A water body drug-resistant gene risk reduction evaluation method and system based on regulatory region integrity and DNA fragment threshold

By combining a dual-dimensional evaluation method that considers both the integrity of the regulatory region and the DNA fragmentation threshold, the accuracy of assessing the risk reduction effect of antibiotic resistance genes in water bodies was solved, enabling accurate identification and evaluation of the true transmission risk of ARGs.

CN122146868APending Publication Date: 2026-06-05INSTITUTE OF ENVIRONMENT AND SUSTAINABLE DEVELOPMENT IN AGRICULTURE CAAS

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF ENVIRONMENT AND SUSTAINABLE DEVELOPMENT IN AGRICULTURE CAAS
Filing Date
2026-05-11
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to accurately evaluate the risk reduction effect of antibiotic resistance genes (ARGs) in water bodies, and cannot distinguish between residual but inactive and residual and active states, leading to misjudgments of risk reduction effects.

Method used

A two-dimensional evaluation method based on regulatory region integrity and DNA fragmentation threshold was adopted. The distribution of DNA fragment length and regulatory region integrity were detected by high-throughput sequencing. The risk reduction effect of ARGs was determined by combining the proportion of fragments with length less than L and the proportion of regulatory region integrity P.

Benefits of technology

It significantly improves the accuracy and reliability of evaluation results, can accurately identify whether residual fragments have functional activity, avoids misjudgment based solely on abundance decline, and has good cross-gene universality and operability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146868A_ABST
    Figure CN122146868A_ABST
Patent Text Reader

Abstract

The application discloses a water body drug-resistant gene risk reduction evaluation method and system based on regulatory region integrity and DNA fragment threshold, and belongs to the field of bioinformatics. The application extracts DNA in a water sample to be tested, detects DNA fragment length distribution and regulatory region integrity of a target antibiotic resistance gene by using high-throughput sequencing, determines a proportion of fragments with a length less than L in residual DNA fragments after treatment according to the DNA fragment length distribution, and determines a proportion P of regulatory regions still remaining in broken fragments according to the regulatory region integrity. When the proportion of fragments with a length less than L meets a first preset threshold condition and P meets a second preset threshold condition, it is determined that the risk of the target antibiotic resistance gene has been effectively reduced. The application proposes an evaluation method combining the DNA fragment threshold and the regulatory region integrity, overcomes the defect of simply relying on the abundance reduction to evaluate the risk reduction, and has higher accuracy and practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioinformatics, specifically relating to a method and system for evaluating the risk reduction of drug resistance genes in water bodies based on the integrity of the regulatory region and the DNA fragmentation threshold. Background Technology

[0002] With the intensive development of livestock and poultry farming, the use of antibiotics in animal disease prevention and growth promotion is widespread. The large-scale input and irrational use of antibiotics have led to the continuous accumulation of antibiotic resistance genes (ARGs) in livestock and poultry manure, livestock wastewater, agricultural irrigation tailwater, and other agricultural-related environmental media. These genes can enter a wider ecosystem through water migration, environmental diffusion, and microbial transmission, posing a potential threat to ecological security and public health.

[0003] Currently, most methods for assessing the risk of ARG pollution in water bodies are based on qPCR, metagenomic sequencing, or high-throughput quantitative analysis, mainly focusing on changes in ARG abundance or removal efficiency. However, using only the decrease in gene abundance as the basis for risk reduction is difficult to accurately reflect the actual biological activity and spread potential of ARGs, and cannot distinguish between the two states of "residual but inactive" and "residual and still active", which can easily lead to misjudgment of the risk reduction effect.

[0004] Unlike traditional chemical pollutants, the environmental risk of ARGs depends not only on their total amount or abundance in the environmental medium, but also on their molecular integrity, whether key functional regions are damaged, and whether they still possess transcriptional expression and horizontal transfer capabilities. For example, during treatment, although some ARGs may break down, their key regulatory or functional regions may remain intact, thus retaining expression activity or the potential for recombination and spread. Conversely, if regulatory regions such as ARG promoters are damaged, even if some fragments remain, the associated drug resistance function and spread risk may be significantly reduced. Therefore, accurately assessing the degree of risk reduction of ARGs cannot rely solely on abundance decline, but should comprehensively consider their molecular structural integrity and biological activity.

[0005] Current technologies lack a comprehensive evaluation method that combines regulatory region integrity and DNA fragmentation thresholds to assess ARG residue risk. There is also a lack of a systematic evaluation framework for water treatment processes that reflects the degree of ARG transition from presence to inactivation. To address this issue, there is an urgent need to establish a risk reduction assessment method based on molecular integrity evaluation. This would provide a scientific basis and technical support for determining the effectiveness of ARG pollution control in agricultural wastewater, identifying the risk of drug resistance transmission, and optimizing related treatment technologies. Summary of the Invention

[0006] To address the aforementioned limitations of existing technologies, the present invention aims to provide a method and system for evaluating the risk reduction of antibiotic resistance genes in water bodies based on the integrity of regulatory regions and DNA fragmentation thresholds. This invention targets the representative sulfonamide resistance gene sul1 (158 bp) in agricultural and aquaculture wastewater environments, comprehensively evaluating its degradation status, functional integrity, and propagation potential at the molecular level. This provides technical support for determining the effectiveness of ARGs pollution control in agricultural wastewater, identifying the risk of antibiotic resistance propagation, and optimizing related treatment technologies.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, this invention provides a method for assessing the risk reduction of drug resistance genes in water bodies based on regulatory region integrity and DNA fragmentation threshold, comprising the following steps: (1) Obtain the water sample to be tested, extract the DNA from the water sample to be tested, and detect the DNA fragment length distribution and regulatory region integrity of the target antibiotic resistance gene by high-throughput sequencing; (2) Based on the DNA fragment length distribution, determine the proportion of fragments with a length less than L in the residual DNA fragments after treatment, and based on the integrity of the regulatory region, determine the proportion P of the target antibiotic resistance gene regulatory region still retained in the broken fragments; (3) When the proportion of fragments with a length less than L meets the first preset threshold condition and P meets the second preset threshold condition, it is determined that the risk of the target antibiotic resistance gene in the water sample to be tested has been effectively reduced.

[0008] L is the shortest continuous length in the detection system that can trigger a valid signal, and the value of L ranges from 80 to 120 bp.

[0009] The regulatory region is the 0–1 kb region proximal to the promoter of the target antibiotic resistance gene.

[0010] Preferably, the first preset threshold condition is: the proportion of fragments with a length less than L in the residual DNA fragments after treatment is >60%; the second preset threshold condition is: P<30%.

[0011] Preferably, the target antibiotic resistance gene includes sulfonamide resistance genes and / or tetracycline resistance genes.

[0012] Preferably, the sulfonamide resistance gene is roll1 The tetracycline resistance gene is... tet(M) Gene.

[0013] In a second aspect, the present invention provides an evaluation system for reducing the risk of drug resistance genes in water bodies based on the integrity of the regulatory region and the DNA fragmentation threshold, comprising: a sample processing module, a detection module, a calculation module and an evaluation module; The sample processing module is used to extract DNA from the water sample to be tested; The detection module is used to detect the DNA fragment length distribution and regulatory region integrity of the target antibiotic resistance gene; The calculation module is used to determine the proportion of fragments with a length less than L in the residual DNA fragments after treatment based on the DNA fragment length distribution, and to determine the proportion P of the target antibiotic resistance gene regulatory region still retained in the broken fragments based on the integrity of the regulatory region; where L is the shortest continuous length that can trigger an effective signal in the detection system; The evaluation module is used to determine that the risk of the target antibiotic resistance gene in the water sample to be tested has been effectively reduced when the proportion of fragments with a length less than L meets the first preset threshold condition and P meets the second preset threshold condition.

[0014] The beneficial effects of this invention are: 1. This invention proposes for the first time a dual-dimensional evaluation method combining DNA fragmentation threshold (L index) and regulatory region integrity (P index) to comprehensively assess the continuity and functional integrity of ARGs at the molecular level. When the proportion of fragments shorter than L in the treated sample exceeds 60% and the regulatory region coverage P is less than 30%, it indicates that the continuity of the target sequence and the expression-driving structure are simultaneously impaired, and the conversion potential of residual drug resistance genes is significantly reduced. This criterion is directly related to the actual transmission risk of ARGs, overcoming the shortcomings of simply relying on abundance reduction, and significantly improving the accuracy and reliability of the evaluation results.

[0015] 2. This invention utilizes sulfonamide resistance genes. roll1 An evaluation method was established for the model and successfully applied to tetracycline resistance genes. tet(M) This study verified the applicability and stability of the evaluation method on different types of ARGs, demonstrating good cross-genetic universality.

[0016] 3. The high-throughput sequencing and data analysis methods used in this invention are all mature technologies with standardized operating procedures and clear bioinformatics processes for data analysis, which facilitates their application in environmental monitoring agencies, water treatment facilities, and research institutions. Attached Figure Description

[0017] Figure 1 for roll1 Changes in degradation concentration.

[0018] Figure 2 for roll1 The region near the promoter (0–1 kb) is rich in transcription binding sites.

[0019] Figure 3 for tet(M) The region near the promoter (0–1 kb) is rich in transcription binding sites. Detailed Implementation

[0020] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] The specific embodiments of the present invention will be described in further detail below with reference to examples. The following detailed descriptions are illustrative and intended to provide further explanation of this application, rather than limiting the scope of the invention.

[0022] Example 1: Based on roll1 Establishment of a risk reduction assessment system for genes This embodiment uses representative sulfonamide resistance genes from agricultural and livestock wastewater environments. roll1 Using the target gene, samples with different degrees of degradation were constructed through electrochemical treatment to clarify the quantitative judgment thresholds of L and P indicators and establish a complete risk reduction evaluation system.

[0023] 1. Experimental Methods: (1) Electrochemical treatment by roll1 The target gene sequence was used for PCR amplification using primers shown in SEQ ID NO: 1-2.

[0024] Upstream primer (SEQ ID NO: 1): CGCACCGGAAACATCGCTGCAC; Downstream primer (SEQ ID NO: 2): TGAAGTTCCGCCGCAAGGCTCG.

[0025] The PCR products were purified using a kit and then subjected to first-generation sequencing. Sequence alignment confirmed that the amplified product was the target drug resistance gene, and the nucleotide length of the amplified fragment was determined to be 158 bp. The purified target fragment was diluted to the same concentration (31.0 ng / μL) and placed in an electrochemical reaction system. The electrochemical treatment conditions were set at a constant voltage of 4 V, with treatment times of 0, 10, 30, 60, 180, and 300 seconds. Three replicates were set up for each treatment time.

[0026] (2) Determination of DNA concentration and abundance After treatment, the concentration of drug resistance genes was determined using the Qubit dsDNA HS Assay Kit. qPCR was used to determine... roll1Absolute gene abundance was determined using the following qPCR reaction system: 10 μL SYBR Green Master Mix, 0.5 μL each of forward and reverse primers (10 μM), 2 μL DNA template, and ddH2O to a final volume of 20 μL. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 40 cycles. Quantitative analysis was then performed. roll1 Changes in gene copy number.

[0027] (3) High-throughput sequencing and fragment analysis Amplicon high-throughput sequencing was used to analyze the degradation roll1 The length distribution and quantity variations of the fragments were analyzed, and different processing times were considered. roll1 Sequence feature mining and genomic localization analysis based on motif motifs were conducted on fragmented sequences to identify easily degradable sequences and assess their distribution characteristics in regulatory regions.

[0028] The proportion of fragments shorter than L (80-120 bp) in the residual DNA fragments after statistical processing was determined. Based on the integrity of the regulatory region, the proportion P of the fragments that still retain the regulatory region of the target antibiotic resistance gene was determined; P = number of fragments that still retain the regulatory region sequence / total number of fragments.

[0029] 2. Experimental Results DNA concentration, absolute abundance, and integrity before and after treatment roll1 The changes in the number of sequences are shown in Table 1.

[0030] Table 1: Changes in concentration, absolute abundance, and number of intact ARGs before and after treatment The results showed that DNA concentration, absolute abundance, and the number of intact sequences all decreased with prolonged treatment time. Figure 1, showing the changes in sul1 degradation concentration, clearly illustrates that the sul1 gene concentration continuously decreased with prolonged electrochemical treatment time, rapidly dropping from 31.0 ng / μL to 10.9 ng / μL within 0–300 s. This degradation trend exhibited a rapid initial decrease followed by a slower decrease, highly consistent with the decreasing trend of the number of intact sequences in Table 1. However, it was impossible to distinguish whether the remaining fragments still possessed functional activity.

[0031] Further analysis of the length distribution of the fractured fragments and the coverage of the control zone is shown in Table 2.

[0032] Table 2: roll1 Fragment length L and the proportion of the control region P change over time Note: L is the total number of fragments in the sequencing data with a length in the range of 80–120 bp; P is the proportion of fragments containing the proximal (0–1 kb) regulatory region of the promoter.

[0033] Table 2 shows that as the treatment time increased, the number of L fragments continuously decreased from 40912 to 18411, a decrease of 55.0%, indicating that long fragments were gradually broken down into smaller fragments. The proportion of P fragments decreased from 0.413 to 0.095, and after 60 seconds it was below 0.3 (30%), indicating that more than 70% of the regulatory region had been broken. Combined with Figure 2, which shows the enriched region of transcription binding sites in the proximal (0–1 kb) region of the sul1 promoter, it can be seen that there is a densely enriched region of transcription binding sites in the 0–1 kb region proximal to the sul1 gene promoter. This region is the core functional region regulating gene expression. When the proportion of P fragments is below 30%, it means that this core enriched region has been largely destroyed, and the transcriptional expression ability of the sul1 gene has been significantly lost.

[0034] 3. Establishment of evaluation criteria (1) Determination of L index threshold L is defined as the number of fragments with a length in the range of 80–120 bp. This range corresponds to the shortest continuous length range in the detection system that can trigger an effective signal. When the length of the broken fragments in the processed sample is less than L, it indicates that the residual sequence is unlikely to form a complete detectable region, and the conversion potential is significantly reduced.

[0035] To establish clear and operable judgment criteria, this invention sets the judgment criteria for the L index as follows: in the processed sample, the proportion of fragments with a length less than L is >60%; this indicates that long fragments are destroyed, the residual sequence is difficult to form a complete detectable region, and the conversion potential is significantly reduced.

[0036] (2) Determination of the threshold for the P index P is defined as the proportion of the fragment containing the proximal (0–1 kb) regulatory region of the promoter.

[0037] To establish clear and operable judgment criteria, this invention sets the judgment criteria for the L index as: P < 30%. When P is below this threshold, it indicates that more than 70% of the regulatory region has been broken, key transcription binding sites are damaged, and the expression activity and horizontal transfer ability of residual drug resistance genes are significantly reduced.

[0038] (3) Risk reduction judgment criteria Based on the above analysis, the present invention establishes the following quantitative judgment criteria: L-index determination criteria: In the processed sample, the proportion of fragments with a length less than L is >60%; P-index judgment criteria: P-value after treatment <30%; When the target ARGs in the treated water sample simultaneously meet the above two conditions, it indicates that the continuity of the target sequence and the expression-driving structure are damaged synchronously, the conversion potential of the residual drug resistance gene is significantly reduced, and the risk has been effectively reduced.

[0039] Example 2: Based on tet(M) Validation of the universality of the gene evaluation system This embodiment applies the quantitative judgment criteria established in Example 1 to tetracycline resistance genes. tet(M) To verify whether the evaluation system has cross-gene applicability.

[0040] by tet(M) The target gene sequence is used, and the primer sequences for amplification are as follows: Upstream primer (SEQ ID NO: 3): GCTTCCATTGGTTTATCTGTATCAC; Downstream primer (SEQ ID NO: 4): CATAGCGTATCCCTTCCATAACTG.

[0041] The electrochemical treatment conditions were maintained exactly the same as in Example 1 (constant voltage 4 V, treatment times of 0, 10, 30, 60, 180, and 300 seconds, respectively). After treatment, the same DNA extraction and amplicon high-throughput sequencing methods were used for analysis. tet(M) The length distribution of the degraded fragments and the coverage of the regulatory region.

[0042] Table 3: tet(M) Fragment length L and the proportion of the control region P change over time Note: L is the total number of fragments in the sequencing data with a length in the range of 80–120 bp; P is the proportion of fragments containing the proximal (0–1 kb) regulatory region of the promoter.

[0043] Table 3 shows that as the treatment time increased, the number of L molecules continuously decreased from 61760 to 5901, a decrease of 90.4%; the proportion of P decreased from 0.338 to 0.056, and after 30 seconds it was below 0.3 (30%), and continued to decrease. Combined with Figure 3, which shows the enriched region of transcription binding sites in the proximal (0–1 kb) region of the tet(M) promoter, it can be seen that the 0–1 kb region proximal to the tet(M) gene promoter also contains a characteristic enriched module of transcription binding sites. The integrity of this region directly determines gene expression activity. The rapid decrease in the proportion of P indicates that this enriched module was efficiently destroyed, consistent with the destruction pattern of the regulatory region of the sul1 gene, verifying the universality of the dual-index evaluation system.

[0044] Based on the test results, tet(M)Following electrochemical treatment, the number of L fragments continued to decrease, and the P value remained below 30%, indicating that the sequence function and regulatory driving structure were simultaneously impaired, resulting in a significant reduction in potential transmission capacity. This verifies that the drug resistance gene risk reduction assessment system established in this invention can be stably applied to different types of ARGs, demonstrating good universality, effectiveness, and scalability.

[0045] Example 3: Evaluation of the risk reduction effect of ARGs in actual aquaculture wastewater treatment process The following water samples were collected from the wastewater treatment system (using electrochemical oxidation technology) of a large-scale livestock farm: Raw water before treatment: Effluent from the equalization tank Effluent after treatment: Effluent from the electrochemical reaction cell Three parallel samples were set up at each sampling point, with a sampling volume of 1 L. After sampling, the samples were immediately placed in an ice box and transported back to the laboratory. They were stored at 4°C and DNA extraction was completed within 24 hours.

[0046] This embodiment uses a real-world aquaculture wastewater treatment process as an application scenario. It employs the method of this invention and the traditional qPCR abundance method to evaluate the risk reduction effect of ARGs, and uses the transformation activity experiment as the gold standard to verify the accuracy and superiority of the method of this invention. The three analytical methods are as follows: (1) The method of the present invention: Total DNA was extracted from water samples and targeted separately. roll1 Amplicon high-throughput sequencing was performed, and L and P indices were statistically analyzed.

[0047] Judgment criteria: If the proportion of residual DNA fragments with a length less than L (80–120 bp) is >60% and P < 30%, risk reduction is considered.

[0048] (2) Traditional method (qPCR abundance method): qPCR assay roll1 The absolute abundance (copies / μL) was used to calculate the rate of decrease in abundance before and after treatment.

[0049] Judgment criteria: When the abundance decreases by more than 50%, the risk is considered reduced (a common judgment criterion in this field).

[0050] (3) Conversion activity assay: Using commercially available E. coli DH5α competent cells, transformation activity was determined according to the following steps: ① Extract total DNA from each water sample and dilute it to the same concentration (10 ng / μL) with sterile ultrapure water.

[0051] ② Take 50 μL of competent cells, add 5 μL of diluted DNA sample, mix gently, and incubate on ice for 30 min.

[0052] ③ Heat shock in a 42℃ water bath for 45 seconds, then immediately ice bath for 2 minutes.

[0053] ④ Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C and 200 rpm for 1 h.

[0054] ⑤ Spread 100 μL of bacterial culture onto an LB agar plate containing sulfonamide (100 μg / mL) and incubate at 37°C for 16 h.

[0055] ⑥ Count the number of transformants on the plate and calculate the relative conversion efficiency (based on the number of transformants in the water sample before treatment as 100%).

[0056] Judgment criteria: If the relative conversion efficiency of the treated water sample is <50%, the actual risk is considered to have been reduced; otherwise, it is considered not reduced. The test results of the three methods are shown in Table 4.

[0057] Table 4: Comparison of ARGs Risk Reduction Assessment Results Before and After Actual Aquaculture Wastewater Treatment Table 4 shows that the water samples treated with the traditional qPCR abundance method... roll1 Absolute abundance from 8.6 × 10 5 The number of copies / μL decreased to 3.9 × 10⁻⁶. 5 The abundance reduction rate was 54.7%, exceeding the 50% threshold, thus the treatment process was deemed to have achieved ARGs risk reduction.

[0058] Conversion activity determination: The relative conversion efficiency of the treated water sample was 63.8%, which is still higher than the benchmark value of 50%, indicating that the residual ARGs still have high conversion activity and the actual risk of transmission has not been effectively reduced.

[0059] According to the method of this invention: the proportion of fragments with a length less than L in the treated water sample was 38.6%, which did not meet the threshold condition of >60%; the coverage rate P of the control zone was 47.3%, which did not meet the threshold condition of <30%. Neither of these indicators met the criteria for risk reduction, therefore the risk was determined to have not been reduced, consistent with the results of the conversion activity assay.

[0060] The above results indicate that traditional qPCR abundance methods rely solely on the rate of abundance decrease to determine risk reduction, but transformation activity assays show that the risk is not actually reduced, suggesting that relying solely on abundance decrease can easily lead to misjudgment. The method of this invention, by simultaneously examining the DNA fragmentation threshold (L index) and regulatory region integrity (P index), can accurately identify situations where "abundance decreases but function is not inactivated," and the judgment results are consistent with those of the transformation activity assay. Therefore, compared to traditional abundance evaluation methods, the method of this invention can more accurately reflect the true propagation risk of ARGs, avoiding misjudgments caused by relying solely on abundance decrease, and has higher accuracy and practical application value.

[0061] The above description is merely a preferred embodiment of this application and is not intended to limit the application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications made within the spirit and principles of this application are not permitted. Equivalent substitutions and improvements should all be included within the scope of protection of this application.

Claims

1. A method for assessing the risk reduction of drug resistance genes in water bodies based on regulatory region integrity and DNA fragmentation threshold, characterized in that, Includes the following steps: (1) Obtain the water sample to be tested, extract the DNA from the water sample to be tested, and detect the DNA fragment length distribution and regulatory region integrity of the target antibiotic resistance gene by high-throughput sequencing; (2) Based on the DNA fragment length distribution, determine the proportion of fragments with a length less than L in the residual DNA fragments after treatment, and based on the integrity of the regulatory region, determine the proportion P of the target antibiotic resistance gene regulatory region still retained in the broken fragments; (3) When the proportion of fragments with a length less than L meets the first preset threshold condition and P meets the second preset threshold condition, it is determined that the risk of the target antibiotic resistance gene in the water sample to be tested has been effectively reduced. L is the shortest continuous length in the detection system that can trigger an effective signal, and the value of L ranges from 80 to 120 bp. The first preset threshold condition is: the proportion of fragments with a length less than L in the residual DNA fragments after treatment is >60%; the second preset threshold condition is: P < 30%.

2. The method for assessing the risk reduction of drug resistance genes in water bodies according to claim 1, characterized in that, The regulatory region is the 0–1 kb region proximal to the promoter of the target antibiotic resistance gene.

3. The method for assessing the risk reduction of drug resistance genes in water bodies according to claim 1, characterized in that, The target antibiotic resistance genes include sulfonamide resistance genes and / or tetracycline resistance genes.

4. The method for assessing the risk reduction of drug resistance genes in water bodies according to claim 3, characterized in that, The sulfonamide resistance gene is sul1 The tetracycline resistance gene is... tet(M) Gene.

5. A water body antibiotic resistance gene risk reduction assessment system based on regulatory region integrity and DNA fragmentation threshold, characterized in that, include: Sample processing module, detection module, calculation module, and evaluation module; The sample processing module is used to extract DNA from the water sample to be tested; The detection module is used to detect the DNA fragment length distribution and regulatory region integrity of the target antibiotic resistance gene; The calculation module is used to determine the proportion of fragments with a length less than L in the residual DNA fragments after treatment based on the DNA fragment length distribution, and to determine the proportion P of the broken fragments that still retain the target antibiotic resistance gene regulatory region based on the integrity of the regulatory region. Where L is the shortest continuous length that can trigger an effective signal in the detection system; The evaluation module is used to determine that the risk of the target antibiotic resistance gene in the water sample to be tested has been effectively reduced when the proportion of fragments with a length less than L meets the first preset threshold condition and P meets the second preset threshold condition. L is the shortest continuous length in the detection system that can trigger an effective signal, and the value of L ranges from 80 to 120 bp. The first preset threshold condition is: the proportion of fragments with a length less than L in the residual DNA fragments after treatment is >60%; the second preset threshold condition is: P < 30%.