as shown in SEQ ID NO.12), and the terminator T2845 (as shown in SEQ ID NO.7) were inserted. Subsequently, the Lox71 sequence was inserted before the promoter P2845, and the Lox66 sequence was inserted after the terminator T2845 to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66.

[0015] (2) Construction of recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32:

[0016] Using pZPK as a vector, the promoter P2845 (as shown in SEQ ID NO.6), the G418 resistance gene NeoR (as shown in SEQ ID NO.12), and the terminator T2845 (as shown in SEQ ID NO.7) were inserted. Subsequently, the Frt32 sequence was inserted before the promoter P2845 and after the terminator T2845 to obtain the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32.

[0017] (3) Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845:

[0018] Using pZPK as a vector, promoter P2845 (as shown in sequence SEQ ID NO.6), the Nourse resistance gene (as shown in sequence SEQ ID NO.13), and terminator T2845 (as shown in sequence SEQ ID NO.7) were inserted. Subsequently, promoter P3626 (as shown in sequence SEQ ID NO.8), Cre recombinase (as shown in sequence SEQ ID NO.9), and terminator T2845 were inserted after terminator T2845 to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845.

[0019] (4) Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845:

[0020] Using pZPK as a vector, promoter P2845 (as shown in sequence SEQ ID NO.6), the Nourse resistance gene (as shown in sequence SEQ ID NO.13), and terminator T2845 (as shown in sequence SEQ ID NO.7) were inserted. Subsequently, promoter P2902 (as shown in sequence SEQ ID NO.10), Flp recombinase (as shown in sequence SEQ ID NO.11), and terminator T2845 were inserted after terminator T2845 to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845.

[0021] (5) Construction of recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32:

[0022] Using pZPK as a vector, promoter P2845 (as shown in sequence SEQ ID NO.6), the Nourse resistance gene (as shown in sequence SEQ ID NO.13), and terminator T2845 (as shown in sequence SEQ ID NO.7) were inserted. Subsequently, promoter P3626 (as shown in sequence SEQ ID NO.8), Cre recombinase (as shown in sequence SEQ ID NO.9), and terminator T2845 were inserted after terminator T2845. Then, the Frt32 sequence was inserted before promoter P2845 and after terminator T2845 to obtain the recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32.

[0023] (6) Construction of recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66:

[0024] Using pZPK as a vector, promoter P2845 (as shown in sequence SEQ ID NO.6), G418 resistance gene NeoR (as shown in sequence SEQ ID NO.12), and terminator T2845 (as shown in sequence SEQ ID NO.7) were inserted. Subsequently, promoter P2902 (as shown in sequence SEQ ID NO.10), Flp recombinase (as shown in sequence SEQ ID NO.11), and terminator T2845 were inserted after terminator T2845. Then, the Lox71 sequence was inserted before promoter P2845, and the Lox66 sequence was inserted after terminator T2845 to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66.

[0025] (7) Construction of Agrobacterium AGL-1 engineered strain:

[0026] The recombinant plasmids pZPK-Lox71-P2845-NeoR-T2845-Lox66, pZPK-Frt32-P2845-NeoR-T2845-Frt32, pZPK-P2845-Nourse-T2845-P3626-Cre-T2845, pZPK-P2845-Nourse-T2845-P2902-Flp-T2845, and pZPK-Frt32-P were used to... 2845-Nourse-T2845-P3626-Cre-T2845-Frt32 and pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 were transformed into Agrobacterium, and positive single clones were selected by colony PCR. They were then inoculated into LB liquid medium for activation. After activation, the Agrobacterium engineered strains were inoculated into IM medium containing acetylsuccinone for induction.

[0027] (8) Preparation of competent cells of Schizochytrium HX-308:

[0028] Schizochytrium was activated using GPYS solid medium. Single colonies were picked and inoculated into seed liquid medium for overnight activation. 1% (v / v) of the activated bacterial solution was then inoculated into a new seed liquid medium for reactivation.

[0029] (9) Co-culture of Agrobacterium AGL-1 engineered strain and Schizochytrium HX-308:

[0030] Induced Agrobacterium (OD≥0.4) and activated Schizochytrium (≥10) 7 (each item) was spread on an induction solid medium containing acetylsuccinone and co-cultured for 2 days;

[0031] (10) Screening of Schizochytrium transformants:

[0032] The co-cultured bacterial cells were washed off with sterile water and spread on GPYS solid medium containing cefotaxime sodium and corresponding resistance (such as G418 or Nourse) for screening to obtain the transformed Schizochytrium.

[0033] (11) Validation of positive transformants from engineered strains of Schizochytrium:

[0034] The transformed Schizochytrium were passaged for two more generations on GPYS solid medium containing the corresponding resistance (such as G418 or Nourse). The genome of the Schizochytrium transformants was then extracted and verified by PCR to obtain positive transformants of the engineered Schizochytrium strain.

[0035] In steps (7)-(9), the culture conditions are 28-30℃ and the culture time is 24h.

[0036] In step (10), the culture conditions are 28-30℃ and the culture time is 3-7 days.

[0037] In step (11), the culture conditions are 28-30℃ and the culture time is 2 days.

[0038] The present invention relates to the application of the Cre-LoxP combined with Flp-Frt screening marker recovery technology in multigene editing and metabolic engineering of Schizochytrium.

[0039] This invention is the first to use Agrobacterium AGL-1 to transform the exogenous resistance gene expression cassette Nourse into Schizochytrium HX-308, and to test the Cre-Loxp recombination system combined with the Flp-Frt recombination system for multi-gene editing in Schizochytrium using the Agrobacterium AGL-1 transformation method. This not only demonstrates that the Nourse resistance gene can be used for screening in Schizochytrium, but also demonstrates the application of the Cre-Loxp recombination system combined with the Flp-Frt recombination system in Schizochytrium, realizing the recovery and reuse of screening markers, thereby enabling multi-gene editing in Schizochytrium.

[0040] Compared with the prior art, the advantages and positive effects of the present invention are as follows:

[0041] 1. The method of this invention demonstrates the application of the Cre-Loxp recombination system in Schizochytrium HX-308, realizes the recovery of the corresponding selection markers, realizes gene editing of Schizochytrium, and changes the number of rounds of genome editing from 2 to 3, reducing production costs and having economic benefits.

[0042] 2. The method of this invention demonstrates the application of the Flp-Frt recombination system in Schizochytrium HX-308, realizes the recovery of the corresponding selection markers, and achieves gene editing of Schizochytrium, changing from two rounds of genome editing to three rounds, reducing production costs and having economic benefits.

[0043] 3. The method of this invention demonstrates that the Cre-Loxp recombination system and the Flp-Frt recombination system can be coupled and applied to Schizochytrium HX-308, realizing the recycling and recovery of selection markers, transforming the editing process from two rounds to multiple rounds on the genome, thereby achieving multi-gene editing of Schizochytrium, reducing production costs, and having significant implications in the field of multi-gene editing of Schizochytrium.

[0044] The method of this invention achieves multi-gene editing in Schizochytrium by using screening marker recovery technology based on Cre-LoxP combined with Flp-Frt recombination system. The method is simple, low-cost and highly safe. Attached Figure Description

[0045] Figure 1 The structure diagram of pZPK-Lox71-P2845-NeoR-T2845-Lox66 is shown, where P2845 is the promoter, NeoR is the G418 resistance gene, T2845 is the terminator, and the Lox71 and Lox66 sequences are Loxp sites.

[0046] Figure 2 The structure diagram of pZPK-Frt32-P2845-NeoR-T2845-Frt32 is shown, where P2845 is the promoter, NeoR is the G418 resistance gene, T2845 is the terminator, and FRT32 is the Frt site.

[0047] Figure 3 The diagram shows the structure of pZPK-P2845-Nourse-T2845-P3626-Cre-T2845, where P2845 and P3626 are promoters, Nourse is the Nourse resistance gene, T2845 is the terminator, and Cre is the Cre recombinase.

[0048] Figure 4 The diagram shows the structure of pZPK-P2845-Nourse-T2845-P2902-Flp-T2845, where P2845 and P2902 are promoters, Nourse is the Nourse resistance gene, T2845 is the terminator, and Flp is the Flp recombinase.

[0049] Figure 5 The structure diagram of pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32 is shown, where P2845 and P3626 are promoters, Nourse is the Nourse resistance gene, T2845 is the terminator, Cre is the Cre recombinase, and the FRT32 sequence is the Frt site.

[0050] Figure 6 The structure diagram of pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 is shown, where P2845 and P2902 are promoters, NeoR is the G418 resistance gene, T2845 is a terminator, Flp is the Flp recombinase, and the Lox71 and Lox66 sequences are Loxp sites.

[0051] Figure 7 Agarose gel image showing the genomic DNA of *Schizochytrium* HX-308 transformants after being introduced into the Cre-Loxp recombination system, used for PCR identification of NeoR and Nourse resistance genes.

[0052] Figure 8 Agarose gel image showing the genomic DNA of *Schizochytrium* HX-308 transformants after being incorporated into the Flp-Frt recombination system, used for PCR identification of NeoR and Nourse resistance genes.

[0053] Figure 9 Agarose gel image of genomic DNA from *Schizochytrium* HX-308 transformants after initial editing using the Cre-Loxp recombination system and the Flp-Frt recombination system, used for PCR identification of NeoR and Nourse resistance genes.

[0054] Figure 10 Agarose gel image of genomic DNA from the Schizochytrium HX-308 transformant, after a second editing using the Cre-Loxp recombination system and the Flp-Frt recombination system, for PCR identification of NeoR and Nourse resistance genes. Detailed Implementation

[0055] The present invention will be further described below with reference to the accompanying drawings and embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0056] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0057] The culture media used in the following implementation examples are as follows:

[0058] LB liquid medium (1L) composition: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride.

[0059] LB solid medium (1L) composition: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 20 g agar.

[0060] GPYS solid medium (1L) composition: glucose 10 g, tryptone 3 g, yeast extract 7 g, potassium dihydrogen phosphate 1 g, magnesium sulfate heptahydrate 0.5 g, agar 20 g.

[0061] IM liquid culture medium (1L) composition: glucose 2 g, potassium dihydrogen phosphate 1.45 g, dipotassium hydrogen phosphate 2.05 g, ammonium nitrate 0.5 g, calcium chloride 0.01 g, magnesium sulfate heptahydrate 0.5 g, sodium chloride 0.3 g, zinc sulfate heptahydrate 0.001 g, copper sulfate pentahydrate 0.001 g, boric acid 0.001 g, ammonium sulfate 0.5 g, manganese sulfate monohydrate 0.001 g, sodium molybdate monohydrate 0.001 g, morpholine ethanesulfonic acid 8.7 g, glycerol 5 g, acetylsuccinone 200 μM.

[0062] IM solid culture medium (1L) composition: glucose 2 g, potassium dihydrogen phosphate 1.45 g, dipotassium hydrogen phosphate 2.05 g, ammonium nitrate 0.5 g, calcium chloride 0.01 g, magnesium sulfate heptahydrate 0.5 g, sodium chloride 0.3 g, zinc sulfate heptahydrate 0.001 g, copper sulfate pentahydrate 0.001 g, boric acid 0.001 g, ammonium sulfate 0.5 g, manganese sulfate monohydrate 0.001 g, sodium molybdate monohydrate 0.001 g, morpholine ethanesulfonic acid 8.7 g, glycerol 5 g, acetylsuccinone 200 μM, agar 20 g.

[0063] Seed liquid culture medium (1L) composition: sodium sulfate 10 g, potassium dihydrogen phosphate 4 g, magnesium sulfate 2 g, ammonium sulfate 0.8 g, potassium chloride 0.2 g, calcium chloride 0.1 g, trace elements (EDTA 6 g, manganese chloride tetrahydrate 0.86 g, zinc sulfate 0.8 g, ferrous sulfate heptahydrate 2 g, cobalt chloride hexahydrate 0.01 g, copper sulfate pentahydrate 0.6 g, nickel sulfate hexahydrate 0.06 g, sodium molybdate dihydrate 0.01 g).

[0064] Example 1:

[0065] The strain used in this invention is *Schizochytrium* HX-308, with accession number CCTCC M 209059, currently preserved in glycerol tubes. This invention is applicable to any other wild-type *Schizochytrium*, with consistent results.

[0066] A method and application of a screening, labeling, and recovery technique based on Cre-LoxP combined with Flp-Frt, comprising the following steps:

[0067] (1) Preparation of target gene

[0068] Based on genome annotation, promoter P2845 (SEQ ID NO. 6), terminator T2845 (SEQ ID NO. 7), promoter P2902 (SEQ ID NO. 10), and promoter P3626 (SEQ ID NO. 8) were identified. (See reference: NongFT, Zhang ZX, Xu LW, Du F, Ma W, Yang G, Sun XM, 2024. Selecting endogenous promoters for improving biosynthesis of squalene in Schizochytrium sp. Biotechnol. J, 19(10), e202400237.)

[0069] Based on the sequences obtained from the genome, corresponding primers were designed, and the sequence listing is as follows: Figure 1 As shown in Table 1, using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using the primers listed in Table 1 to obtain the corresponding promoters and terminators P2845, T2845, P2902, and P3626.

[0070] The G418 resistance gene NeoR is shown in SEQ ID NO.12. Based on the NeoR sequence, corresponding primers were designed. Using pZPK plasmid as a template (Sun W, Yang X, Wang X, et al. Homologous gene targeting of acarotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium mediated transformation[J]. Biotechnology Letters, 2017, 39(7): 1001-1007.), primers G418-F / R in Table 1 were used to amplify the gene by PCR to obtain the corresponding resistance gene fragment.

[0071] The Nourse resistance gene, as shown in sequence SEQ ID NO.13, was synthesized by a biotechnology company after codon optimization. It was then amplified by PCR using the primers Nourse-F / R in Table 1 to obtain the corresponding resistance gene fragment.

[0072] The Cre recombinase gene, as shown in SEQ ID NO.9, was synthesized by a biotechnology company after codon optimization. It was then amplified by PCR using the primers Cre-F / R in Table 1 to obtain the corresponding recombinase gene fragment.

[0073] The Flp recombinase gene, as shown in SEQ ID NO.11, was synthesized by a biotechnology company after codon optimization. It was then amplified by PCR using the primers Flp-F / R in Table 1 to obtain the corresponding recombinase gene fragment.

[0074] The PCR amplification system described above is shown in Table 2. The amplification program was: denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 10 s, and extension at 72 ℃ (extension time = target fragment length / 1 kb, unit: min), repeated for 35 cycles. After PCR amplification, gel extraction and electrophoresis were used for verification, yielding linear fragments of P2845, T2845, P2902, P3626, G418 resistance gene NeoR, Nourse resistance gene, Cre recombinase, and Flp recombinase.

[0075] Table 1 Primer Sequences

[0076]

[0077] Table 2 PCR amplification system

[0078]

[0079] (2) Construction of recombinant plasmids

[0080] a. Construction of recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66 (see appendix) Figure 1 )

[0081] Using pZPK as a vector, the promoter P2845, the G418 resistance gene NeoR, and the terminator T2845 were inserted to obtain the recombinant plasmid pZPK-P2845-NeoR-T2845.

[0082] pZPK was double-digested with the restriction enzymes EcoRI and HindIII, and the linearized plasmid fragment was obtained by gel extraction. The linearized plasmid fragment was then co-incubated with the amplified promoter P2845, terminator T2845, and G418 resistance gene NeoR. A one-step cloning process was then performed using Novizan's Ultra One Step Cloning Kit to construct the recombinant plasmid pZPK-P2845-NeoR-T2845. The specific reaction system is shown in Table 3 below. The reaction system involved incubation at 50℃ for 30 min. The incubation solution was then transformed into competent E. coli cells (purchased from Tulugang Biotechnology Co., Ltd.). The specific procedure was as follows: competent cells stored at -80℃ were thawed on ice. 10 μL of incubation solution was injected into the competent cells, the tube was gently tapped to mix, and the cells were incubated on ice for 30 min. Then, the cells were heat-shocked in a 42℃ water bath for 90 s, and then incubated on ice again for 3 min. 0.8 mL of LB liquid medium was added, and the cells were incubated at 37℃ for 1 h at 220 rpm. After centrifugation at 4000 rpm for 3 min, the cells were finally spread on LB solid medium containing 50 μg / mL ampicillin sodium and 50 μg / mL kanamycin. The cells were incubated upside down in a 37℃ incubator for 12-24 h. After the transformants were cultured, the plasmid was extracted and sequenced to obtain the recombinant plasmid pZPK-P2845-NeoR-T2845.

[0083] Table 3 One-step cloning enzyme reaction system

[0084]

[0085] Using pZPK-P2845-NeoR-T2845 as a vector, a Lox71 sequence was inserted before the promoter P2845 using primer 01 Lox71-F / R. This was then transformed into competent E. coli cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmids were extracted and sequenced to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845. Similarly, a Lox66 sequence was inserted after the terminator T2845 using primer 02 Lox66-F / R. This was then transformed into competent E. coli cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmids were extracted and sequenced to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66.

[0086] b. Construction of recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32 (see appendix) Figure 2 )

[0087] Using pZPK-P2845-NeoR-T2845 as a vector, the Frt32 sequence was inserted before the promoter P2845 using primer 03 Frt32-F / R. This was then transformed into competent *E. coli* cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmid extraction and sequencing yielded the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845. Similarly, the Frt32 sequence was inserted after the terminator T2845 using primer 04 Frt32-F / R. This was also transformed into competent *E. coli* cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmid extraction and sequencing yielded the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32.

[0088] PCR amplification was performed using primers 01 Lox71-F / R, 02 Lox66-F / R, 03 Frt32-F / R, and 04 Frt32-F / R from Table 4.

[0089] Table 4 Primer Sequences

[0090]

[0091] c. Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845 (see appendix) Figure 3 )

[0092] Using pZPK-P2845-Nourse-T2845 as a vector, the promoter P3626, the Cre recombinase gene, and the terminator T2845 were inserted to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845.

[0093] The plasmid was digested with HindIII and the linearized plasmid fragment was obtained by gel extraction. The linearized plasmid fragment was then co-incubated with the amplified promoter P2845, terminator T2845 and Cre recombinase gene. One-step cloning was performed using Novizan's Ultra One Step Cloning Kit. The plasmid fragment was transformed into competent E. coli cells and cultured upside down for 12-24 hours to obtain transformants. After extracting the plasmid and sequencing, the recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845 was constructed.

[0094] d. Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845 (see appendix) Figure 4 )

[0095] Using pZPK-P2845-Nourse-T2845 as a vector, the promoter P3626, the Flp recombinase gene, and the terminator T2845 were inserted to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845.

[0096] The plasmid was digested with HindIII and linearized by gel extraction. The linearized plasmid fragment was then co-incubated with the amplified promoter P2845, terminator T2845, and Flp recombinase gene. One-step cloning was then performed using Novizan's Ultra One Step Cloning Kit. The plasmid fragment was transformed into competent E. coli cells and cultured upside down for 12-24 hours to obtain transformants. After plasmid extraction and sequencing, the recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845 was constructed.

[0097] e. Construction of recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32 (see appendix) Figure 5 )

[0098] Using pZPK-P2845-Nourse-T2845-P2902-Flp-T2845 as a vector, the Frt32 sequence was inserted before the promoter P2845 using primer 03 Frt32-F / R. This was then transformed into competent *E. coli* cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmid extraction and sequencing yielded the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845. Similarly, using primer 04 Frt32-F / R, the Frt32 sequence was inserted after the terminator T2845. This was also transformed into competent *E. coli* cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmid extraction and sequencing yielded the recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32.

[0099] f. Construction of recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 (see appendix) Figure 6 )

[0100] Using pZPK-P2845-Nourse-T2845-P3626-Cre-T2845 as a vector, a Lox71 sequence was inserted before the promoter P2845 using primer 01 Lox71-F / R. This was then transformed into competent E. coli cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmids were extracted and sequenced to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845. Similarly, a Lox66 sequence was inserted after the terminator T2845 using primer 02 Lox66-F / R. This was then transformed into competent E. coli cells. After inverted culture for 12-24 hours, transformants were obtained. Plasmids were extracted and sequenced to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66.

[0101] Example 2

[0102] (1) Construction of Agrobacterium AGL-1 engineered strain

[0103] The original Agrobacterium AGL-1 strain was streaked onto LB agar plates containing 50 μg / mL ampicillin sodium and incubated at 28°C for 2 days. After 2 days, single colonies were picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL ampicillin sodium and incubated overnight at 28°C and 220 rpm. 200 μL of the overnight culture was inoculated into fresh 5 mL of LB liquid medium containing 50 μg / mL ampicillin sodium and incubated at 28°C and 220 rpm until OD600 = 0.5. The bacterial culture was then removed, incubated on ice for 30 min, and centrifuged at 4°C and 4000 rpm for 5 min to collect the cells. The cells were resuspended in 10 mL of 20 mM CaCl2 and incubated on ice for 15 min. The cells were then centrifuged again at 4°C and 4000 rpm for 5 min to collect the cells. Discard the supernatant, suspend the bacterial cells in 2 mL of 20 mM CaCl2 (containing 15% glycerol), aliquot into 100 μL portions, flash freeze in liquid nitrogen, and store at -80 °C.

[0104] Take out 100 μL of Agrobacterium competent cells stored at -80 ℃ and place them on ice for 10 min. Add 1 μg of each of the recombinant plasmids pZPK-Lox71-P2845-NeoR-T2845-Lox66, pZPK-Frt32-P2845-NeoR-T2845-Frt32, pZPK-P2845-Nourse-T2845-P3626-Cre-T2845, pZPK-P2845-Nourse-T2845-P2902-Flp-T2845, pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32, and pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 prepared in Example 1, and use 20 Gently pipette the μL culture to mix thoroughly and incubate on ice for 30 min. Quickly freeze in liquid nitrogen for 5 min, incubate at 37 °C for 5 min, and incubate on ice for 2 min. Add 1 mL of liquid LB and incubate at 28 °C and 150 rpm for 3 h. Centrifuge at 8000 rpm for 2 min to collect the bacterial cells. After removing the supernatant, resuspend the bacterial cells in 100 μL of LB liquid medium and spread evenly on LB plates (containing 50 μg / ml ampicillin sodium and 50 μg / ml kanamycin), and incubate at 28 °C for 3 days. Pick transformants and incubate overnight at 28 °C and 220 rpm with 3 mL of liquid LB (containing 50 μg / ml ampicillin sodium and 50 μg / ml kanamycin). Sequencing is performed to verify the positive transformants. The Agrobacterium-mediated transformation culture containing the recombinant plasmid is stored at -80 °C (containing 15% glycerol).

[0105] (2) The corresponding fragment was transformed into Schizochytrium HX-308 using Agrobacterium-mediated transformation:

[0106] Schizochytrium HX-308 was activated by streaking on GPYS solid medium. Single colonies were picked and inoculated into seed liquid medium for overnight activation. A 1% (v / v) concentration of the activated bacterial solution was then inoculated into fresh seed liquid medium for reactivation. After centrifugation at 200 × g for 5 min, the supernatant was removed, and the cells were resuspended in sterile water. The concentration of Schizochytrium HX-308 was adjusted to 10... 7 cells / mL;

[0107] Agrobacterium AGL-1 was activated by streaking on LB solid medium. Two days later, single colonies were picked and inoculated into 5 mL of LB liquid medium containing 50 μg / mL ampicillin sodium and 50 μg / mL kanamycin. The culture was incubated overnight at 28 °C and 220 rpm. Cells were obtained by centrifugation at 4000 × g for 5 min. The centrifuged cells were then inoculated into 5 mL of IM liquid medium to adjust the OD600 to 0.3 and incubated at 28 °C and 220 rpm until the OD600 reached 0.7. After centrifugation at 4000 × g for 5 min, the supernatant was removed, and the cells were resuspended in sterile water. The concentration of the Agrobacterium engineered strain containing the recombinant plasmid was adjusted to an OD of 0.4.

[0108] 100 μL of the *Agrobacterium* strain containing the recombinant plasmid and 100 μL of the *Schizochytrium* strain were taken separately, mixed well, and spread onto solid IM medium containing 200 μM acetylsyleugenone. The mixture was co-cultured at 28 °C for 24 h. After 24 h, 1 mL of sterile water was added, and the co-culture was washed off the plate using a spreader. 0.5 mL of the washed culture was spread onto GPYS solid medium containing 300 μg / mL cefotaxime sodium and 500 μg / mL G418 or Nourse antibiotics for screening. The medium was incubated at 28 °C for 2 days. Single clones growing on the screening plates were selected, subcultured twice, each time incubated at 28 °C for 2 days. The genome was then extracted, and PCR verification was performed using the corresponding primers on the resistance gene to obtain positive transformants of the *Schizochytrium* strain.

[0109] The PCR amplification system and amplification procedure described above are shown in Tables 5 and 6.

[0110] Table 5 PCR amplification system

[0111]

[0112] Table 6 PCR Amplification Procedure

[0113]

[0114] Example 3

[0115] Based on the transformation of the corresponding fragment into Schizochytrium HX-308 using the Agrobacterium transformation method described in Example 2, Example 3 evaluated the application of the Cre-Loxp recombination system in Schizochytrium. In this case, the fragment Lox71-P2845-NeoR-T2845-Lox66 was first integrated into the genome of Schizochytrium HX-308 using the Agrobacterium AGL-1 engineered strain containing the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66, thereby obtaining the engineered strain S01. Subsequently, using the engineered strain Agrobacterium AGL-1 containing the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66, the fragment P2845-Nourse-T2845-P3626-Cre-T2845 was integrated into the genome of S01. Screening was performed using GPYS solid medium containing G418 resistance and Nourse resistance, respectively, at 28 ℃. After two days of incubation, transformants that grew on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium were selected. Genomic DNA was then extracted and PCR was performed using 2×Taq Master Mix to verify the presence of false positives. It was found that 18 positive transformants were successfully obtained on Nourse plates after one round of transformation. After screening, 16 transformants grew on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium. Figure 7 Agarose gel electrophoresis images of PCR verification for two of the transformants are attached. Figure 7 (Left) Transformants grown on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium. Lane 2 is Nourse-resistant, showing a bright DNA band of approximately 600 bp. Lane 4 is G418-resistant, showing no band. Figure 7 (Right) is the negative control for the integrated fragment Lox71-P2845-NeoR-T2845-Lox66. Lane 2 is the Nourish resistance, with no band. Lane 4 is the G418 resistance, with a bright DNA band of about 1000 bp. This proves that the Cre-Loxp recombination system can be applied to Schizochytrium HX-308 and the G418 resistance gene selection marker can be successfully recovered. The successfully edited transformant is the engineered strain S02.

[0116] Example 4

[0117] Based on the transformation of the corresponding fragment into Schizochytrium HX-308 using the Agrobacterium transformation method described in Example 2, Example 4 evaluated the application of the Flp-Frt recombination system in Schizochytrium. In this case, the Frt32-P2845-NeoR-T2845-Frt32 fragment was first integrated into the genome of Schizochytrium HX-308 using the Agrobacterium AGL-1 engineered strain containing the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32, thereby obtaining the engineered strain S03. Subsequently, using an engineered strain of Agrobacterium AGL-1 containing the recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845, the fragment P2845-Nourse-T2845-P2902-Flp-T2845 was integrated into the genome of S03. Transformants were screened by streaking on GPYS solid medium containing G418 resistance and Nourse resistance, respectively, at 28 ℃. After two days of culture, transformants that grew on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium were selected. The genome was then extracted, and PCR verification was performed using 2×Taq Master Mix to further verify the absence of false positives. It was observed that 10 positive transformants were successfully obtained on Nourse plates after one round of transformation. After screening, 9 transformants were found to grow on G418-resistant GPYS solid medium, but not on Nourse-resistant GPYS solid medium. Figure 8 Agarose gel electrophoresis images of PCR verification for two of the transformants are attached. Figure 8 (Left) Transformants grown on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium. Lane 2 is Nourse-resistant, showing a bright DNA band of approximately 600 bp. Lane 4 is G418-resistant, showing no band. Figure 8 (Right) is the negative control for the integrated fragment Frt32-P2845-NeoR-T2845-Frt32. Lane 2 is the Nourse resistance, with no band. Lane 6 is the G418 resistance, with a bright DNA band of about 1000 bp. This proves that the Flp-Frt recombination system can be applied to Schizochytrium HX-308 and the G418 resistance gene selection marker can be successfully recovered. The successfully edited transformant is the engineered strain S04.

[0118] Example 5

[0119] Based on the Agrobacterium-mediated transformation method described in Example 2, which transforms the corresponding fragment into Schizochytrium HX-308, Example 5 combines the Cre-Loxp recombination system with the Flp-Frt recombination system and evaluates the application of the two systems in combination for multi-gene editing. Specifically, using the Agrobacterium-mediated transformation method, the Agrobacterium AGL-1 engineered strain containing the recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32 first integrated the fragment Frt32-P2845-Nourse-T2845-P2902-Flp-T2845-Frt32 into the genome of the Schizochytrium engineered strain S01. Transformants were screened by streaking on GPYS solid medium containing G418 resistance and Nourse resistance, respectively, at a culture temperature of 28 ℃. After two days of culture, transformants that grew on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium were selected. The genomes were then extracted and PCR was performed using 2×Taq Master Mix to verify the presence of false positives. It was observed that 10 positive transformants were successfully obtained on Nourse plates after one round of transformation. After screening, 6 transformants were found to grow on G418-resistant GPYS solid medium, but not on Nourse-resistant GPYS solid medium. Figure 9 Agarose gel electrophoresis images of PCR verification for two of the transformants are attached. Figure 9 (Left) Transformants grown on Nourse-resistant GPYS solid medium but not on G418-resistant GPYS solid medium. Lane 2 is Nourse-resistant, showing a bright DNA band of approximately 600 bp. Lane 4 is G418-resistant, showing no band. Figure 9 (Right) is the negative control for the integrated fragment Lox71-P2845-NeoR-T2845-Lox66. Lane 2 is Nourse resistant and has no band. Lane 6 is G418 resistant and has a bright DNA band of about 1000bp. The successfully edited transformant is the engineered strain S06.

[0120] Next, based on the engineered strain S06, the Agrobacterium AGL-1 engineered strain containing the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 was transformed into the genome of the Schizochytrium engineered strain S06 using the Agrobacterium transformation method. Transformants were screened by streaking on GPYS solid medium containing G418 resistance and Nourse resistance, respectively, at 28 ℃. After two days of culture, transformants that grew on G418-resistant GPYS solid medium but not on Nourse-resistant GPYS solid medium were selected. The genomes were then extracted and PCR was performed using 2×Taq Master Mix to verify the presence of false positives. It was observed that 17 positive transformants were successfully obtained on Nourse plates after one round of transformation. After screening, 3 transformants were found to grow on G418-resistant GPYS solid medium, but not on Nourse-resistant GPYS solid medium. Figure 10 Agarose gel electrophoresis images of PCR verification for two of the transformants are attached. Figure 10 (Left) Transformants grown on G418-resistant GPYS solid medium but not on Nourse-resistant GPYS solid medium. Lane 2 shows a bright DNA band of approximately 1000 bp, indicating G418 resistance. Lane 5 shows no band, indicating Nourse resistance. (Attached) Figure 10 (Right) is the S06 negative control. Lane 5 is G418 resistant and has no band. Lane 2 is Nourse resistant and has a bright DNA band of about 600 bp. The successfully edited transformant is the engineered strain S07.

[0121] In the subsequent editing process, based on the engineered strain S07, the Agrobacterium AGL-1 engineered strain containing recombinant plasmids pZPK-Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32 and pZPK-Lox71-P2845-NeoR-T2845-P2902-Flp-T2845-Lox66 was used alternately to integrate the fragments Frt32-P2845-Nourse-T2845-P3626-Cre-T2845-Frt32 and Lox71-P2845-NeoR-T2845-P3626-Cre-T2845-Lox66 into the genome. Subsequently, screening was performed using GPYS solid medium containing G418 resistance and Nourse resistance, respectively, at a culture temperature of 28°C. After two days of incubation at ℃, different resistances were used for screening, followed by genome extraction. PCR verification was performed using 2×Taq MasterMix to further confirm the absence of false positives. The successfully edited engineered bacterial strains were S08, S09, S10, S11, S12, S13, and S14. This demonstrates that the Cre-Loxp recombination system, in conjunction with the Flp-Frt recombination system, can be applied to Schizochytrium HX-308, successfully achieving stable multi-round editing of the G418 resistance gene and the Nourse resistance gene selection marker, without detecting any abnormal recombinations.

[0122] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A screening, labeling, and recycling technology based on Cre-LoxP combined with Flp-Frt, characterized in that, Using Agrobacterium-mediated transformation, exogenous gene expression cassette 1 was first transformed into the Schizochytrium genome, enabling Schizochytrium to utilize resistance gene 1 for selection and integrate the Loxp site (Lox66 / Lox71). Subsequently, exogenous gene expression cassette 2 was transformed into the Schizochytrium genome, enabling Schizochytrium to utilize resistance gene 2 for selection and integrate the Frt site (Frt32). Simultaneously, resistance gene 1 between the two Loxp sites was recovered. Similarly, exogenous gene expression cassette 3 was transformed into the Schizochytrium genome. This method enables Schizochytrium to be screened using resistance gene 1 and integrate the Loxp site (Lox66 / Lox71). Simultaneously, resistance gene 2 between the two Frt sites (Frt32) can be recovered. Lox66 and Lox71 recombine to form a double mutation site that is no longer recognized by Cre recombinase, thereby avoiding non-specific recombination under conditions of multiple sites coexisting and achieving orthogonal operation and stable cyclic recovery of the two systems. The original Agrobacterium strain is AGL-1; the Schizochytrium strain is Schizochytrium HX-308 with accession number CCTCC M 209059.

2. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 1, characterized in that, The exogenous gene expression cassette 1 consists of the Loxp66 sequence, resistance gene 1, and Loxp71 sequence, as shown in SEQ ID NO. 1; the exogenous gene expression cassette 2 consists of the Frt32 sequence, resistance gene 2, Cre recombinase expression cassette, and Frt32 sequence, as shown in SEQ ID NO. 2; the exogenous gene expression cassette 3 consists of the Lox66 sequence, resistance gene 1, Flp recombinase expression cassette, and Lox71 sequence, as shown in SEQ ID NO.

3.

3. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 2, characterized in that, Resistance gene 1 is the NeoR expression cassette for the G418 resistance gene, as shown in sequence SEQ ID NO. 4; resistance gene 2 is the Nourse resistance gene expression cassette, as shown in sequence SEQ ID NO. 5; the Lox66 sequence is shown in SEQ ID NO. 14: TACCGTTCGTATAATGTATGCTATACGAAGTTAT; the Lox71 sequence is shown in SEQ ID NO. 15: ATAACTTCGTATAATGTATGCTATACGAACGGTA; the Frt32 sequence is shown in SEQ ID NO. 16: GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC; the Cre recombinase expression cassette includes: the endogenous promoter P3626 of Schizochytrium, as shown in sequence SEQ ID NO. 8, the terminator is the endogenous terminator T2845 of Schizochytrium, as shown in sequence SEQ ID NO. 7, and the Cre recombinase gene sequence is shown in SEQ ID NO.

4. As shown in NO.9, the Flp recombinase expression cassette includes: the endogenous promoter P2902 of Schizochytrium, as shown in the sequence SEQ ID NO.10, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in the sequence SEQ ID NO.7, and the Flp recombinase gene sequence as shown in SEQ ID NO.

11.

4. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 3, characterized in that, The G418 resistance gene NeoR expression cassette includes: the endogenous promoter P2845 of Schizochytrium, as shown in sequence SEQ ID NO.6, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in sequence SEQ ID NO.7, and the G418 resistance gene as shown in SEQ ID NO.12; the Nourse resistance gene expression cassette includes: the endogenous promoter P2845 of Schizochytrium, as shown in sequence SEQ ID NO.6, the terminator being the endogenous terminator T2845 of Schizochytrium, as shown in sequence SEQ ID NO.7, and the Nourse resistance gene as shown in SEQ ID NO.

13.

5. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 1, characterized in that, The Agrobacterium-mediated transformation method includes the following steps: (1) Construction of recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66: Using pZPK as a vector, the promoter P2845, the G418 resistance gene and the terminator T2845 were inserted. Then, the Lox71 sequence was inserted before the promoter P2845 and the Lox66 sequence was inserted after the terminator T2845 to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-Lox66; (2) Construction of recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32: Using pZPK as a vector, the promoter P2845, the G418 resistance gene and the terminator T2845 were inserted. Then, the Frt32 sequence was inserted before the promoter P2845 and after the terminator T2845 to obtain the recombinant plasmid pZPK-Frt32-P2845-NeoR-T2845-Frt32; (3) Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845: Using pZPK as a vector, the promoter P2845, the Nourse resistance gene and the terminator T2845 were inserted. Then, the promoter P3626, the Cre recombinase and the terminator T2845 were inserted after the terminator T2845 to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P3626-Cre-T2845; (4) Construction of recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845: Using pZPK as a vector, the promoter P2845, the Nourse resistance gene and the terminator T2845 were inserted. Then, the promoter P2902, the Flp recombinase and the terminator T2845 were inserted after the terminator T2845 to obtain the recombinant plasmid pZPK-P2845-Nourse-T2845-P2902-Flp-T2845; (5) Constructing the recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P2902-Flp-T2845-Frt32: Using pZPK as a vector, the promoter P2845, the Nourse resistance gene, and the terminator T2845 were inserted. Then, the promoter P2902, the Flp recombinase, and the terminator T2845 were inserted after the terminator T2845. Next, the Frt32 sequence was inserted before the promoter P2845 and after the terminator T2845 to obtain the recombinant plasmid pZPK-Frt32-P2845-Nourse-T2845-P2902-Flp-T2845-Frt32; (6) Constructing the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P3626-Cre-T2845-Lox66: Using pZPK as a vector, the promoter P2845, the G418 resistance gene NeoR, and the terminator T2845 were inserted. Then, the promoter P3626, the Cre recombinase, and the terminator T2845 were inserted after the terminator T2845. Next, the Lox71 sequence was inserted before the promoter P2845, and the Lox66 sequence was inserted after the terminator T2845 to obtain the recombinant plasmid pZPK-Lox71-P2845-NeoR-T2845-P3626-Cre-T2845-Lox66; (7) Construction of Agrobacterium AGL-1 engineered strain: The recombinant plasmids pZPK-Lox71-P2845-NeoR-T2845-Lox66, pZPK-Frt32-P2845-NeoR-T2845-Frt32, pZPK-P2845-Nourse-T2845-P3626-Cre-T2845, pZPK-P2845-Nourse-T2845-P2902-Flp-T2845, p ZPK-Frt32-P2845-Nourse-T2845-P2902-Flp-T2845-Frt32 and pZPK-Lox71-P2845-NeoR-T2845-P3626-Cre-T2845-Lox66 were transformed into Agrobacterium, and positive single clones were selected by colony PCR. They were then inoculated into LB liquid medium for activation. After activation, Agrobacterium was inoculated into IM medium containing acetylsuccinone for induction. (8) Preparation of competent cells of Schizochytrium HX-308: Schizochytrium was activated, and single clones were picked and inoculated into seed liquid culture medium for overnight activation. The activated bacterial solution was then inoculated into a new liquid culture medium for reactivation. (9) Co-culture of Agrobacterium AGL-1 engineered strain and Schizochytrium HX-308: The induced Agrobacterium and the activated Schizochytrium were spread on an induction solid medium containing acetylsuccinone for co-culture. (10) Screening of Schizochytrium transformants: The co-cultured cells were washed off and spread on GPYS solid medium containing cefotaxime sodium and corresponding resistance (such as G418 or Nourse) for screening to obtain the transformed Schizochytrium. (11) Verification of positive transformants of Schizochytrium engineered strain: The transformed Schizochytrium was passaged for two more generations on GPYS solid medium containing the corresponding resistance (such as G418 or Nourse). The genome of the Schizochytrium transformants was then extracted and verified by PCR to obtain positive transformants of the Schizochytrium engineered strain.

6. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 5, characterized in that, The culture conditions in steps (7)-(9) are 28-30℃ and the culture time is 24h.

7. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 5, characterized in that, The culture conditions in step (10) are 28-30℃ and the culture time is 3-7 days.

8. The screening, labeling, and recovery technology based on Cre-LoxP combined with Flp-Frt according to claim 5, characterized in that, The culture conditions in step (11) are 28-30℃ and the culture time is 2 days.

9. The application of the Cre-LoxP combined with Flp-Frt screening marker recovery technology as described in claim 1 in multigene editing and metabolic engineering of Schizochytrium.

Citation Information

Patent Citations

  • A Schizochytrium without antibiotic marker and its genetic transformation method

    CN104263661B

  • A method and application of Agrobacterium transforming Schizochytrium

    CN114426985B