CmMADS1 gene and application thereof in regulating fruit ripening

By cloning and overexpressing the CmMADS1 gene, the problem of fruit ripening regulation in melon breeding was solved, achieving early fruit ripening and quality improvement, and providing a new molecular breeding path for early-maturing melon varieties.

CN122146772APending Publication Date: 2026-06-05SHANDONG ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANDONG ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-05-06
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Traditional melon breeding methods are time-consuming and inefficient, making it difficult to precisely control fruit ripening, which leads to a decline in quality and reduced resistance, failing to meet the needs of high-quality development in the modern melon industry.

Method used

The CmMADS1 gene was cloned and overexpressed in plants. Fruit ripening was promoted by driving the gene with a strong promoter or optimizing the regulatory elements. This included constructing recombinant vectors, introducing them into plants, and screening transgenic plants to achieve early fruit ripening.

Benefits of technology

It significantly shortens the fruit ripening time, cultivates early-maturing and high-quality varieties, has a short cycle and high efficiency, solves the shortcomings of traditional breeding, and provides new resources for regulating fruit ripening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146772A_ABST
    Figure CN122146772A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a CmMADS1 gene and application thereof in regulating fruit ripening. The CmMADS1 gene is cloned from a melon, and the nucleotide sequence of the CmMADS1 gene is shown as SEQ ID NO:1. By overexpressing the CmMADS1 gene in tomatoes, it is confirmed that the gene can significantly promote fruit early ripening, and the fruit ripening time is advanced by 3-5 days, and the growth cycle of the tomatoes is significantly shortened. The application provides a new key gene resource for melon fruit ripening regulation research, and opens up a new path for molecular breeding of melon early-ripening varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the CmMADS1 gene and its application in regulating fruit ripening. Background Technology

[0002] Muskmelon (Cucumis melo L.) is an important horticultural crop of the Cucurbitaceae family, widely cultivated globally. Its sweet, juicy taste and rich nutritional value make it a favorite among consumers and give it a significant place in the agricultural economy. In the field of muskmelon breeding, traditional early-maturing variety selection mainly relies on hybridization breeding methods, which are time-consuming and inefficient. Furthermore, traditional breeding methods struggle to precisely control fruit ripening-related traits, easily leading to a chain reaction of problems such as decreased quality and reduced resistance, making it difficult to meet the demands of high-quality development in the modern muskmelon industry.

[0003] Therefore, using molecular biology techniques to discover key genes that regulate the ripening of melon fruits and develop precise and efficient breeding techniques for early-maturing varieties has become an urgent need for the transformation and upgrading of the melon industry. Summary of the Invention

[0004] To address the shortcomings of the existing technology, the purpose of this invention is to provide the CmMADS1 gene and its application in regulating fruit ripening.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the application of the CmMADS1 gene and related biological materials in promoting the ripening of plant fruits, wherein the nucleotide sequence of the CmMADS1 gene is shown in SEQ ID NO:1.

[0006] Furthermore, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant cells or tissues.

[0007] Furthermore, the application is achieved by overexpressing the CmMADS1 gene in plants.

[0008] Furthermore, the promotion of plant fruit ripening is manifested in shortening the ripening time of plant fruits.

[0009] A second aspect of the present invention provides a method for promoting the ripening of plant fruits, comprising overexpressing the CmMADS1 gene in a plant using genetic engineering techniques; the nucleotide sequence of the CmMADS1 gene is shown in SEQ ID NO:1.

[0010] Furthermore, the overexpression mode is selected from any of the following: (1) Increase the copy number of the CmMADS1 gene; (2) The CmMADS1 gene is expressed under the drive of a strong promoter; (3) Increase the CmMADS1 gene regulatory elements to overexpress it, wherein the regulatory elements include enhancer elements, elements that improve mRNA stability, elements that enhance translation efficiency and / or elements that enhance protein secretion; (4) Increase the ribosome binding site of the CmMADS1 gene; (5) Codon optimization of the CmMADS1 gene; (6) Gene expression is upregulated by altering the epigenetic modifications of DNA methylation or histone acetylation in the CmMADS1 gene.

[0011] Furthermore, (2) can be achieved by replacing the natural promoter of the CmMADS1 gene with a strong promoter, or by operably linking a second promoter to the CmMADS1 gene.

[0012] Furthermore, the strong promoters include the T7 promoter, CaMV promoter, SV40 promoter, SFFV promoter, ubq promoter, ubi promoter, RBCS promoter, Actin promoter, Emu promoter, CYP450 promoter, Adhl promoter, and pinⅡ promoter.

[0013] Furthermore, the enhancers include, but are not limited to, CMV enhancers, SV40 enhancers, and RSV enhancers.

[0014] The method for promoting the ripening of plant fruits may include the following steps: (1) Construct a recombinant vector containing a nucleic acid molecule encoding the CmMADS1 gene; (2) Introduce the recombinant vector constructed in step (1) into the target plant; (3) Transgenic plants were obtained through screening and identification.

[0015] Furthermore, the above method may include step (4) after step (3): hybridizing the transgenic plant with the plant to be improved to obtain offspring transgenic plants, wherein the offspring transgenic plants are phenotypically consistent with the transgenic plant (i.e., the transgenic plant as the parent).

[0016] In this invention, in the above-described applications or methods, the plant is any of the following: (A1) Monocotyledonous or dicotyledonous plants; (A2) Grasses or cruciferous plants.

[0017] Furthermore, the plant can be any one or more of crops, such as corn, rice, tomato, potato, peanut, soybean, cotton, tobacco, cucumber, melon, watermelon, Chinese cabbage, rapeseed, bok choy, spinach, and radish.

[0018] Furthermore, the plant is a melon or a tomato.

[0019] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention cloned the CmMADS1 gene from melon and, through overexpression of the CmMADS1 gene in tomato, confirmed that this gene can significantly promote early fruit ripening, advancing the fruit ripening time by 3-5 days and significantly shortening the tomato growth cycle. Compared with traditional hybridization breeding methods, it has the advantages of shorter cycle, higher efficiency, and stronger targeting, enabling the rapid breeding of early-maturing, high-quality varieties. This discovery provides a new key gene resource for the study of melon fruit ripening regulation and opens up a new path for molecular breeding of early-maturing melon varieties. Attached Figure Description

[0020] Figure 1 Electrophoresis image of the full-length amplification of the CmMADS1 gene.

[0021] Figure 2 Analysis of CmMADS1 gene expression in different parts of melon.

[0022] Figure 3 The spectrum of the pCAMBIA2300-35S vector.

[0023] Figure 4 Quantitative analysis of the CmMADS1 gene highly expressed lines OE#3, OE#7, and OE#18.

[0024] Figure 5 This study compares the ripeness of positive transgenic tomatoes and control tomatoes at different developmental stages. Detailed Implementation

[0025] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0026] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0027] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0028] The muskmelon inbred line “B3” used in this example was bred by the Watermelon and Muskmelon Research Group of the Vegetable Research Institute of Shandong Academy of Agricultural Sciences. The Micro Tom tomato material was kindly provided by the Tomato Research Group of the Vegetable Research Institute of Shandong Academy of Agricultural Sciences.

[0029] Example 1: Acquisition and Identification of the CmMADS1 Gene 1. Gene Acquisition: Total RNA was extracted from melon fruit, reverse transcribed to obtain cDNA, and the coding region sequence of the CmMADS1 gene was obtained by PCR amplification. The amplification results are shown below. Figure 1 As shown, its nucleotide sequence is shown in SEQ ID NO:1, and the encoded amino acid sequence is shown in SEQ ID NO:2.

[0030] (SEQ ID NO:1).

[0031] MGRGIVELKRIENKINRQVTFAKRRNGLLKKAYELSVLCDAEVALIIFSNRGKLYEFCSTSNMLKTLERYQKCSYGAVEVTKPAKELESSYREYVKLKSRFESLQRTQRNLLGEDLGPLNSKELE QLERQLESSLKQVRSTKTQYMLDQLSDLQNKEQMLIETNRALQMKLEEISSRNNIRHPWDGGDQSMSYGTQNAQTQGFFQPLDCNPTLQIGYTSAVSDQITSTTTPTHAQQVNGFLPGWML (SEQ ID NO:2).

[0032] 2. Expression analysis of CmMADS1 gene in different parts of melon To clarify the expression pattern of the CmMADS1 gene in different tissues and organs of melon, this study used the melon inbred line "B3" as material and collected tissues from roots, stems, leaves, flowers (male and female flowers), and fruits at different developmental stages. Real-time quantitative PCR was used to detect the expression of the CmMADS1 gene. CmMADS1 The level of expression in various organizations.

[0033] The primer sequences for real-time quantitative PCR are as follows: F:TATCTGATCTTCAGAACAAGGAAC (SEQ ID NO:3); R:GAGGAAGCCATTGACTTGTTGGGC (SEQ ID NO:4).

[0034] from Figure 2 It can be seen that CmMADS1 is expressed to varying degrees in different tissues of melon, but exhibits significant tissue specificity in the fruit. Among vegetative organs, the expression level of this gene is relatively low in the stem, while it is higher in the roots and leaves compared to the stem. The expression level of CmMADS1 in the fruit is significantly higher than in different tissues such as roots, stems, and leaves, and the expression level shows obvious dynamic changes with fruit development. In the early stage of fruit development (20 days after pollination), the expression level is relatively low; when the fruit enters the rapid expansion stage (30 days after pollination), its expression level increases significantly; and it reaches its peak 40 days after pollination, when the fruit enters the ripening stage. This expression pattern indicates that CmMADS1 mainly plays a regulatory role in the middle and late stages of fruit development, especially during the fruit ripening and flavor quality formation stages.

[0035] Example 2: Construction and Identification of Transgenic Plants 1. Construction of plant overexpression vector: The coding region sequence of the CmMADS1 gene was cloned into the plant overexpression vector pCAMBIA2300-35S to construct the 35S::CmMADS1 overexpression vector. The CmMADS1 gene was inserted into the MCS multiple cloning site, and a double digestion system of BamH1 and Sal1 was used. The primer sequence used for inserting the vector was: F:GC GGATCC ATGGGAAGAGGAATAGTAGAGTT (SEQ ID NO: 5); R: AG GTCGAC AAGCATCCAACCAGGGAGGA (SEQ ID NO:6). pCAMBIA2300-35S vector spectrum as shown below. Figure 3 As shown in SEQ ID NO:7, this vector contains a CaMV 35S strong promoter, a CmMADS1 gene coding region, a GUS reporter gene, and a hygromycin resistance selection marker.

[0036] 2. Agrobacterium transformation: The 35S::CmRIN overexpression vector was introduced into Agrobacterium GV3101 strain by freeze-thaw method to obtain positive transformed Agrobacterium strains.

[0037] 3. Tomato genetic transformation: Tomato explants were transformed using Agrobacterium-mediated cotyledonary node transformation. Specific steps included: Tomato seeds were disinfected and germinated, and cotyledonary nodes were cut off as explants. Co-culture the explants with the positively transformed Agrobacterium strain for 2-3 days; The co-cultured explants were transferred to a selection medium containing hygromycin for selection culture to induce the differentiation of callus and adventitious shoots; The differentiated adventitious buds were transferred to rooting medium for culture to obtain complete transgenic tomato plants.

[0038] 4. Identification of transgenic tomato plants: Positive transgenic tomato plants were identified by PCR detection and qRT-PCR analysis, and lines OE#3, OE#7, and OE#18 with high expression of the CmMADS1 gene were screened out. Figure 4 ).

[0039] 5. Maturity Identification: Using non-GMO tomatoes as a control, a field planting experiment was conducted on positive GMO tomato plants. After flowering, the tomato plants were tagged with pollination dates. The dates of color change and red ripening of the fruits of positive GMO tomatoes and control plants were recorded separately, and the fruit ripening time was calculated.

[0040] The results are as follows Figure 5 As shown, the transgenic CmMADS1 positive line matured 4 days earlier than the control group.

[0041] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of the CmMADS1 gene and related biomaterials in promoting plant fruit ripening, characterized in that, The nucleotide sequence of the CmMADS1 gene is shown in SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that, The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant cells or tissues.

3. The application as described in claim 1, characterized in that, The application is achieved by overexpressing the CmMADS1 gene in plants.

4. The application as described in claim 1, characterized in that, The promotion of plant fruit ripening is manifested in shortening the ripening time of plant fruits.

5. The application as described in claim 1, characterized in that, The plants mentioned include melons or tomatoes.

6. A method for promoting the ripening of plant fruits, characterized in that, This includes using genetic engineering techniques to overexpress the CmMADS1 gene in plants; the nucleotide sequence of the CmMADS1 gene is shown in SEQ ID NO:

1.

7. The method of claim 6, wherein the overexpression mode is selected from any of the following: (1) Increase the copy number of the CmMADS1 gene; (2) The CmMADS1 gene is expressed under the drive of a strong promoter; (3) Increase the CmMADS1 gene regulatory elements to overexpress it, wherein the regulatory elements include enhancer elements, elements that improve mRNA stability, elements that enhance translation efficiency and / or elements that enhance protein secretion; (4) Increase the ribosome binding site of the CmMADS1 gene; (5) Codon optimization of the CmMADS1 gene; (6) Gene expression is upregulated by altering the epigenetic modifications of DNA methylation or histone acetylation in the CmMADS1 gene.

8. The method as described in claim 7, characterized in that, The strong promoters include the T7 promoter, CaMV promoter, SV40 promoter, SFFV promoter, ubq promoter, ubi promoter, RBCS promoter, Actin promoter, Emu promoter, CYP450 promoter, Adhl promoter, and pinⅡ promoter.

9. The method as described in claim 6, characterized in that, The plants mentioned include melons or tomatoes.

10. The application of the method according to any one of claims 6-9 in plant breeding.