A set of eriocheir sinensis summer continuous high temperature breeding related dna methylation molecular markers and application thereof
By screening and applying DNA methylation markers associated with extreme summer temperatures in Chinese mitten crabs, the problem of lacking high-temperature loss assessment tools in breeding has been solved, enabling early individual screening and improving breeding efficiency. This method is applicable to heat-resistant breeding and risk early warning of Chinese mitten crabs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YANCHENG TEACHERS UNIV
- Filing Date
- 2026-03-19
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of existing epigenetic molecular tools that can be directly used to assess losses from extreme summer temperatures in Chinese mitten crabs and to screen for early parent selection leads to low breeding efficiency.
We developed a set of DNA methylation markers associated with the loss of Chinese mitten crabs due to extreme summer temperatures. Through analysis of whole-genome methylome, transcriptome, and non-coding RNAome data, we screened out key differentially methylated sites and regions. These were then validated by qPCR and detected using targeted amplification sequencing and methylation-specific PCR for high-temperature loss risk assessment and heat-resistant breeding.
This enables pre-selection of candidate individuals before phenotypic formation, improving breeding efficiency, reducing the risk of loss under high-temperature conditions, and providing new molecular tools to support breeding and aquaculture management.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding of aquatic animals, development of epigenetic markers and heat-assisted selection, specifically involving a set of DNA methylation markers related to the loss of Chinese mitten crabs due to extreme high temperatures in summer and their application in breeding. Background Technology
[0002] Against the backdrop of global warming, extreme heat events are becoming more frequent in summer, posing a significant environmental factor affecting the stable production of aquaculture. The Chinese mitten crab (Eriocheir sinensis) is an important economically important farmed crustacean species in my country, and its growth, survival, size formation, and reproductive performance are all highly sensitive to environmental temperature. Existing research has shown that abnormally high temperatures can lead to decreased feed intake, disordered energy metabolism, weakened immune function, and increased tissue damage in Chinese mitten crabs, ultimately resulting in a significant decline in yield and size.
[0003] Compared to traditional breeding methods that rely on phenotypic observation, molecular marker-assisted selection can identify superior individuals at an earlier stage, thereby shortening the breeding cycle and improving breeding efficiency. Existing molecular marker patents for crustaceans are mostly concentrated on SNPs, growth or trait-related loci, while there is still a lack of systematic development and patenting of epigenetic markers related to the loss of Chinese mitten crabs due to extreme summer temperatures, especially DNA methylation markers that can directly serve heat-resistant breeding.
[0004] DNA methylation is an important epigenetic mechanism regulating gene expression and environmental adaptation. High-temperature stimulation can induce methylation remodeling in specific gene promoter regions, gene bodies, or adjacent regulatory regions, thereby affecting the expression of genes related to stress, metabolism, development, and cell fate. Identifying DNA methylation markers that are significantly associated with high-temperature loss and have good reproducibility, and using them for screening and risk assessment of heat-resistant individuals in the Chinese mitten crab, would have significant breeding value and industrial implications.
[0005] Therefore, it is clearly necessary to develop a set of DNA methylation markers that are significantly associated with the loss of Chinese mitten crabs due to extreme high temperatures in summer, and to establish their application methods in candidate individual detection, risk prediction, and heat-resistant breeding. Summary of the Invention
[0006] The purpose of this invention is to provide a set of DNA methylation molecular markers related to the loss of Chinese mitten crabs due to extreme high temperatures in summer and their application in breeding, in order to solve the problem of the lack of epigenetic molecular tools that can be directly used for high temperature loss assessment and parent selection in the existing heat-resistant breeding process.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: Based on the whole genome methylome, transcriptome, non-coding RNA genome, and qPCR validation data of Chinese mitten crab populations in climate-suitable years and populations in summer extreme high-temperature years, differentially methylated sites and differentially methylated regions significantly associated with high-temperature damage are screened out, and methylation markers located in or near key damage response genes such as ADCY9, UNC79, UBN1, IFT52, ACO2, LOC126986070, LOC127001126, and LOC126997895 are preferred as candidate core markers.
[0008] The methylation markers can be identified and quantified using bisulfite conversion sequencing, methylation-specific PCR, targeted amplification sequencing, pyrosequencing, or other feasible methylation detection methods in the art.
[0009] The present invention also provides primers, probes and detection procedures for targeting the methylation markers, and applies them to the risk assessment of high temperature loss of Chinese mitten crab, screening of heat-resistant parents, construction of reserve populations and molecular marker-assisted breeding.
[0010] Due to the adoption of the above technical solution, the advantages and positive effects of this invention are as follows: (1) This invention is the first to propose a DNA methylation molecular marker scheme that can be directly used for breeding screening based on the natural long-term extreme high temperature loss phenotype of Chinese mitten crab, which is different from the traditional breeding mode that only focuses on SNP or single differential gene. (2) The candidate markers used in this invention are derived from the combined analysis of whole genome methylome and transcriptome, non-coding RNA and qPCR, which have stronger biological relevance and can better reflect the true damage state induced by high temperature. (3) The marker described in this invention can screen candidate individuals in advance before the phenotype is formed, which is beneficial to remove individuals with a high risk of high temperature loss in a timely manner during the stages of parent retention, family construction and seedling grading; (4) This invention combines scientific research innovation with industrial transformation, and can provide new molecular tools for heat-resistant breeding of Chinese mitten crab, high temperature early warning in summer and optimization of aquaculture management. Attached Figure Description
[0011] Figure 1 Differences in summer temperature, humidity, and other climatic conditions in the Yangtze River Basin between 2023 and 2024; Figure 2 This is a DNA methylation map of the whole genome of the Chinese mitten crab, showing the three methylation patterns of CpG, CHG and CHH on 70 chromosomes, as well as the methylation distribution of mRNA and lncRNA in the genome body, upstream 2 kb and downstream 2 kb regions; Figure 3This image shows the differential methylation characteristics of Chinese mitten crabs related to high temperature, including sample clustering, correlation analysis, DMR and DMC heatmaps, DMR heatmap and its target gene enrichment results. Figure 4 This is a diagram of the joint analysis of differentially methylated genes and differentially expressed genes, including the intersection of key genes, the marker-gene-noncoding RNA regulatory network, and the qPCR validation results of candidate core markers; Figure 5 Production data for 10 major aquaculture bases in the Yangtze River Basin in 2023 and 2024; Figure 6 Information on core differential methylation sites; Figure 7 Primer sequences for genes associated with core methylation markers. Detailed Implementation
[0012] The following embodiments are used to further illustrate the present invention, but do not constitute a limitation on the scope of protection of the present invention. All equivalent substitutions, simple modifications, or conventional optimizations made based on the technical concept of the present invention should fall within the scope of protection of the present invention.
[0013] Example 1: Sample Collection and Confirmation of High Temperature Loss Phenotype Adult male Chinese mitten crabs naturally cultured in Yancheng, Jiangsu Province, were used as the research subjects. Samples were collected on October 31, 2023, and October 31, 2024, respectively. The 2023 sample represents the population from a year with suitable climate for culture, while the 2024 sample represents the population that experienced extreme summer heat. After sampling, the samples were domesticated for 3 days in clean freshwater at 25°C. Subsequently, the samples were weighed, and tissues such as the hepatopancreas, gills, muscles, and nerves were collected for subsequent DNA methylation, transcriptomics, and molecular validation analyses.
[0014] Meanwhile, daily meteorological data for Yancheng area from 2020 to 2024 were collected, with a focus on comparing the differences in daily average temperature, maximum temperature, and relative humidity during the high-temperature period from July to September 2023 and 2024. The results showed that the average temperature and maximum temperature in the summer of 2024 were significantly higher than those in 2023, while the relative humidity was lower, indicating that 2024 was a year of extreme high temperatures for aquaculture.
[0015] Further statistical analysis was conducted on the total output, survival rate, and proportion of large-sized individuals in 10 major aquaculture bases in the Yangtze River Basin during the two production cycles of 2023 and 2024. The results showed that the population in 2024 showed a significant decline in all three indicators, demonstrating a clear link between extreme summer temperatures and losses in the Chinese mitten crab industry.
[0016] Example 2: DNA methylation mapping construction and candidate marker screening High-throughput bisulfite sequencing was performed on the genomic DNA of the samples. After FASTP quality control, the raw data were aligned to the Chinese mitten crab reference genome ASM2467909v1 using Bismark. PCR duplicates were removed, and information on CpG, CHG, and CHH methylation types was extracted. Chromosome-level methylation statistics were performed using a 500 kb window and a 100 kb step size. Sliding window analysis was also performed on the upstream 2 kb, gene body, and downstream 2 kb regions to obtain methylation distribution curves for different functional regions.
[0017] Differential methylation analysis was performed at both the site and regional levels. At the site level, methylation differences were calculated on a single-base basis, with a selection criterion of |meth.diff| > 20 and p < 0.05. At the regional level, the average methylation level was calculated using a 600 bp window and a 200 bp step size, and regions with consecutive significant differences were selected as differentially methylated regions (DMRs). The results showed that CpG methylation was predominant in the Chinese mitten crab population, and that populations from high-temperature years exhibited significant methylation remodeling across multiple genomic elements.
[0018] Based on this, cross-analysis of differentially methylated genes and differentially expressed genes was performed, and combined with miRNA, lncRNA regulatory networks, and qPCR verification results, eight core genes closely related to high-temperature damage were selected: ADCY9, UNC79, UBN1, IFT52, ACO2, LOC126986070, LOC127001126, and LOC126997895. DMCs or DMRs located in or adjacent to the above genes were defined as preferred candidate methylation markers of this invention.
[0019] Example 3 Determination of core methylation markers Intersection analysis of differentially expressed genes (DEGs) and differentially methylated genes (DMGs) revealed eight common core genes: ADCY9, UNC79, UBN1, IFT52, ACO2, LOC126986070, LOC127001126, and LOC126997895.
[0020] Among them, UBN1, LOC126986070, LOC127001126, and LOC126997895 are regulated by both DMC and DMR, while the remaining genes are mainly regulated by DMC. Based on the core site table provided by the user, the eight core DNA methylation markers of this invention were finally determined.
[0021] Example 4: Methylation Marker Detection Method Genomic DNA was extracted from the muscle, gills, hepatopancreas, or other suitable tissues of the Chinese mitten crab. After testing the concentration and integrity, an appropriate amount of DNA was subjected to bisulfite conversion.
[0022] Amplification primers or detection probes are designed based on the region where the candidate marker is located, preferably covering the corresponding DMC or DMR core region. Subsequently, the methylation level of each target site or region is detected by methylation-specific PCR, pyrosequencing, bisulfite amplification sequencing, or targeted resequencing methods.
[0023] The methylation levels of the tested individuals on these molecular markers were compared with those of a reference population. The reference population included at least a heat-damaged population and a climate-suited population; individuals whose methylation patterns were closer to those of the climate-suited population and deviated from the heat-damaged methylation patterns were preferred as candidates for heat-resistant breeding.
[0024] Example 5: Application in breeding During the backup parental stage, DNA methylation typing was performed on candidate individuals, and individuals that did not exhibit high-temperature-damaged methylation patterns were prioritized for retention to reduce the risk of high mortality, low yield, and low size rate in the next generation under extreme summer heat conditions.
[0025] During the family evaluation phase, the stability and consistency of different families on the methylation markers can be compared, and the families can be comprehensively stratified by combining the results of growth, survival and heat resistance challenges to establish a core candidate population for high temperature resistance.
[0026] In production practice, the methylation markers described in this invention can also be used for pre-assessment of seedling risks before summer, providing decision support for pond-separated culture, feeding management, and parent stock renewal during the high-temperature season.
Claims
1. A set of DNA methylation markers for characterizing the risk of damage from extreme summer temperatures in the Chinese mitten crab, characterized in that, The DNA methylation marker includes at least one of the following differentially methylated cytosine sites: (1) NC_066513.1 chromosome 7188602 site, positive strand, high methylation, neighboring gene LOC126983793 (ADCY9), located in the gene body region; (2) NC_066520.1 chromosome 7719165 site, negative strand, low methylation, neighboring gene LOC126997354 (UNC79), located in the gene body region; (3) NC_066522.1 chromosome 10698432 site, negative strand, low methylation, neighboring gene is LOC126998428 (UBN1), located in the gene body region; (4) NC_066521.1 chromosome 8980033 site, positive strand, low methylation, neighboring gene LOC126997943 (IFT52), located in the gene body region; (5) NW_026111543.1 sequence 1255999 position, negative strand, high methylation, neighboring gene is LOC126991093 (ACO2), located in gene body region; (6) NC_066569.1 chromosome 1135069 site, negative strand, high methylation, neighboring gene is LOC126986070; (7) NC_066528.1 chromosome 6989888 site, positive strand, low methylation, neighboring gene is LOC127001126; (8) NC_066521.1 Chromosome 4037765 site, positive strand, high methylation, neighboring gene is LOC126997895.
2. The DNA methylation marker according to claim 1, characterized in that, The markers were located based on the reference genome Eriocheir sinensis ASM2467909v1, and the difference in methylation between the high-temperature damaged population and the normal climate population was used as the criterion.
3. The DNA methylation marker according to claim 1 or 2, characterized in that, The marker is used to evaluate at least one of the following risks of body damage, decreased survival rate, growth inhibition, or decreased production of large-sized individuals in Chinese mitten crabs under extreme high-temperature conditions in summer:
4. A detection procedure for detecting the DNA methylation markers according to any one of claims 1-3, characterized in that, It includes DNA extraction reagent, bisulfite conversion reagent, methylation detection unit, and data interpretation unit; the methylation detection unit is any one of methylation-specific PCR, bisulfite sequencing, pyrosequencing, or targeted resequencing.
5. The detection process according to claim 4, characterized in that, The kit also includes a primer set for detecting the expression level of neighboring genes to the methylation marker, the primer set including at least one of the following primer pairs: LOC126983793-F: TCTACGCTAACGCCAATG; LOC126983793-R: GCACCACAACACAACAAG; LOC126997354-F: TTGCTGGAAGGCTGAATC; LOC126997354-R: TTGCTGGAAGGCTGAATC; LOC126997895-F: TTGTGAAGGATGTGAGAGTT; LOC126997895-R: AAGCAGGAGGTTGTTGAC; LOC126997943-F: GTGGTAGGTTAGTGGTCATT; LOC126997943-R: AAGAGCGTAATAGCATAGCA; LOC126998428-F: AGCATCATCATCAGCATCA; LOC126998428-R: GGAATCAGCAGAGGTATGG; LOC127001126-F: AGTCAGTCAGTCAGTCAGA; LOC127001126-R: CTTCCATTCCTTCCGTCAT; LOC126986070-F: ACTGCTACTACTACTAAGAAGG; LOC126986070-R: GAAGAGGAGGAGGAAGGAT; LOC126991093-F: TCCTTCCATCATCGTTTCATT; LOC126991093-R: TAGTATCGGCGTAGAGTGT.
6. The application of the DNA methylation marker or kit according to any one of claims 1-5 in the heat-resistant breeding of Chinese mitten crab.
7. The application according to claim 6, characterized in that, The applications include at least one of the following: parent selection, early family evaluation, seedling retention, heat-resistant population construction, and high-temperature risk warning during aquaculture.
8. A method for screening heat-resistant candidate individuals of *Eriocheir sinensis* using the DNA methylation markers described in any one of claims 1-5, characterized in that, Includes the following steps: (1) Extract genomic DNA from individual or group samples of Chinese mitten crabs to be tested; (2) Detecting the methylation level at one or more sites as described in claim 1; (3) Optionally, the expression levels of corresponding neighboring genes can be detected; (4) When the overall methylation pattern of the individual to be tested deviates from the high temperature damage-related methylation pattern, it is identified as a heat-resistant candidate individual and retained.
9. The method according to claim 8, characterized in that, High-temperature damage-related methylation patterns included: upmethylation at sites adjacent to ADCY9, ACO2, LOC126986070, and LOC126997895, and downmethylation at sites adjacent to UNC79, UBN1, IFT52, and LOC127001126.
10. The method according to claim 8 or 9, characterized in that, The screening results are used in conjunction with at least one of total yield, survival rate, proportion of large individuals, heat damage phenotype, or recovery ability after heat exposure for breeding decisions.