Methods for preparing sequencing libraries
By pre-processing and denaturing DNA samples before ligating adapters, this method solves the problem of insufficient sensitivity and accuracy in low-volume sample detection of existing sequencing library preparation methods, thereby improving library yield and quality, simplifying the operation process, and enhancing the sensitivity of methylation site detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2026-06-09
Smart Images

Figure CN122168720A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of next-generation sequencing (NGS), specifically to methods for preparing libraries, particularly methods for preparing methylated sequencing libraries. Background Technology
[0002] Cell-free DNA (cfDNA) is a ubiquitous nucleic acid fragment found in bodily fluids such as blood. Circulating tumor DNA (ctDNA), which may be present within cfDNA, is widely recognized as a precise tumor biomarker. Therefore, in the field of precision medicine, early tumor screening is typically achieved by analyzing cfDNA (especially its methylation status) in bodily fluids such as blood. However, ctDNA levels are usually low in the blood of early-stage cancer patients, thus requiring high sensitivity and accuracy from relevant detection methods.
[0003] The library preparation method significantly impacts the sensitivity and accuracy of detection methods. Existing double-stranded DNA (dsDNA)-based library preparation methods require high sample volumes and produce libraries with poor coverage, complexity, and uniformity, making them unsuitable for detecting small sample volumes. While existing single-stranded DNA (ssDNA)-based library preparation methods have improved coverage, complexity, and uniformity to some extent, they still suffer from low pre-library yield, poor library quality, and strong end bias. Furthermore, there is still room for improvement in their complexity and uniformity. Summary of the Invention
[0004] To at least partially solve the aforementioned technical problems, in one aspect, the present invention provides a method for preparing a sequencing library, the method comprising the following steps:
[0005] a. Pre-treat DNA samples to convert methylated cytosine (C) or unmethylated C into non-C bases, such as uracil (U), thymine (T), adenine (A), and guanine (G);
[0006] b. Perform denaturation treatment on the nucleic acid product obtained in step a;
[0007] c. Connecting adapters to nucleic acids after denaturation and dehydrogenation.
[0008] In one embodiment, the sequencing is next-generation sequencing. More preferably, the sequencing is next-generation sequencing that detects the methylation state of C.
[0009] In one embodiment, the pretreatment method in step a includes chemical and enzymatic methods, with enzymatic methods being preferred. In a more specific embodiment, the chemical method includes bisulfite-based chemical conversion methods, such as bisulfite sequencing (BS-Seq) and reduced representation bisulfite sequencing (RRBS). In another, more specific embodiment, the enzymatic method includes enzymatic conversion methods based on TET enzymes (e.g., Enzymatic Methyl-sequencing (EM-seq), Tet-assisted Bisulfite Sequencing (TAB-seq), TET-assisted pyridine borane sequencing (TAPS-seq), Magnetic bead-assisted parallel single-cell gene expression sequencing (MAPS-seq)) and enzymatic conversion methods based on deaminases (e.g., Engineered A3C sequencing (EAC-seq), Single Enzyme Methylation sequencing (SEM-seq)).
[0010] In one implementation, in step a, the unmethylated C is converted to U.
[0011] In one embodiment, in step a, the DNA sample is derived from various biological samples, such as bodily fluids (e.g., blood, lymph, cerebrospinal fluid, etc.), or various tissue or organ samples (e.g., bone, muscle, etc., heart, liver, spleen, lung, kidney, brain, skin, etc.). In a preferred embodiment, in step a, the DNA sample is derived from bodily fluids (preferably blood).
[0012] In one embodiment, in step a, the DNA is selected from cfDNA, ctDNA, or genomic DNA (gDNA).
[0013] In one implementation, in step a, the DNA sample is broken into fragments of a certain length before or after pretreatment, the specific length of which is determined by the sequencing platform used. When the DNA sample is non-genomic DNA such as cfDNA or ctDNA, it may not be necessary to break it up.
[0014] In one embodiment, the nucleic acid product obtained in step a is not purified before the denaturation treatment in step b. In another embodiment, the nucleic acid product obtained in step a is purified before the denaturation treatment in step b. More specifically, the purification method includes nucleic acid separation and recovery methods based on nucleic acid gel electrophoresis, nucleic acid separation and recovery methods based on high performance liquid chromatography, nucleic acid separation and recovery methods based on capillary electrophoresis, nucleic acid separation and recovery methods based on size exclusion chromatography, magnetic bead-based methods (e.g., using AMPure XP magnetic beads (Beckman Coulter, Inc.), nucleic acid fragment screening and purification magnetic microspheres (Suzhou Weidu Biotechnology Co., Ltd.)), and adsorption column-based methods (e.g., using oligonucleotide purification and concentration kits (Oligo Clean & Concentrator Kits (ZYMO Research))).
[0015] In one embodiment, no auxiliary substances are added to the nucleic acid product obtained in step a before the denaturation treatment in step b. In another embodiment, an auxiliary substance is added to the nucleic acid product obtained in step a before the denaturation treatment in step b, such as single-stranded DNA binding protein (SSB) (preferably extreme thermostable single-stranded DNA binding protein (ET SSB)), formamide, sodium hydroxide, or dimethyl sulfoxide (DMSO). In one specific embodiment, the final concentration of the SSB (preferably ET SSB) in the final reaction system in step b is 2.0-6.0 ng / μL, for example, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 or 6.0 ng / μL, or a subrange consisting of any values within these ranges, preferably 2.5-4.5 ng / μL, most preferably 3.5-4.2 ng / μL.
[0016] In one embodiment, the treatment in step b can be performed using methods including thermal denaturation, formamide denaturation, and sodium hydroxide denaturation, with thermal denaturation being preferred. In a specific embodiment, the thermal denaturation includes maintaining the system containing the nucleic acid product obtained in step a at at least 90°C (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99°C, or a subrange of any value within these ranges, preferably at least 95°C) for at least 2 minutes (e.g., 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 minutes, or a subrange of any value within these ranges, preferably at least 5 minutes). In a further embodiment, the thermal denaturation further includes maintaining the system containing the nucleic acid product at a temperature not higher than 10°C (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1°C, or a subrange of any value within these ranges, preferably not higher than 4°C) for at least 0.5 minutes (e.g., 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 minutes, or a subrange of any value within these ranges, preferably at least 2 minutes). In a preferred embodiment, the thermal denaturation includes maintaining the system containing the nucleic acid product obtained in step a at at least 95°C for at least 5 minutes, and then maintaining it at a temperature not higher than 4°C for at least 2 minutes.
[0017] In one embodiment, in step c, the denatured single-stranded nucleic acid is ligated with end adapters. In a further embodiment, in step c, the adapters include a 5' end adapter and a 3' end adapter, the 5' end adapter including a random sequence complementary to the 5' end of the single-stranded nucleic acid, and the 3' end adapter including a random sequence complementary to the 3' end of the single-stranded nucleic acid. In an even further embodiment, in step c, the length of the random sequence is 5-10 nt, for example, 5, 6, 7, 8, 9, or 10 nt, preferably 6-9 nt, and most preferably 7 nt.
[0018] In one embodiment, the random sequence contains at least one of A, T, C, and G at a content of no more than 24% (e.g., 24, 23, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1%, preferably no more than 20%, more preferably no more than 10%) or no less than 26% (e.g., 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50%, preferably no less than 30%, more preferably no less than 40%).
[0019] In a preferred embodiment, the random sequence contains 2-9% G, for example, 2, 3, 4, 5, 6, 7, 8 or 9% G, preferably 3-8% G, and most preferably 5% G.
[0020] In one embodiment, step c, the adapter further includes a sequence for connection to the sequencing platform (e.g., the P5 and P7 sequences of the Illumina sequencing platform), a sequence for connection to the sequencing primers, and / or a marker sequence (e.g., an index sequence or a barcode sequence).
[0021] In one embodiment, the reaction system in step c is incubated at 20-40°C (e.g., 20, 25, 30, 35 or 40°C, or a subrange consisting of any values in these ranges, preferably 25-35°C, most preferably 30°C) for at least 0.5 hours (e.g., 0.5, 1, 1.5 or 2 hours, preferably at least 1 hour).
[0022] In one embodiment, the reaction system in step c includes denatured single-stranded nucleic acid, a 5' adapter, and a 3' adapter. Further, the reaction system in step c also includes components selected from the following: buffer (e.g., Tris(hydroxymethyl)aminomethane buffer, i.e., Tris; Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl); Tris buffer salt solution (TBS); Tris acetate EDTA (TAE); Tris borate EDAT (TBE), etc., preferably Tris), dithiothreitol (DTT), adenosine triphosphate (ATP), polynucleotide 5' hydroxykinase (e.g., T4 polynucleotide kinase (T4 PNK)), MgCl2, DNA ligase (e.g., T4 DNA ligase, SplintR ligase, preferably containing both T4 DNA ligase and SplintR ligase), polyethylene glycol (PEG, e.g., PEG 6000, PEG 8000, preferably PEG 6000), Proclin (e.g., Proclin... 150, Proclin 200, Proclin 300 or Proclin 950 (preferably Proclin 950) and / or recombinant albumin, preferably containing all of the above ingredients.
[0023] In a preferred embodiment, the reaction system in step c comprises 0.01-10.00 ng / μL (e.g., 0.01, 0.05, 0.10, 0.50, 1.00, 2.00, 3.00, 4.00, 5.00, 6.00, 7.00, 8.00, 9.00, or 10.00 ng / μL, or a subrange of any value within these ranges) of denatured single-stranded nucleic acid, and 30.0-50.0 nM (e.g., 30.0, 32.5, 35.0, 37.5, 40.0, 42.0). 5' connectors of 5, 45.0, 47.5 or 50.0 nM, or sub-ranges of any values in these ranges, preferably 32.5-47.5 nM, most preferably 35.0-45.0 nM) and / or 3' connectors of 30.0-50.0 nM (e.g., 30.0, 32.5, 35.0, 37.5, 40.0, 42.5, 45.0, 47.5 or 50.0 nM, or sub-ranges of any values in these ranges, preferably 32.5-47.5 nM, most preferably 35.0-45.0 nM). Furthermore, the reaction system in step c further includes a component selected from the following: 40.0-60.0 mM (e.g., 30.0, 32.5, 35.0, 37.5, 40.0, 42.5, 45.0, 47.5, 50.0, 52.5, 55.0, 57.5 or 60.0 mM, or sub-ranges consisting of any values within these ranges, preferably 35.0-55.0 mM, most preferably 37.5-52.5 mM) and a pH of 7.0. Buffers of -8.0 (e.g., 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or subranges consisting of any values within these ranges, preferably 7.2-7.8, most preferably 7.4-7.6) (e.g., Tris(hydroxymethyl)aminomethane buffer, i.e., Tris; Tris; Tris HCl); Tris buffered salt solution (TBS); Tris acetate EDTA (TAE); Tris borate EDAT (TBE), etc., preferably Tris); 5.0-15.0 mM (e.g., 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0 or 15.0 mM, or sub-ranges consisting of any values in these ranges, preferably 7.0-13.0 mM, most preferably 8.0-12.0 mM); dithiothreitol (DTT); 0.10-2.00 mM (e.g., 0.10, 0.15, 0.20, 0.25, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 1.00, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, 1.80, 1.85, 1.90, 1.95 or 2.00 mM, or subranges consisting of any values within these ranges, preferably 0.30-0.90 mM, most preferably 0.50-0.80 mM) of adenosine triphosphate (ATP), 0.025-0.125 U / μL (e.g. The concentrations of polynucleotide 5'-hydroxykinases (e.g., T4 polynucleotide kinase) are 0.025, 0.030, 0.035, 0.040, 0.045, 0.050, 0.055, 0.060, 0.065, 0.070, 0.075, 0.080, 0.085, 0.090, 0.095, 0.100, 0.105, 0.110, 0.115, 0.120, or 0.125 U / μL, or subranges consisting of any values within these ranges, preferably 0.050-0.100 U / μL, most preferably 0.070-0.080 U / μL. MgCl2 at concentrations of 15.0-20.0 mM (e.g., 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5 or 20.0 mM, or subranges consisting of any values within these ranges, preferably 15.5-19.5 mM, most preferably 16.5-18.5 mM), and 20.0-30.0 U / μL (e.g., 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 3... DNA ligase at a concentration of 0.0 U / μL, or a subrange consisting of any values within these ranges, preferably 21.0-29.0 U / μL, most preferably 23.0-27.0 U / μL (e.g., 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 U / μL, or a subrange consisting of any values within these ranges, preferably 21.0-29.0 U / μL, most preferably 23.0-27.0 U / μL) and a concentration of 20.0-30 ... DNA ligase, 0.10-0.20 U / μL (e.g., 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19 or 0.20 U / μL, or subranges of any values within these ranges, preferably 0.12-0.18 U / μL, most preferably 0.13-0.20 U / μL).SplintR ligase (17 U / μL), preferably also containing 20.0-30.0 U / μL (e.g., 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 U / μL, or subranges of any values in these ranges, preferably 21.0-29.0 U / μL, most preferably 23.0-27.0 U / μL) T4. DNA ligase and 0.10–0.20 U / μL (e.g., 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, or 0.20 U / μL, or subranges of any values within these ranges, preferably 0.12–0.18 U / μL, most preferably 0.13–0.17 U / μL) SplintR ligase. 10.0-20.0 wt.% (e.g., 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0 or 20.0 wt.%, or subranges consisting of any values within these ranges, preferably 12.0-18.0 wt.%, most preferably 15.0-17.0 wt.%) of polyethylene glycol. Glycol, PEG, e.g., PEG 6000, PEG8000), 0.01-0.10 wt.% (e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or 0.10 wt.%, or subranges of any values within these ranges, preferably 0.02-0.08 wt.%, most preferably 0.03-0.07 wt.%) of Proclin (e.g., Proclin 150, Proclin 200, Proclin 300 or Proclin 950, preferably Proclin 950). 950) and / or 15.0-25.0 ng / μL (e.g., 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0 or 25.0 ng / μL, or subranges consisting of any values within these ranges, preferably 16.0-24.0 ng / μL, most preferably 17.0-23.0 ng / μL) recombinant albumin, preferably containing all of the above components.
[0024] In one implementation, steps a, b, and c are all performed in the same tube.
[0025] In a further embodiment, the method further includes step d. amplifying the product obtained in step c. In a more specific embodiment, the amplification method is selected from: polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), alternating cyclic amplification (ACAP), preferably polymerase chain reaction (PCR).
[0026] In one implementation, steps a, b, c, and d are all performed in the same tube.
[0027] In a further embodiment, the method further includes step e. purifying the amplification product obtained in step d. More specifically, the purification method includes nucleic acid separation and recovery methods based on nucleic acid gel electrophoresis, nucleic acid separation and recovery methods based on high performance liquid chromatography, nucleic acid separation and recovery methods based on capillary electrophoresis, nucleic acid separation and recovery methods based on size exclusion chromatography, magnetic bead-based methods (e.g., using AMPure XP magnetic beads (Beckman Coulter, Inc.), nucleic acid fragment screening and purification magnetic microspheres (Suzhou Weidu Biotechnology Co., Ltd.)), and adsorption column-based methods (e.g., using oligonucleotide purification and concentration kits (Oligo Clean & Concentrator Kits (ZYMO Research))).
[0028] In a further embodiment, the method further includes step f: directly performing sequencing analysis on the purified product obtained in step e, or performing targeted enrichment on the purified product obtained in step e before performing sequencing analysis.
[0029] In another aspect of the invention, a composition is provided comprising one or more components in the reaction system used in step c of the method of the invention. Optionally, it further comprises one or more components in the reaction system used in steps a, b, d, e and / or f of the method of the invention.
[0030] In another aspect of the invention, a kit is provided comprising the composition of the invention.
[0031] The method of this invention can effectively improve the output, quality, complexity, uniformity, methylation quantification accuracy, and methylation site detection sensitivity of libraries.
[0032] Furthermore, the method of this invention enables "one-tube" library construction, meaning that samples pretreated in step a can directly enter the library construction process without purification. At the same time, steps a, b, c, and d can all be performed in the same tube without purification or tube replacement, simplifying the operation, greatly avoiding sample loss, saving costs, and shortening the library construction time.
[0033] In this invention, unless otherwise specified, "reaction system" and "system" can be used interchangeably, both referring to the final mixture in each step.
[0034] In this invention, unless otherwise specified, the concentration refers to the final concentration in the system at each step.
[0035] In this invention, each value can be an approximate value after rounding.
[0036] In this invention, percentages (%) refer to mass percentages unless otherwise specified or have other meanings that can be understood by those skilled in the art (e.g., when describing the percentage of a base, it refers to the percentage of quantity or molar percentage, or the probability of a base appearing at a specific position).
[0037] The term "base" as used in this invention (including adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U)) may refer to the base itself or a compound containing that base (e.g., the corresponding (deoxy)nucleoside or (deoxy)nucleotide) depending on the specific context and convention in the art. Unless otherwise stated, this invention distinguishes various bases and compounds containing various bases only by the base portion. For example, adenine may refer to the base adenine (A) itself or compounds such as deoxyadenosine triphosphate (dATP) containing that base.
[0038] In this invention, unless otherwise specified, "bp" and "nt" can be used interchangeably. They are not intended to distinguish between single and double stranded states of a sequence, but are only used to indicate the sequence length.
[0039] In this invention, unless otherwise specified, "read" and "segment" can be used interchangeably. Attached Figure Description
[0040] Figure 1 This is a schematic diagram of a specific example of the method of the present invention.
[0041] Figure 2 This shows the distribution of the terminal bases of the R1 sequencing fragment.
[0042] Figure 3 This shows the distribution of bases at the ends of the R2 sequencing fragments.
[0043] Figure 4The invention demonstrates a comparison of prescript library yields between the method of this invention and the Accel-seq method under different cfDNA sample input amounts.
[0044] Figure 5 This paper presents a comparison of the complexity of libraries obtained by the method of this invention and the Accel-seq method under different cfDNA sample input amounts.
[0045] Figure 6 This paper presents a comparison of the effective sequencing depth of libraries obtained by the method of this invention and the Accel-seq method under different cfDNA sample input amounts.
[0046] Figure 7 This paper presents a comparison of the target rates in sequencing libraries obtained by the method of this invention and the Accel-seq method under different cfDNA sample input amounts.
[0047] Figure 8 This paper presents a comparison of the capture region complexity of libraries obtained by the method of this invention and the Accel-seq method under different cfDNA sample input amounts.
[0048] Figure 9 The consistency of methylation sequencing results of libraries obtained by the method of the present invention under different cfDNA sample input amounts is demonstrated.
[0049] Figure 10 The consistency of methylation sequencing results of libraries obtained by the Accel-seq method under different cfDNA sample input amounts is demonstrated.
[0050] Figure 11 The proportion of nonmethylated differentially expressed regions obtained by the method of this invention and the Accel-seq method is shown under different HCT116 cell gDNA percentages.
[0051] Figure 12 The proportion of differentially methylated regions obtained by the method of this invention and the Accel-seq method is shown under different HCT116 cell gDNA percentages.
[0052] Figure 13 The distribution of methylation levels measured by the method of this invention and the Accel-seq method in samples with different methylation levels is shown. Detailed Implementation
[0053] To better understand the present invention, the following embodiments further illustrate the content of the invention, but the content of the invention is not limited to the following embodiments. Unless otherwise specified, the experimental operations described in the following embodiments are routine operations; the reagents and materials described are commercially available unless otherwise specified.
[0054] The sequencing platform used in this section is the Illumina sequencing platform (specifically, the NovaSeq 6000). The setup parameters and specific operations for the sequencing process were performed according to the manufacturer's instructions. Unless otherwise specified, pre-sequencing operations (e.g., sample preparation and library construction) were performed according to the manufacturer's recommended standard parameters and procedures.
[0055] Unless otherwise specified, the cfDNA samples extracted in this section are all blood samples from healthy East Asian individuals.
[0056] 1. The influence of the base composition of random sequences in the linker on the library.
[0057] To investigate the impact of the base composition of random sequences in the linker on the library, the following procedures were performed.
[0058] cfDNA was extracted using a commercial kit (QIAamp Circulating Nucleic Acid Kit (Qiagen)) and divided into 10 samples (10 ng cfDNA / sample) for subsequent experiments;
[0059] Using commercially available reagent kits ( The above-mentioned cfDNA was pretreated using the Enzymatic Methyl-seq Conversion Module (NEB). The oxidation reaction, oxidation cessation reaction, nucleic acid purification, nucleic acid denaturation, and deamination reaction were performed according to the instructions of this commercial kit.
[0060] The reaction system was purified using twice the volume of nucleic acid fragment screening and purification magnetic microspheres (Suzhou Weidu Biotechnology Co., Ltd.);
[0061] Resuspension with 20 μL of enzyme-free water, and collect the eluted and recovered nucleic acids;
[0062] After adding 2 μL of ET SSB (NEB) (the final concentration in the system is 41 ng / μL), nucleic acid thermal denaturation was performed (heating at 98°C for 5 minutes, followed immediately by placing on ice for 2 minutes);
[0063] The adapter ligation reaction was performed using the following reaction system (all concentrations are final): 22 μL denatured nucleic acid, 37.5 nM 5' adapter, 37.5 nM 3' adapter, 50 mM Tris pH 7.5, 10 mM DTT, 1 mM ATP, 0.075 U / μL T4 PNK (NEB), 10 mM MgCl2, 25 U / μL T4 DNA ligase (NEB), 0.15 U / μL SplintR ligase (NEB), and 20% PEG8000. The base composition of the random sequences contained in the 5' and 3' adapters is shown in Table 1 below. The above reaction system was incubated at 30°C for 1 hour.
[0064] The above reaction system was purified using 1.8 times the volume of nucleic acid fragment screening and purification magnetic microspheres;
[0065] Redissolve the eluted nucleic acid in 25 μL of enzyme-free water and collect the eluted nucleic acid. Add index primers (index primer P5 (5'-3'): AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTT CCCTACACGACGCTCTTCCGATCT; index primer P7 (5'-3'): CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, where consecutive Ns refer to the index sequence; unless otherwise specified, the index primers mentioned below are the same except for the index sequence) for PCR amplification. The amplification system was: 25 μL of eluted nucleic acid, 2 μM of index primer, and 1X KAPA HiFi HotStart Uracil + ReadyMix. The PCR amplification program was 98℃ for 45 s; 98℃ for 10 s, 60℃ for 30 s, 72℃ for 30 s, 9 cycles; 72℃ for 1 min.
[0066] The amplified PCR products were purified. Purification was performed using 1.2 times the volume of nucleic acid fragment screening and purification magnetic microspheres, followed by elution with 30 μL of enzyme-free water to obtain the pre-library product.
[0067] The pretext library output is shown in Table 2 below;
[0068] The pre-library was hybridized and captured using an IDT kit (xGen universal blocking agent TS and xGen Hybridization and Washv2 Kit) and GenScript probes to form the final library product. The final library product was sequenced and analyzed using a NovaSeq 6000 sequencing system. The analysis workflow was implemented using the following software: fastqc v0.11.9, cutadapt 3.5, bwameth 0.2.6, sambamba 0.6.6, picard 2.26.4, MethylDackel 0.6.0, and seqkit v2.2.0. Unless otherwise specified, the recommended settings by the software authors were used. The raw_reads and other metrics in the sequencing results were derived from the output of the aforementioned software. The sequencing results are shown in Table 3 below. Figures 2-3 As shown.
[0069] Table 1 shows the base composition ratio of the random sequences contained in the connectors in each group of samples.
[0070]
[0071] Table 2 Pretext Library Output
[0072]
[0073]
[0074] Table 3 Sequencing data
[0075]
[0076] Note: The meanings of the indicators in the tables are as follows (unless otherwise specified or understood by those skilled in the art to have other meanings, the same indicators in subsequent tables and figures have the same meanings as here):
[0077] 1. raw_reads: This refers to the raw sequencing data, which includes all unfiltered and uncontrolled sequences generated after sequencing. In this experiment, raw reads were normalized to allow for comparison of different sample groups at the same level.
[0078] 2. clean_ratio_via_reads: This indicates the proportion of raw reads remaining after quality control, removing connector sequences, low-quality sequences, and impurity sequences. It shows the utilization of the data and the quality of the library.
[0079] 3. mapped_ratio_raw_human: This indicates the proportion of reads aligned to the reference genome out of all raw reads, also reflecting the degree of data utilization and library quality.
[0080] 4. unique_ratio_human: This indicates the proportion of non-repeating reads among the reads aligned to the human genome, reflecting the complexity of the library.
[0081] 5. mean_insert_size_dedup_human: This represents the average fragment length of the sequence after deduplication and alignment to the human genome.
[0082] 6. target_unique_ratio_human: Represents the proportion of non-repetitive sequences within the target region of the human genome.
[0083] 7. `target_mean_cov_raw_human`: Represents the average sequencing depth of the target region in the human genome before deduplication. Greater depth indicates more utilization of sequencing data resources.
[0084] 8. target_mean_cov_dedup_human: Represents the average sequencing depth of the target region in the human genome after deduplication. The deeper the depth, the more fully the effective sequencing region is utilized.
[0085] 9. target_ratio_raw_human: This represents the target ratio of the target region in the human genome before deduplication, reflecting the hybridization capture efficiency.
[0086] As can be seen from the pre-library yield and sequencing data in Tables 2 and 3, samples 3 and 4 have higher pre-library yields, and the libraries have the highest complexity and the best uniformity.
[0087] also, Figure 2 This shows the base distribution at the ends of the R1 sequencing fragment. Figure 3 This shows the distribution of terminal bases in the R2 sequencing fragments. It demonstrates that the terminal bases of libraries 3 and 4 are the most homogeneous.
[0088] 2. The impact of the linking system on the library
[0089] To investigate the impact of the linking system on the library, the following operations were performed.
[0090] cfDNA was extracted using a commercial kit (QIAamp Circulating Nucleic Acid Kit (Qiagen)) and divided into 4 samples (10 ng cfDNA / sample) for subsequent experiments;
[0091] Using commercially available reagent kits ( The above cfDNA was pretreated using the Enzymatic Methyl-seq Conversion Module (NEB). Unless otherwise specified, all steps were performed according to the instructions of the commercial kit. Denaturation conditions before deamination were 98°C for 10 minutes, followed immediately by 2 minutes on ice. The deamination reaction volume was 20 μL (containing 16.5 μL of nucleic acid recovered from the previous purification step, 0.5 μL of bovine serum albumin (BSA), 1 μL of apolioprotein B mRNA-editing enzyme catalytic polypeptide (APOBEC), and 2 μL of APOBEC reaction buffer). After deamination, the reaction volume was not purified or transferred to tubes; it was directly used in the library construction process.
[0092] After adding 2 μL of ET SSB (NEB) (the final concentration in the system is 41 ng / μL), nucleic acid thermal denaturation was performed (heating at 98°C for 5 minutes, followed immediately by placing on ice for 2 minutes);
[0093] The joint connection reaction was carried out in two different reaction systems, wherein:
[0094] Reaction system A (all concentrations are final, reaction volume 50 μL): 22 μL denatured nucleic acid, 60 nM 5' adapter (C 20%, T 27%, A 48%, G 5%), 30 nM 3' adapter (C 20%, T 27%, A 48%, G 5%), 50 mM Tris pH 8.0, 10 mM DTT, 1 mM ATP, 0.125 U / μL T4 PNK (NEB), 10 mM MgCl2, 25 U / mL T4 DNA ligase (NEB), 20% PEG 8000. The above reaction system was incubated at 37°C for 45 minutes.
[0095] Reaction system B (all concentrations are final concentrations, reaction volume 40 μL): 22 μL denatured nucleic acid, 37.5 nM 5' adapter (C 20%, T 27%, A 48%, G 5%), 37.5 nM 3' adapter (C 20%, T 27%, A 48%, G 5%), 50 mM Tris pH 7.5, 10 mM DTT, 0.75 mM ATP, 0.075 U / μL T4 PNK (NEB), 17.5 mM MgCl2, 25 U / μL T4 DNA ligase (NEB), 0.15 U / μL SplintR ligase (NEB), 16% PEG 6000, 0.05% Proclin 950, 20 ng / μL recombinant albumin. The above reaction system was incubated at 30°C for 1 hour.
[0096] After the ligation reaction, without purification, index primers (index primer P5 (5'-3'): AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTT CCCTACACGACGCTCTTCCGATCT (sequence 1); index primer P7 (5'-3'): CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT (sequence 2), where consecutive N refers to the index sequence) and polymerase were added for amplification. The amplification system was as follows: the ligation reaction system was supplemented with enzyme-free water to a final concentration of 50 μL, index primers at a final concentration of 2 μM, and Equinox Uracil Tolerant Amplification Kit (Watchmaker genomics) at a final concentration of 1X. The PCR amplification program was 98℃ for 45 s; 98℃ for 10 s, 60℃ for 30 s, 72℃ for 30 s, 9 cycles; 72℃ for 1 min;
[0097] The amplified PCR products were purified. Purification was performed using a 1-volume volume of nucleic acid fragment screening and purification magnetic microspheres, followed by elution with 30 μL of enzyme-free water. The purification step was repeated once to obtain the pre-library product. The pre-library yields are shown in Table 4 below.
[0098] The pre-library was hybridized and captured using the IDT kit (xGen universal blocking agent TS and xGen Hybridization and Washv2 Kit) and GenScript probes to form the final library product;
[0099] The final library products were sequenced and analyzed using the NovaSeq 6000 sequencing system. The analysis workflow was implemented using the following software: fastqc v0.11.9, cutadapt 3.5, bwameth 0.2.6, sambamba 0.6.6, picard 2.26.4, MethylDackel 0.6.0, and seqkit v2.2.0. Unless otherwise specified, the recommended settings by the software authors were used. The raw_reads and other metrics in the sequencing results were derived from the output of the aforementioned software. The sequencing results are shown in Table 5 below.
[0100] Table 4 Pretext Library Output
[0101]
[0102] Table 4 shows that the library construction process using reaction system B has a higher pre-library yield.
[0103] Table 5 Sequencing data
[0104]
[0105]
[0106] Note: The meanings of the indicators in the table are as follows (unannotated indicators have the same meanings as those in the aforementioned table):
[0107] 1. clean_ratio_via_bases: This indicates the proportion of bases in the remaining sequence after removing adapter sequences, low-quality sequences, and impurity sequences from the raw reads. It shows the utilization of the data and the quality of the library.
[0108] Table 5 shows that the library prepared using reaction system B has better performance in terms of complexity (unique_ratio_human) and effective sequencing depth (target_mean_cov_dedup_human).
[0109] 3. Comparison of library construction results and sequencing results between the library construction method of this invention and the existing library construction method (Accel-seq).
[0110] cfDNA was extracted using a commercial kit (QIAamp Circulating Nucleic Acid Kit (Qiagen)) and divided into 12 samples (5, 30, or 100 ng cfDNA / sample) for subsequent experiments.
[0111] (1) The database construction operation was performed using the method of the present invention and the Accel-seq method respectively.
[0112] 1) Method flow of the present invention:
[0113] Using commercially available reagent kits ( The above cfDNA was pretreated using the Enzymatic Methyl-seq Conversion Module (NEB). Unless otherwise specified, all steps were performed according to the instructions of the commercial kit. 0.3 μL of Oxidation enhancer was used in the oxidation reaction system. Denaturation conditions were 98°C for 10 minutes, followed immediately by 2 minutes on ice. The deamination reaction system consisted of 20 μL (containing 16.5 μL of nucleic acid recovered from the previous purification step, 0.5 μL of BSA, 1 μL of APOBEC, and 2 μL of APOBEC reaction buffer). After the deamination reaction, the reaction system was not purified or transferred to tubes; it was directly proceeded to the library construction process.
[0114] After adding 2 μL of ET SSB (NEB) (the final concentration in the system is 41 ng / μL), nucleic acid thermal denaturation was performed (heating at 98°C for 5 minutes, followed immediately by placing on ice for 2 minutes);
[0115] The adapter ligation reaction was performed using the following reaction system (all concentrations are final): 22 μL of denatured nucleic acid, 37.5 nM 5' adapter (C 20%, T 27%, A 48%, G 5%), 37.5 nM 3' adapter (C 20%, T 27%, A 48%, G 5%), 50 mM Tris (pH 7.5), 10 mM DTT, 0.75 mM ATP, 0.075 U / μL T4 PNK (NEB), 17.5 mM MgCl2, 25 U / μL T4 DNA ligase (NEB), 0.15 U / μL SplintR ligase (NEB), 16% PEG 6000, 0.05% Proclin 950, and 20 ng / μL recombinant albumin. The reaction system was incubated at 30°C for 1 hour.
[0116] After the ligation reaction, without purification, index primers (index primer P5 (5'-3'): AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTT CCCTACACGACGCTCTTCCGATCT; index primer P7 (5'-3'): CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT, where consecutive N refers to the index sequence) and polymerase were added for amplification. The amplification system consisted of 40 μL of ligation reaction mixture, 2 μM of index primers, and 1X Equinox Uracil Tolerant Amplification Kit (Watchmaker genomics). The PCR amplification program was 98℃ for 45 s; 98℃ for 10 s, 60℃ for 30 s, 72℃ for 30 s, for 9 cycles; 72℃ for 1 min.
[0117] The amplified PCR products were purified. Purification was performed using a 1-volume volume of nucleic acid fragment screening and purification magnetic microspheres, followed by elution with 30 μL of enzyme-free water. This purification step was repeated once to obtain the pre-library product. The pre-library yields are shown in Table 6 below. Figure 4 As shown.
[0118] 2) Accel-seq method flow:
[0119] Samples were pretreated using a commercial kit (EZ DNA Methylation-Lightning Kit (ZYMO research, D5030)). All steps were performed according to the manufacturer's instructions. The pretreated DNA was then processed using a commercial kit (SwiftBiosciences). The library was constructed using 1S DNA LIBRARY KITS, and PCR amplification was performed for 12 cycles to form a pretext library.
[0120] (2) The pre-library was hybridized and captured using the IDT kit (xGen universal blocking agent TS and xGen Hybridization and Wash v2 Kit) and GenScript probes to form the final library product.
[0121] (3) The final library products were sequenced and analyzed using the NovaSeq 6000 sequencing system. The analysis process was implemented using the following software: fastqc v0.11.9, cutadapt 3.5, bwameth 0.2.6, sambamba 0.6.6, picard 2.26.4, MethylDackel 0.6.0, and seqkit v2.2.0. Unless otherwise specified, the recommended settings by the software authors were used. The raw_reads and other metrics in the sequencing results were derived from the output of the aforementioned software. The sequencing results are shown in Table 7 below. Figures 5-10 As shown.
[0122] Table 6 Pretext Library Output
[0123]
[0124]
[0125] Table 7 Sequencing Results
[0126]
[0127] Note: Tables and Figures 5-8 Each indicator in this table has the same meaning as the indicators in the table above.
[0128] Table 6 and Figure 4 The results show that, for various sample input amounts, the library construction method of this invention can achieve a higher pre-library yield compared to the Accel-seq method.
[0129] Table 7 and Figures 5-8 The results show that, for various sample input amounts, the library preparation method of this invention achieves better results than the Accel-seq method in terms of library complexity, effective sequencing depth, target rate in sequencing, and complexity of the captured region.
[0130] also, Figures 9-10 The consistency of methylation results obtained by sequencing using the two methods under different sample input amounts was compared. The results showed that sequencing the library obtained using the method of this invention yielded better consistency in methylation levels under different sample input amounts.
[0131] 4. Comparison of sample detection sensitivity between the library construction method of this invention and the existing library construction method (Accel-seq).
[0132] Using gDNA samples from human colon cancer cells HCT116 and NA12878 that had been digested with MNase, the gDNA samples from HCT116 and NA12878 cells were mixed and blended at different proportions of HCT116 gDNA, namely 0%, 0.05%, 0.1%, 0.5%, 1%, 5%, and 100%, to obtain gDNA samples containing different proportions of HCT116.
[0133] Library construction was performed using both the method of this invention and the Accel-seq method (10 ng of enzyme-digested gDNA sample was used in both cases). Except for the PCR amplification in the Accel-seq method, which consisted of 11 cycles, the rest of the procedure was exactly the same as in section "3. Comparison of library construction results and sequencing results between the library construction method of this invention and the existing library construction method (Accel-seq)".
[0134] The pre-library yields are shown in Table 8 below, and the sequencing data are shown in Table 9 below.
[0135] Table 8 Pretext Library Output
[0136]
[0137]
[0138] Table 9 Sequencing data
[0139]
[0140] Note: The meanings of the indicators in the table are as follows (unannotated indicators have the same meanings as those in the aforementioned table):
[0141] 1. target_0.5_cov_mean_raw_human: The percentage of bases in the target region of the human genome with a coverage depth greater than 0.5 times the average coverage depth relative to the total number of bases before deduplication. This data reflects the uniformity of the library.
[0142] 2. target_0.5_cov_mean_dedup_human: The percentage of bases in the human genome whose target region coverage depth is greater than 0.5 times the average coverage depth after deduplication, relative to the total number of bases. This data reflects the uniformity of the library.
[0143] The results in Tables 8 and 9 show that when using enzyme-digested gDNA as samples and homogenizing it according to the average original depth of the target region, the key indicators such as pre-library yield, complexity, uniformity, average depth of the capture region, and complexity of the capture region are significantly better than the Accel-seq library construction method when using the method of the present invention for library construction.
[0144] To further compare the sample detection sensitivity of the two methods, the following steps were performed.
[0145] The target region was divided into different blocks (approximately 60,000 blocks) based on regions containing one, two, or more CpG sites. For each block, the total number of fragments in that block was counted. The methylation level of CpG sites in each fragment was calculated. If more than 85% of the CpG sites in a fragment were methylated, the fragment was designated as a methylated fragment (M-read), and the proportion of its number to the total number of fragments in that block was defined as the methylated block ratio (M ratio). If more than 85% of the CpG sites in a fragment were unmethylated, the fragment was designated as an unmethylated fragment (U-read), and the proportion of its number to the total number of fragments in that block was defined as the unmethylated block ratio (U ratio).
[0146] To calculate the number of differential blocks, we first define a set of differential block regions. For positive samples (100% HCT116 samples) and negative samples (0% HCT116 samples), we calculate the mean of the proportion of methylated fragments and the proportion of unmethylated fragments in each region among the replicate samples. We then determine the regions where the difference between the mean of positive samples and negative samples is >0.2 as the set of differential block regions.
[0147] Using all negative samples as a baseline, the mean and standard deviation of the proportion of methylated blocks and the proportion of unmethylated blocks in each differentially expressed region were calculated for all negative samples (0% HCT116 samples).
[0148] For samples with different doping ratios, the proportions of methylated and unmethylated blocks were calculated separately and then compared with the corresponding block proportions of the baseline sample to identify the differential blocks. Specifically, for each block of each sample, the differences between the proportions of methylated and unmethylated blocks and the baseline sample points were calculated; based on the criterion of a significant difference (P<0.05), the number of differential blocks between methylated and unmethylated blocks was selected.
[0149] The proportion of differentially expressed regions to the total differentially expressed region set was calculated for each of the two library construction methods under different HCT116 cell percentages. The results are shown in Table 10. Figure 11 and 12 As shown.
[0150] In both library construction methods, the proportions of differentially methylated and unmethylated regions increased with the increase in the proportion of HCT116 cells. The library construction method of this invention has a higher proportion of both differentially methylated and unmethylated regions than the Accel-seq library construction method, indicating that the method of this invention has higher sample detection sensitivity.
[0151] Table 10. Proportion of methylated and non-methylated differential blocks
[0152]
[0153]
[0154] 5. Comparison of sample detection accuracy between the library construction method of this invention and the existing library construction method (Accel-seq).
[0155] HCT116 cell gDNA samples with fully methylated CpG (hereinafter referred to as "fully methylated") and fully unmethylated CpG (hereinafter referred to as "fully unmethylated") were mixed and blended according to the proportion of fully methylated CpG HCT116 cell gDNA samples of 0%, 20%, 40%, 60%, 80%, and 100% to obtain HCT116 cell gDNA samples containing different proportions of fully methylated CpG.
[0156] Library construction was performed using both the method of this invention and the Accel-seq method (10 ng of enzyme-digested gDNA sample was used in both cases). Except for the PCR amplification in the Accel-seq method, which consisted of 13 cycles, the rest of the procedure was exactly the same as in section "3. Comparison of library construction results and sequencing results between the library construction method of this invention and the existing library construction method (Accel-seq)".
[0157] The pre-library yields are shown in Table 10 below, and the sequencing data are shown in Table 11 below.
[0158] Table 10 Pretext Library Output
[0159]
[0160] Table 11 Sequencing data
[0161]
[0162]
[0163]
[0164] Note: The indicators in the table have the same meaning as those in the aforementioned table.
[0165] The results in Tables 10 and 11 show that when using enzyme-digested gDNA as samples and homogenizing it according to the average original depth of the target region, the key indicators such as pre-library yield, complexity, uniformity, average depth of the capture region, and complexity of the capture region are significantly better than the Accel-seq library construction method when using the method of the present invention for library construction.
[0166] To further compare the sample detection accuracy of the two methods, the following steps were performed.
[0167] Site selection was performed on the files in the target region after deduplication; for 100% methylated (i.e., CpG fully methylated) samples, sites with a depth greater than or equal to 100× and a CpG methylation rate greater than 97% were selected; 20,624 CpG sites were obtained.
[0168] For 0% methylated (i.e., CpG is all nonmethylated) samples, sites with a depth greater than or equal to 100× and a CpG methylation rate of less than 2% were screened out; 50,332 CpG sites were obtained.
[0169] Sites that pass both screening methods are defined as test sites; 5394 test sites were obtained; the methylation level of the test sites in each test sample was evaluated.
[0170] The accuracy results of methylation sample detection are as follows: Figure 13 As shown, compared with the Accel-seq library construction method, the method of the present invention has more convergent methylation levels measured in samples of various methylation levels, indicating higher accuracy.
Claims
1. A method for preparing a sequencing library, characterized in that: The method includes the following steps: a. Pre-treat DNA samples to convert methylated cytosine (C) or unmethylated C into non-C bases; b. Perform denaturation treatment on the nucleic acid product obtained in step a; c. Ligating the nucleic acid adapters after denaturation and melting. In step c, the denatured single-stranded nucleic acid is ligated with end adapters. The 5' end adapter includes a random sequence complementary to the 5' end of the single-stranded nucleic acid, and the 3' end adapter includes a random sequence complementary to the 3' end of the single-stranded nucleic acid. In the random sequence, the content of at least one of A, T, C, and G is not higher than 24% or not lower than 26%.
2. The method according to claim 1, wherein the pretreatment method in step a includes chemical methods and enzymatic methods.
3. The method according to claim 2, wherein the chemical method includes a chemical conversion method based on bisulfite.
4. The method according to claim 2, wherein the enzymatic method includes an enzymatic conversion method based on TET enzyme and an enzymatic conversion method based on deaminase.
5. The method according to any one of the preceding claims, wherein in step a, the unmethylated C is converted to U.
6. The method according to any one of the preceding claims, wherein in step a, the DNA is selected from cfDNA, ctDNA, or genomic DNA (gDNA).
7. The method according to any one of the preceding claims, wherein the nucleic acid product obtained in step a is not purified before the denaturation treatment in step b, or, The nucleic acid product obtained in step a is purified before the denaturation process in step b.
8. The method according to any one of the preceding claims, wherein in step b, no auxiliary substance is added to the nucleic acid product obtained in step a before the denaturation treatment, or, in step b, an auxiliary substance is added to the nucleic acid product obtained in step a before the denaturation treatment.
9. The method according to claim 8, wherein the final concentration of SSB in the final reaction system in step b is 2.0-6.0 ng / μL.
10. The method according to any one of the preceding claims, wherein the treatment in step b may be performed by methods including thermal denaturation, formamide denaturation, and sodium hydroxide denaturation.
11. The method of claim 10, wherein the thermal denaturation comprises maintaining the system containing the nucleic acid product obtained in step a at at least 90°C for at least 2 minutes, and then maintaining the system containing the nucleic acid product at at least 10°C for at least 0.5 minutes.
12. The method according to any one of the preceding claims, wherein the length of the random sequence is 5-10 nt.
13. The method according to any one of the preceding claims, wherein the random sequence contains 2-9% G.
14. The method according to any one of the preceding claims, wherein the adapter further comprises a sequence for connection to a sequencing platform, a sequence for binding to sequencing primers, and / or a marker sequence.
15. The method according to any one of the preceding claims, wherein the reaction system in step c is incubated at 20-40°C for at least 0.5 hours.
16. The method according to any one of the preceding claims, wherein the reaction system in step c comprises denatured single-stranded nucleic acid, a 5' adapter and a 3' adapter, and a component selected from: buffer, dithiothreitol, adenine nucleoside triphosphate, polynucleotide 5' hydroxykinase, MgCl2, DNA ligase, polyethylene glycol, Proclin and / or recombinant albumin.
17. The method according to claim 16, wherein the reaction system in step c comprises 0.01-10.00 ng / μL of single-stranded nucleic acid after denaturation, 30.0-50.0 nM of 5' adapter and / or 30.0-50.0 nM of 3' adapter, and The ingredients are selected from the following: 40.0-60.0 mM buffer solution with a pH of 7.0-8.0, 5.0-15.0 mM dithiothreitol, 0.10-2.00 mM adenine nucleoside triphosphate, 0.025-0.125 U / μL polynucleotide 5'-hydroxykinase, 15.0-20.0 mM MgCl2, 20.0-30.0 U / μL DNA ligase, 10.0-20.0 wt.% polyethylene glycol, 0.01-0.10 wt.% proclin and / or 15.0-25.0 ng / μL recombinant albumin.
18. The method according to any one of the preceding claims, wherein steps a, b and c are all performed in the same tube.
19. The method according to any one of the preceding claims, further comprising step d. amplifying the product obtained in step c, wherein the amplification method is selected from: polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and alternating cyclic amplification (ACAP).
20. The method according to claim 19, wherein steps a, b, c and d are all performed in the same tube.
21. The method according to claim 20, further comprising step e. purifying the amplification product obtained in step d.
22. The method according to claim 7 or 21, wherein the purification process includes a nucleic acid separation and recovery method based on nucleic acid gel electrophoresis, a nucleic acid separation and recovery method based on high performance liquid chromatography, a nucleic acid separation and recovery method based on capillary electrophoresis, a nucleic acid separation and recovery method based on size exclusion chromatography, a magnetic bead-based method, and an adsorption column-based method.
23. The method according to claim 21, further comprising step f: directly performing sequencing analysis on the purified product obtained in step e, or performing targeted enrichment on the purified product obtained in step e before performing sequencing analysis.
24. A composition comprising one or more components in the reaction system used in step c of the method according to any one of claims 1-23; optionally, it further comprising one or more components in the reaction system used in steps a, b, d, e and / or f of the method of the present invention.
25. A kit comprising the composition of claim 24.