A mutant SBEIIb protein in rice and its application in improving rice quality.
By introducing the P667A amino acid substitution mutation into the rice SBEIIb protein, the problems of low resistant starch content and deteriorated appearance quality in rice were solved, resulting in a significant increase in resistant starch content and improved crystal structure, providing excellent breeding resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2026-05-07
- Publication Date
- 2026-06-30
AI Technical Summary
Currently, rice has low resistant starch content, and conventional rice cultivation processes suffer from deterioration in rice appearance and quality, as well as increased amylose content. It is difficult to significantly improve the amylopectin chain length distribution and resistant starch content without affecting the amylose content.
By introducing a specific amino acid substitution mutation (P667A) into the rice SBEIIb protein, the amylopectin chain length distribution was altered, the starch gelatinization temperature was increased, and the resistant starch content of rice was increased, while maintaining the appearance quality of the rice.
It significantly increases the resistant starch content of rice by about 3.8 times, improves the starch crystal structure and thermodynamic properties, reduces the adverse effects on the appearance quality of rice, and provides excellent breeding resources.
Smart Images

Figure CN122303182A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a rice SBEIIb mutant protein and its application in improving rice quality, belonging to the field of rice genetics and breeding. Background Technology
[0002] Studies have shown that in regions where rice is a staple food, the dietary glycemic load and the risk of diabetes are significantly increased. Foods rich in resistant starch can effectively control postprandial blood glucose, promote beneficial changes in gut microbiota, improve glucose metabolism, inhibit lipid absorption, and reduce inflammation, thereby helping to prevent the occurrence of these metabolic diseases and delaying disease progression in related patients. However, conventional rice has extremely low resistant starch content, making the cultivation of rice rich in resistant starch an important research topic in the field of breeding.
[0003] Starch branching enzyme IIb (SBEIIb) is a key enzyme in the synthesis of amylopectin in rice endosperm, primarily responsible for catalyzing the formation of short branched side chains. Previous studies have shown that SBEIIb mutations can significantly increase the content of resistant starch in rice and reduce the glycemic index of cooked rice. Current research on SBEIIb mutations mainly focuses on protein deletion mutations. While these mutations can alter the amylopectin chain length distribution, they are often accompanied by increased amylose content (negatively correlated with cooking and eating quality), and lead to problems such as complete endosperm mealiness and severely reduced grain weight, resulting in deterioration of appearance quality. A few studies have reported that amino acid substitution mutations at specific sites in the SBEIIb protein can provide more precise regulation of rice quality without completely losing protein function. However, the reported SBEIIb amino acid substitution sites are extremely limited. Therefore, identifying and creating novel SBEIIb amino acid substitution mutants can provide new germplasm and molecular modification targets for breeding functional rice rich in resistant starch, and can be applied to rice quality improvement practices. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a rice SBEIIb mutant protein and its application in improving rice quality. The rice SBEIIb mutant protein significantly alters the amylopectin chain length distribution without affecting the amylose content of rice, and can convert starch from A-type to C-type. A- The mutant significantly increased the starch gelatinization temperature and the resistant starch content of rice by about 3.8 times, while having a less adverse effect on the appearance quality of rice than the SBEIIb deletion mutant.
[0005] The technical solution provided by this invention is as follows:
[0006] This invention provides a mutant SBEIIb protein from rice, the amino acid sequence of which is shown in SEQ ID NO.3. Compared with the wild-type SBEIIb protein, the mutant protein has proline (P) at position 667 replaced by alanine (A) (P667A); the amino acid sequence of the wild-type SBEIIb protein is shown in SEQ ID NO.2.
[0007] The present invention also provides a mutant gene encoding the rice SBEIIb mutant protein.
[0008] Compared with the wild-type SBEIIb gene, the mutant gene has a C-base replaced with G at position 15 of exon 18; the nucleotide sequence of the wild-type SBEIIb gene is shown in SEQ ID NO.1.
[0009] The present invention also provides an expression cassette or recombinant vector containing the mutant gene.
[0010] The present invention also provides the application of the rice SBEIIb mutant protein, mutant gene or expression cassette or recombinant vector in improving rice quality.
[0011] Furthermore, this includes breeding mutant rice.
[0012] Furthermore, this includes breeding homozygous mutant rice.
[0013] Furthermore, the improvement of rice quality includes altering the amylopectin chain length distribution without affecting the actual amylose content of the rice.
[0014] Furthermore, the improvement of rice quality includes one or more of the following: altering the crystal structure of rice starch, increasing the gelatinization resistance of rice starch, or increasing the content of resistant starch in rice.
[0015] Furthermore, the alteration of the rice starch crystal structure includes converting rice starch from the A-type to the C-type. A - and reduces the relative crystallinity of starch.
[0016] Furthermore, the improved thermodynamic properties of rice starch include increasing the gelatinization temperature, gelatinization enthalpy, and gelatinization temperature range of rice.
[0017] This invention also provides a method for identifying homozygous mutant rice, comprising the following steps:
[0018] (1) Extract genomic DNA from the rice to be tested, and perform PCR amplification and identification of the Cas9 gene, gRNA element and HPT marker gene respectively to obtain single plants without Cas9, gRNA and HPT;
[0019] (2) The above-mentioned single strains that do not contain Cas9, gRNA and HPT were subjected to PCR amplification and sequencing identification of the target sites again.
[0020] The nucleotide sequences of the primers used to identify the Cas9 gene are shown in SEQ ID NO. 9 and SEQ ID NO. 10; the nucleotide sequences of the primers used to identify the gRNA element are shown in SEQ ID NO. 5 and SEQ ID NO. 6; and the nucleotide sequences of the primers used to identify the HPT marker gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8.
[0021] The present invention also provides a method for improving rice quality, comprising the following steps:
[0022] By introducing the aforementioned mutant genes into the target plants, rice materials with improved rice quality were obtained.
[0023] Beneficial effects
[0024] This invention constructs a cytosine base editing vector targeting a specific sequence in exon 18 of the rice OsSBEIIb gene. Using the rice variety "Zhonghua 11" as the recipient material, transgenic plants were obtained through Agrobacterium-mediated genetic transformation. Through mutation identification and progeny screening, a homozygous mutant without the exogenous gene was obtained in the T1 generation. In this mutant, the 15th base of exon 18 of the OsSBEIIb gene was replaced by G instead of C, resulting in the substitution of proline (P) at position 667 of the SBEIIb protein with alanine (A) (P667A). This P667A mutant protein significantly altered the chain length distribution of amylopectin (average side chain length increased from 20.8 DP to 26.9 DP) without affecting the actual amylose content of rice, and the starch crystal type changed from A-type to C-type. A The P667A mutant exhibits a significantly increased starch gelatinization temperature and a 3.8-fold increase in resistant starch content in cooked rice. Furthermore, the appearance quality and grain weight of both brown and polished rice from the P667A mutant are significantly superior to those of the ae mutant, which completely lacks the SBEIIb protein. The homozygous mutants obtained through progeny screening do not contain exogenous elements such as Cas9, gRNA, and HPT, meeting breeding safety and compliance requirements and can be directly used for variety improvement. Therefore, this invention has significant application value in the breeding of functional rice varieties rich in resistant starch. Attached Figure Description
[0025] Figure 1 This is a schematic diagram illustrating the construction of the rice SBEIIb-P667 amino acid substitution gene editing target site and editing vector in Examples 1 and 2 of the present invention. Figure 1 In the middle, A represents the structure of the SBEIIb gene and the P667 amino acid substitution gene editing target site it encodes; Figure 1Figure B is a schematic diagram of the vector structure of the SBEIIb-P667 amino acid-substituted cytosine single-base editor.
[0026] Figure 2 This is a sequencing peak diagram of the OsSBEIIb gene target site mutation in a portion of the T0 transgenic plant in Example 4 of this invention.
[0027] Figure 3 This invention relates to the identification and screening of homozygous T1 mutants without exogenous gene insertion in Example 5 of this invention. Figure 3 In the middle A section, T1 single plants that did not contain exogenous genes were selected in the initial screening and rescreening. Figure 3 Figure B shows the sequencing peaks of the T1 homozygous mutant strain without exogenous genes.
[0028] Figure 4 The image shows the phenotypic pattern of T3 rice with SBEIIb-P667A amino acid substitution in Example 6 of this invention under reflected and transmitted light.
[0029] Figure 5 Analysis of the starch composition of rice T3 with SBEIIb-P667A amino acid substitution in Example 6 of this invention.
[0030] Figure 6 The SBEIIb-P667A amino acid substitution in Example 6 of this invention relates to the branched starch chain length distribution of T3 rice. Figure 6 In the diagram, A represents the percentage of chain length distribution; Figure 6 B represents the difference in chain length distribution between the mutant and WT.
[0031] Figure 7 The XRD pattern of T3 rice starch replaced by SBEIIb-P667A amino acid in Example 6 of this invention.
[0032] Figure 8 This is the DSC spectrum of T3 rice starch with SBEIIb-P667A amino acid substitution in Example 6 of the present invention. The solid line in the figure is the thermodynamic curve of the native starch, and the dashed line is the thermodynamic curve of the retrograde starch after gelatinization at 4ºC for 8 days.
[0033] Figure 9 The content of resistant starch in T3 rice cooked by replacing the amino acid SBEIIb-P667A in Example 6 of this invention is [not specified]. Detailed Implementation
[0034] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to examples.
[0035] This invention uses the japonica rice variety Zhonghua 11 (ZH11) as the transformation recipient material to create a mutant P667A in which proline (P) at position 667 of the SBEIIb protein is replaced with alanine (A). ZH11, referred to as the wild type (WT) in this invention, is characterized by large panicles, strong tillering ability, lodging resistance, and strong disease resistance, resulting in excellent rice quality and making it a commonly used representative high-quality rice material in scientific research. As a control, this invention also uses a complete deletion mutant of the SBEIIb protein from ZH11 (ae mutant). This ae mutant was created using CRISPR / Cas9 gene editing technology, inserting a base A at position 77 of the second exon of the SBEIIb gene, causing a frameshift and premature termination of translation, without containing the foreign gene and without off-target effects. The rice ae mutant is a highly resistant starch mutant reported in domestic and international literature, but its rice quality is severely degraded. To evaluate the effect of the P667A mutant created in this invention on rice quality improvement, the wild-type (WT) of Zhonghua 11 and its derived ae mutant were used as control materials. The wild-type (WT) of Zhonghua 11, its derived ae mutant, and the P667A mutant involved in this invention were preserved in our laboratory.
[0036] Example 1
[0037] Editing target design of rice SBEIIb gene
[0038] Based on the SBEIIb gene sequence of japonica rice Zhonghua 11 published in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the OsSBEIIb gene contains 22 exons and 21 introns. The editing target was set on exon 18 of the SBEIIb gene. Combining the editing characteristics of the CBE single-base editing vector, a target sequence was obtained: ATTTTCCAAGAGCTCCACAAG (SEQ ID NO.4) Figure 1 A), corresponding to the 10th to 30th bases of exon 18.
[0039] Example 2
[0040] Construction of CBE single-base editing vector
[0041] The gene editing technology used in this embodiment is CBE single-base editing technology, and the vector structure is as follows. Figure 1 As shown in B. The following oligonucleotides were synthesized targeting the designed sequence:
[0042] sgRNA-SBEIIb-F: TGTGTGATTTTCCAAGAGCTCCACA (SEQ ID NO. 13);
[0043] sgRNA-SBEIIb-R: AAACTGTGGAGCTCTTGGAAAATCA (SEQ ID NO. 14);
[0044] The synthesized primers sgRNA-SBEIIb-F and sgRNA-SBEIIb-R were dissolved in double-distilled water to obtain a 10 μM stock solution. The dissolved primers were mixed in the following ratio: 8 μL double-distilled water + 1 μL sgRNA-F + 1 μL sgRNA-R. Annealing was then performed to obtain a double-stranded DNA fragment with an adapter. The CBE single-base editing vector was digested with BsaI, and the digested linear vector fragment was recovered by agarose gel electrophoresis. The recovered vector was ligated with the annealed double-stranded DNA with sticky ends. The ligation product was transformed into *E. coli* DH5α, positive clones were identified, and sequencing was performed to verify the correct construction of the CBE-SBEIIb sgRNA vector.
[0045] Example 3
[0046] Agrobacterium-mediated rice genetic transformation
[0047] 1. Callus induction: Select mature ZH11 brown rice and disinfect it with 75% ethanol (soak for 1 min) and 3% NaClO (soak for 30 min). After thoroughly rinsing with sterile water and drying, place it on the callus induction medium and incubate it in a light incubator (16 h / 8 h light / dark, 28℃).
[0048] 2. Subculture: After about 28 days of callus culture, select small, pale yellow callus particles, transfer them to subculture medium, and continue to culture them under the same conditions for 5-7 days.
[0049] 3. Agrobacterium transformation and infection: The successfully constructed editing vector was transformed into Agrobacterium strain EHA105. After identification, positive colonies were selected and cultured until the OD600 was between 0.6 and 0.8 for later use. Larger callus particles were selected from the subculture medium and placed in 50 mL centrifuge tubes. 15 mL of infection solution containing Agrobacterium was added (the volume of Agrobacterium solution added was: V = 15 * 0.08 / OD600). The tubes were incubated in the dark at 22°C for 30 min. After discarding the solution, the callus was dried and transferred to a co-culture medium pre-lined with a layer of filter paper. The tubes were then incubated in the dark at 22°C for 2-3 days.
[0050] 4. Recovery: Thoroughly clean the callus with sterile water, add 40 mL of sterile water and 90 μL of 250 mg / mL carboxybenzyl to a centrifuge tube, shake on a shaker for 30 min, dry the callus and transfer it to recovery medium, and incubate in a light incubator (16 h / 8 h light / dark, 28℃) for 3-4 days.
[0051] 5. Screening: Select large, firm callus blocks from the recovery medium and transfer them to a first-sieve medium for 13-15 days; transfer all callus blocks to a second-sieve medium and continue culturing for 13-15 days.
[0052] 6. Differentiation: Take the small, tender yellow callus particles that have fallen from the screening medium or grown on the surface of the blackened callus, transfer them to the differentiation medium and place them to differentiate and regenerate into seedlings.
[0053] 7. Rooting: Select small green seedlings that have already grown roots from the differentiation medium, remove the medium and transfer them to the rooting medium, and continue to cultivate and grow in an artificial climate chamber.
[0054] Example 4
[0055] Identification of target site mutations in T0 rice transformant plants
[0056] Genomic DNA was extracted from individual leaves of T0 rice transformation seedlings from Example 3 using the CTAB method. The DNA samples were then subjected to PCR detection using primers for amplifying sgRNA. The primers are listed below (Table 1):
[0057] sgRNA-F:ATTCTCTTCGCTGTGATGGGCT (SEQ ID NO.5);
[0058] sgRNA-R: CTGCACTTCAAACAAGTGTGACAAA (SEQ ID NO. 6);
[0059] To detect target site mutations in positive transgenic plants, amplification primers were designed on both sides of the region to be edited (Table 1): SBEIIb-F: TCAGTGTATCACCGTACTATTCTTGA (SEQ ID NO.11) and SBEIIb-R: CACAAGTGCAGCTCGTCATT (SEQ ID NO.12). The PCR amplification system and procedure are shown in Tables 2 and 3. After identification by 1% agarose gel electrophoresis, the amplified products were sequenced by Nanjing Qingke Biotechnology Co., Ltd. The sequencing results of the transgenic plants were compared with those of the ZH11 wild-type (WT) plants using DNAMAN software to analyze mutation types. The target site mutation status of exon 18 in some positive T0 transgenic plants is shown below. Figure 2 As shown: the codons at positions 15-17 of exon 18 were heterozygously mutated from CCA to (G / C)CA, corresponding to a heterozygous mutation of amino acid P667P-A. The detected mutant strains were propagated, and T1 seeds were harvested from each plant.
[0060]
[0061] Example 5
[0062] Screening and identification of T1 homozygous mutants without exogenous genes
[0063] To screen mutant strains without exogenous gene elements, this invention detected exogenous gene elements in the T1 plants, progeny of the heterozygous mutant single plants identified in Example 4. First, genomic DNA was extracted from the leaves of T1 plants. A first round of PCR amplification was performed using primers Cas9-F and Cas9-R to identify the Cas9 element, selecting plants with negative results. A second round of amplification was then performed on the plants without Cas9. Primers HPT-F and HPT-R were used to identify the HPT element, sgRNA-F and sgRNA-R were used to identify sgRNA, and primers Actin-F and Actin-R were used to amplify the Actin gene as an internal control. Information on the primers used is shown in Table 1, and the PCR amplification system and procedure are shown in Tables 2 and 3. Finally, single plants without sgRNA, HPT, or Cas9 elements were screened. Figure 3 A).
[0064] To further obtain homozygous mutants without exogenous genes, this invention used primers SBEIIb-F and SBEIIb-R to perform PCR amplification of the target site fragment on the above-mentioned single strains lacking sgRNA, HPT, and Cas9 elements, and then sent them to a company for sequencing. The sequencing results showed that this invention obtained homozygous mutants of the OsSBEIIb gene without exogenous genes, with codons at positions 15-17 of exon 18 being homozygously mutated from CCA to GCA (…). Figure 3 B), corresponding to the P667A homozygous mutation, with the amino acid sequence shown in SEQ ID NO. 3. The above-mentioned T1 homozygous mutant strain without the exogenous gene was propagated.
[0065] The CCA variation at positions 15-17 of exon 18 of the OsSBEIIb gene, as identified in this invention, and the resulting variation at position 667 of the proline, are both reported for the first time.
[0066] Example 6
[0067] In this embodiment, the homozygous mutant without exogenous genes obtained in Example 5 was used for propagation. P667A T3 rice and ZH11 wild-type (WT) and its derived SBEIIb protein deletion mutant ae rice were used as materials to analyze the appearance quality, starch composition, amylopectin chain length distribution, starch crystal structure, thermodynamic properties and resistant starch content of the rice.
[0068] 1. Appearance quality of rice
[0069] First, the phenotypes of brown rice and polished rice were observed under reflected and transmitted light, respectively. Figure 4 WT rice is transparent; P667A rice exhibits three phenotypes: transparent, locally chalky, and completely mealy; while ae rice is entirely mealy. These results indicate that the P667A mutation has a milder adverse effect on endosperm starch synthesis and accumulation, maintaining the transparency of some rice grains while avoiding the severe endosperm mealiness caused by the complete loss of SBEIIb protein. This shows that its adverse effect on rice appearance quality is significantly less than that of ae.
[0070] The thousand-grain weights of brown rice and milled rice were further determined (Table 4). Compared with the WT (brown rice 20.84 g, milled rice 17.00 g), the thousand-grain weights of brown rice and milled rice of the P667A mutant decreased to 17.18 g and 15.01 g, respectively, but were still significantly higher than those of the ae mutant (brown rice 15.29 g, 13.15 g). These results again indicate that the P667A mutation has a milder effect on starch synthesis and accumulation in grains, and is significantly superior to the SBEIIb protein deletion mutation in terms of grain weight traits.
[0071]
[0072] Data are presented as mean ± standard deviation (n = 3). Data in the same column labeled with different letters are statistically significant (p < 0.05).
[0073] 2. Rice starch components
[0074] First, the amylose content was determined using the starch-iodine colorimetric method. Since the long branched side chains in amylopectin can also bind to iodine, the amylose content measured by this method is called apparent amylose content (AAC). The results showed that the apparent amylose content of the P667A mutant significantly increased from 18.6% in the WT mutant to 34.1%, but was lower than that of the ae mutant (46.2%). Figure 5 ).
[0075] To eliminate the influence of amylopectin chain length distribution on the determination of amylose content, this invention further employs the concanavalin A (ConA) precipitation method to determine the amylose content. ConA can selectively bind and precipitate amylopectin; therefore, the ratio of amylose to total starch measured by this method is neither affected by amylopectin chain length distribution nor by starch purity, and is often referred to as the true amylose content (TAC). The ConA method results showed that the true amylose content of the P667A mutant (12.9%) was similar to that of the wild type (13.7%), and significantly lower than that of the ae mutant (19.5%). Figure 5The difference between apparent amylose content and true amylose content (AAC - TAC) reflects the change in the proportion of long side chains in amylopectin; a larger difference indicates a higher proportion of long side chains. In the P667A mutant, this difference increased from 5.0% in the wild type to 21.2%, but was still lower than that in the ae mutant (26.8%). Figure 5 The above starch composition analysis results indicate that the P667A mutation does not affect the actual amylose content of rice, but the apparent amylose content can be increased by increasing the proportion of long-branched side chains in amylopectin.
[0076] 3. Distribution of amylopectin chain length
[0077] The amylopectin chain length distribution was determined using fluorescence-assisted capillary electrophoresis. The results showed that the amylopectin chain length distribution in the P667A mutant was significantly altered, falling between that of the WT and ae mutants. Figure 6 Compared with WT, the proportion of short chains (DP6-12) in P667A decreased from 27.8% to 18.5%, but was still higher than that of ae (14.4%); the proportions of medium-long chains (DP25-36) and long chains (DP≥37) both increased significantly, with the proportion of long chains increasing from 12.4% in WT to 24.0%, slightly lower than that of ae (24.6%); in terms of average side chain length, P667A increased from 20.8 DP in WT to 26.9 DP, but was still lower than that of ae (27.9 DP) (Table 5). These results indicate that the P667A mutation can increase the proportion of long side chains and decrease the proportion of short chains in amylopectin, resulting in a significant increase in average side chain length, but the magnitude of this increase is smaller than that of the ae mutant, meaning the mutation effect of P667A is weaker than that of the ae mutant.
[0078]
[0079] 4. Starch crystal structure
[0080] This invention utilizes X-ray powder diffraction to analyze the crystal structure of starch. For example... Figure 7 As shown, the diffraction pattern of WT starch exhibits strong diffraction peaks at 2θ 15° and 23°, and a connected double peak at 2θ 17° and 18°, which is typical of A-type starch. The diffraction pattern of P667A mutant starch shows a small B-type crystal characteristic peak at 2θ 5.6°, a strong diffraction peak at 2θ 17° accompanied by a distinct shoulder peak at 18°, and a single peak at 2θ 23°. These characteristics indicate its transformation into C-type starch. AType A starch. The ae mutant starch also exhibits a B-type crystal diffraction peak at 2θ 5.6º, a single peak at 17º, and double peaks at 22º and 24º, typical of B-type starch patterns. These results indicate that the P667A mutation induces a transformation of the starch crystal structure from A-type to C-type by altering the amylopectin chain length distribution. A Type -. Along with the change in crystal structure, the relative crystallinity also changes: the relative crystallinity of P667A starch decreased from 28.8% to 23.9%, but was still higher than the 21.8% of the ae mutant. Figure 7 ).
[0081] 5. Thermodynamic properties of starch
[0082] This invention further analyzes the thermodynamic properties of starch. Figure 8 First, the thermodynamic properties of the native starch were determined. Compared with WT, the gelatinization onset temperature (66.3℃), peak gelatinization temperature (76.9℃), termination gelatinization temperature (90.0℃), gelatinization temperature range (23.7℃), and gelatinization enthalpy (12.9 J / g) of the P667A mutant starch were significantly increased. Specifically, the gelatinization onset temperature, peak gelatinization temperature, and gelatinization enthalpy of P667A were lower than those of the ae mutant, while the termination gelatinization temperature and gelatinization temperature range were higher (Table 6). Subsequently, the gelatinized starch was stored at 4°C for 8 days, and thermodynamic analysis was performed again. The results showed that the retrogradation enthalpy (8.4 J / g) and degree of retrogradation (64.8%) of the P667A mutant starch were significantly higher than those of WT, but lower than those of the ae mutant (Table 6). The above results indicate that the P667A mutation can significantly improve the thermal stability and retrogradation ability of starch, manifested as a higher gelatinization temperature and a wider range of thermal stability, which is closely related to the increased proportion of long-chain amylopectin and changes in crystal structure.
[0083]
[0084] Values are expressed as mean ± standard deviation (n = 3). Data with different letters in the same column are statistically significant (p < 0.05). To: gelatinization onset temperature; Tp: gelatinization peak temperature; Tc: gelatinization termination temperature; ΔT: gelatinization temperature range (Tc - To); ΔHn: enthalpy of gelatinization of native starch; ΔHr: enthalpy of gelatinization of retrograded starch; R: degree of retrogradation.
[0085] 6. Resistant starch content of rice
[0086] This study used the resistant starch assay kit (K-RSTAR) from Megazyme, Ireland, to determine the resistant starch content of fresh rice. Figure 9The results showed that the resistant starch content of WT was 0.59%, while that of the P667A mutant was 2.26%, which was about 3.8 times higher than that of WT. The resistant starch content of the ae mutant was 7.2%, which was basically consistent with the literature reports.
[0087] Based on the above results, the P667A mutant obtained in this invention can significantly alter the chain length distribution, crystal structure, and gelatinization characteristics of amylopectin while maintaining the same amylose content in rice, resulting in a 3.8-fold increase in resistant starch content in cooked rice. Furthermore, its adverse effects on the appearance quality of rice are significantly less than those of the SBEIIb protein-completely-deficient mutant ae. Therefore, the rice SBEIIb mutant protein and its mutants provided by this invention are excellent germplasm resources for cultivating new functional rice lines rich in resistant starch, and have significant breeding application value.
[0088] SEQ ID NO.1 (OsSBEIIb gene nucleotide sequence)
[0089]
[0090] SEQ ID NO.2 (Amino acid sequence of OsSBEIIb protein)
[0091] MAAPASAVPGSAAGLRAGAVRFPVPAGARSWRAAAELPTSRSLLSGRRFPGAVRVGGSGGRVAVRAAGASGEVMIPEGESDGMPVSAGSDDLQLPALDDELSTEVGAEVEIESSGASDVEGVKRVVEELAAEQKPRVVPPTGDGQKIFQMDSMLNGYKYHLEYRYSLYRRLRSDIDQYEGGLETFSRGYEKFGFNHSAEGVTYREWAPGAHSAALVGDFNNWNPNADRMSKNEFGVWEIFLPNNADGSSPIPHGSRVKVRMETPSGIKDSIPAWIKYSVQAAGEIPYNGIYYDPPEEEKYIFKHPQPKRPKSLRIYETHVGMSSTEPKINTYANFRDEVLPRIKKLGYNAVQIMAIQEHAYYGSFGYHVTNFFAPSSRFGTPEDLKSLIDKAHELGLVVLMDVVHSHASNNTLDGLNGFDGTDTHYFHSGSRGHHWMWDSRLFNYGNWEVLRFLLSNARWWLEEYKFDGFRFDGVTSMMYTHHGLQVAFTGNYSEYFGFATDADAVVYLMLVNDLIHGLYPEAITIGEDVSGMPTFALPVQDGGVGFDYRLHMAVPDKWIELLKQSDESWKMGDIVHTLTNRRWSEKCVTYAESHDQALVGDKTIAFWLMDKDMYDFMALDRPATPSIDRGIALHKMIRLITMGLGGEGYLNFMGNEFGHPEWIDFPRAPQVLPNGKFIPGNNNSYDKCRRRFDLGDADYLRYRGMLEFDRAMQSLEEKYGFMTSDHQYISRKHEEDKMIIFEKGDLVFVFNFHWSNSYFDYRVGCLKPGKYKVVLDSDAGLFGGFGRIHHTAEHFTADCSHDNRPYSFSVYSPSRTCVVYAPAE*。
[0092] SEQ ID NO.3 (Mutated amino acid sequence of P667A)
[0093] MAAPASAVPGSAAGLRAGAVRFPVPAGARSWRAAAELPTSRSLLSGRRFPGAVRVGGSGGRVAVRAAGASGEVMIPEGESDGMPVSAGSDDLQLPALDDELSTEVGAEVEIESSGASDVEGVKRVVEELAAEQKPRVVPPTGDGQKIFQMDSMLNGYKYHLEYRYSLYRRLRSDIDQYEGGLETFSRGYEKFGFNHSAEGVTYREWAPGAHSAALVGDFNNWNPNADRMSKNEFGVWEIFLPNNADGSSPIPHGSRVKVRMETPSGIKDSIPAWIKYSVQAAGEIPYNGIYYDPPEEEKYIFKHPQPKRPKSLRIYETHVGMSSTEPKINTYANFRDEVLPRIKKLGYNAVQIMAIQEHAYYGSFGYHVTNFFAPSSRFGTPEDLKSLIDKAHELGLVVLMDVVHSHASNNTLDGLNGFDGTDTHYFHSGSRGHHWMWDSRLFNYGNWEVLRFLLSNARWWLEEYKFDGFRFDGVTSMMYTHHGLQVAFTGNYSEYFGFATDADAVVYLMLVNDLIHGLYPEAITIGEDVSGMPTFALPVQDGGVGFDYRLHMAVPDKWIELLKQSDESWKMGDIVHTLTNRRWSEKCVTYAESHDQALVGDKTIAFWLMDKDMYDFMALDRPATPSIDRGIALHKMIRLITMGLGGEGYLNFMGNEFGHPEWIDFARAPQVLPNGKFIPGNNNSYDKCRRRFDLGDADYLRYRGMLEFDRAMQSLEEKYGFMTSDHQYISRKHEEDKMIIFEKGDLVFVFNFHWSNSYFDYRVGCLKPGKYKVVLDSDAGLFGGFGRIHHTAEHFTADCSHDNRPYSFSVYSPSRTCVVYAPAE。
[0094] SEQ ID NO.4 (Targeting sequence): ATTTTCCAAGAGCTCCACAAG。
[0095] SEQ ID NO.5 (sgRNA-F): ATTCTCTTCGCTGTGATGGGCT。
[0096] SEQ ID NO.6(sgRNA-R):CTGCACTTCAAACAAGTGTGACAAA。
[0097] SEQ ID NO.7(HPT-F):CGAGAGCCTGACCTATTGCAT。
[0098] SEQ ID NO.8(HPT-R):CTGCTCCATACAAGCCAACCAC。
[0099] SEQ ID NO.9(Cas9-F):CACCATCTACCACCTGAGAA。
[0100] SEQ ID NO.10(Cas9-R):CGAAGTTGCTCTTGAAGTTG。
[0101] SEQ ID NO.11(SBEIIb-F):TCAGTGTATCACCGTACTATTCTTGA。
[0102] SEQ ID NO.12(SBEIIb-R):CACAAGTGCAGCTCGTCATT。
[0103] SEQ ID NO.13(sgRNA-SBEIIb-F):TGTGTGATTTTCCAAGAGCTCCACA。
[0104] SEQ ID NO.14(sgRNA-SBEIIb-R):AAACTGTGGAGCTCTTGGAAAATCA。
[0105] SEQ ID NO.15(Actin-F):CCAAGGCCAATCGTGAGAAGA。
[0106] SEQ ID NO.16(Actin-R):AATCAGTGAGATCACGCCCAG。
Claims
1. A rice SBEIIb mutant protein, characterized in that, The amino acid sequence of the mutant protein is shown in SEQ ID NO.3; compared with the wild-type SBEIIb protein, the mutant protein has a proline substitution at position 667 with alanine, and the amino acid sequence of the wild-type SBEIIb protein is shown in SEQ ID NO.
2.
2. A mutant gene encoding the rice SBEIIb mutant protein of claim 1.
3. The mutant gene according to claim 2, characterized in that, Compared with the wild-type SBEIIb gene, the mutant gene has a C-base replaced with G at position 15 of exon 18; the nucleotide sequence of the wild-type SBEIIb gene is shown in SEQ ID NO.
1.
4. An expression cassette or recombinant vector, characterized in that, It contains the mutant gene as described in claim 2 or 3.
5. The application of the rice SBEIIb mutant protein of claim 1, the mutant gene of claim 2 or 3, or the expression cassette or recombinant vector of claim 4 in improving rice quality.
6. The application according to claim 5, characterized in that, The improvement of rice quality includes changing the amylopectin chain length distribution without affecting the actual amylose content of rice.
7. The application according to claim 5, characterized in that, The improvement of rice quality includes one or more of the following: altering the crystal structure of rice starch, increasing the gelatinization resistance of rice starch, or increasing the content of resistant starch in rice.
8. A method for identifying homozygous mutant rice, characterized in that, Includes the following steps: Genomic DNA was extracted from the rice plants to be tested, and PCR amplification was performed on the Cas9 gene, gRNA element, and HPT marker gene to identify them, and single plants without Cas9, gRNA, and HPT were obtained. The single strains that do not contain Cas9, gRNA, and HPT were subjected to PCR amplification and sequencing identification of the target sites again.
9. The method according to claim 8, characterized in that, The nucleotide sequences of the primers used to identify the Cas9 gene are shown in SEQ ID NO. 9 and SEQ ID NO. 10; the nucleotide sequences of the primers used to identify the gRNA element are shown in SEQ ID NO. 5 and SEQ ID NO. 6; and the nucleotide sequences of the primers used to identify the HPT marker gene are shown in SEQ ID NO. 7 and SEQ ID NO.
8.
10. A method for improving rice quality, characterized in that, Includes the following steps: By introducing the mutant gene described in claim 2 or 3 into the target plant, rice materials with improved rice quality are obtained.