KASP primers related to pepper fruit orientation and application thereof
By developing KASP primers at position 39737613 on chromosome 12 of pepper, the problem of the accuracy of molecular markers for pepper fruit orientation was solved, enabling early and high-throughput identification of fruit orientation, improving breeding efficiency and reducing costs.
Patent Information
- Application Number
- CN202610620114.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-08
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2046-05-08
AI Technical Summary
Existing technologies are difficult to efficiently and accurately perform molecular markers for the orientation of pepper fruits, resulting in long breeding cycles, high costs, and low selection efficiency. Traditional marker technologies are prone to false positives or false negatives under different environmental conditions.
We developed KASP primers based on the SNP site at position 39737613 on chromosome 12 of pepper, designed specific forward primers and combined them with fluorescent reporter groups for high-throughput and accurate identification of fruit orientation using competitive allele-specific polymerase chain reaction (KASP).
It enables early, high-throughput, and precise identification of pepper fruit orientation, significantly shortens the breeding cycle, improves selection efficiency, reduces field management costs, and provides an efficient and reliable molecular-assisted breeding tool.
Smart Images

Figure CN122146931A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular markers, specifically to a KASP primer associated with the orientation of pepper fruits and its applications. Background Technology
[0002] chili( Capsicum annuum As a widely cultivated and consumed economic crop globally, fruit orientation is one of the key agronomic traits affecting fruit quality, harvesting efficiency, and overall economic benefits. In traditional chili pepper cultivation, fruit orientation is primarily influenced by a combination of genetic and environmental factors, with complex genetic patterns that make precise improvement difficult through simple phenotypic observation and conventional breeding methods. However, the rapid development of molecular biology techniques, especially the widespread application of molecular markers in plant genetic research, has made it possible to deeply elucidate the genetic mechanisms of chili pepper fruit orientation and develop related molecular markers.
[0003] Currently, molecular marker technology has made some progress in pepper genetic research. For example, SSR (simple sequence repeat) and AFLP (amplified fragment length polymorphism) markers have been used for constructing genetic maps, identifying germplasm resources, and locating some important traits in pepper. However, these marker technologies have certain limitations, such as the high development cost of SSR markers and the poor reproducibility of AFLP markers. KASP (Kompetitive Allele Specific PCR) molecular marker technology, as an emerging molecular marker technology, has advantages such as high throughput, low cost, high accuracy, and ease of automation, and has gradually gained attention in plant genetic research in recent years.
[0004] While some studies have explored the genetic patterns of fruit orientation in chili peppers using traditional genetic analysis methods, the systematic development and application of KASP molecular markers for fruit orientation are limited. Current development of molecular markers for chili pepper fruit orientation mainly focuses on other types of marker technologies, and these markers have certain shortcomings in practical applications. For example, some markers have low detection efficiency, making it difficult to meet the needs of large-scale germplasm resource screening and breeding improvement; others lack specificity, potentially leading to false positives or false negatives under different environmental conditions or genetic backgrounds, thus affecting their application value in improving chili pepper fruit orientation.
[0005] Therefore, developing KASP molecular markers targeting pepper fruit orientation has significant theoretical and practical value. This can not only provide more precise tools for in-depth analysis of the genetic basis of pepper fruit orientation and help identify key genes or gene regions controlling fruit orientation, but also provide efficient marker methods for molecular-assisted breeding of peppers, accelerating the breeding process of superior pepper varieties, improving the economic and social benefits of pepper cultivation, and playing a vital role in promoting the sustainable development of the pepper industry. Summary of the Invention
[0006] This invention aims to provide a KASP primer closely related to the orientation of pepper fruits. This primer was developed based on an SNP site located at position 39737613 on chromosome 12 of pepper (reference genome version: CNA0036143, download link: https: / / ftp.cngb.org / pub / CNSA / data3 / CNP0001129 / CNS0252417 / CNA0036143 / ).
[0007] Furthermore, this invention aims to provide the aforementioned KASP primers and their application in identifying pepper fruit orientation and in assisted breeding.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] This invention discloses for the first time the chili pepper ( Capsicum annuum A SNP locus at physical location 39737613 on chromosome 12 of the L. genome (CNA0036143 version) is found that is significantly associated with fruit orientation. This locus exhibits G / A polymorphism. Through genotype-phenotype association analysis in a large-scale population, this invention further established the correspondence between the alleles of this SNP locus and the fruit orientation phenotype: when the genotype at this locus is homozygous GG, the pepper fruit faces downwards; when the genotype is homozygous AA, the pepper fruit faces upwards.
[0010] Based on the sequence of this SNP site, this invention designs a set of KASP genotyping primers. This primer set includes: a specific forward primer for the G allele (SEQ ID NO. 5), a specific forward primer for the A allele (SEQ ID NO. 6), and a universal reverse primer (SEQ ID NO. 7). The 5' ends of the two forward primers are connected to different fluorescent reporter groups to facilitate detection and differentiation. The 5' end of the forward primer sequence shown in SEQ ID NO. 5 is modified with a FAM group, and the 5' end of the forward primer sequence shown in SEQ ID NO. 6 is modified with a HEX group.
[0011] The present invention also provides a kit for identifying the orientation of chili pepper fruits, the core component of which is the aforementioned KASP primer set.
[0012] This invention further provides the application of the KASP primer set or the kit in any of the following aspects:
[0013] (1) Identify or predict the fruit orientation of chili peppers during the seedling stage;
[0014] (2) Used for genetic evaluation and classification of fruit orientation traits in chili germplasm resource banks;
[0015] (3) In chili pepper hybridization breeding, early and high-throughput screening of fruit orientation traits is carried out on the offspring population.
[0016] Furthermore, the application includes the following steps:
[0017] PCR amplification is performed on the genomic DNA of the pepper to be tested. If the fluorescence signal color in the PCR amplification result is consistent with the fluorescence adapter color of the forward primer as shown in SEQ ID NO. 5, then the pepper to be tested is homozygous genotype GG, with the phenotype of fruit facing down. If the fluorescence signal color is consistent with the fluorescence adapter color of the forward primer as shown in SEQ ID NO. 6, then the pepper to be tested is homozygous genotype AA, with the phenotype of fruit facing up. If fluorescence signals consistent with the forward primers as shown in both SEQ ID NO. 5 and SEQ ID NO. 6 are detected simultaneously, then the pepper to be tested is heterozygous genotype GA.
[0018] The beneficial effects of this invention are as follows:
[0019] This invention provides a KASP molecular marker and primers developed based on a specific SNP locus (Chr12: 39737613) on chromosome 12 of pepper. Its core advantage lies in its ability to achieve high-throughput, accurate early-stage identification of pepper fruit orientation (upward or downward). This method overcomes the limitations of traditional reliance on phenotypic observation during the fruiting stage, significantly shortens the breeding cycle, improves the selection efficiency for target traits, and reduces field management costs. It provides an efficient and reliable technical tool for molecular-assisted breeding and germplasm resource evaluation of pepper. Attached Figure Description
[0020] Figure 1 This is a phenotypic diagram of the orientation of chili pepper fruits in an embodiment of the present invention, wherein, Figure 1 In the diagram, A represents the phenotypic pattern of fruit facing downwards. Figure 1 B in the diagram represents the phenotypic pattern of fruit facing upwards.
[0021] Figure 2 This is a typical fluorescence scatter plot of the SNP site KASP typing in Example 2 of the present invention. Detailed Implementation
[0022] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following embodiments.
[0023] This study targeted map-based cloning sites for pepper fruit orientation (up or down). Based on the SNP differences between the two parents, D1 (Pepper D60, fruit down) and U1 (Pepper CT4, fruit up), KSAP primers were designed within the mapping interval. It was found that the SNP at Chr12:39737613 in the pepper genome reference version: CNA0036143 could effectively genotype fruit orientation (up or down). The parental pepper fruit orientation is as follows... Figure 1 As shown.
[0024] Example 1: Discovery and Validation of SNP Molecular Markers
[0025] PCR amplification was performed on the Chr12:39737613 locus (reference genome version: CNA0036143) of six fruit-down (D10, D4, D12, D6, D7, D9) and 14 fruit-up (CT94, CT92, CT28, CW1, CB8, CF1, CF8, CT21, CF10, CT29, CT40, CT41, CT37, CT36) pepper inbred lines. The primer sequences used to amplify the region containing this SNP were SEQ ID NO.1: AAAGGAAGGGGAATTGAAAGGGT and SEQ ID NO.2: TTGTTCAACAATACATCCAACCTCA. The amplified fragment length was 401 bp. ApexHF HS DNA polymerase-CL reagent (catalog number AG12204) from Aikerui Biotechnology Co., Ltd. was used in a 50 μL reaction system, including 1 μL of... ApexHF HS DNA Ploymerase CL, 25 μL 2×Apex HF CL Buffer (Mg2+ and dNTP plus), 1 μL template DNA, 0.2 μmol specific amplification primers SEQ ID NO.1, 0.2 μmol specific amplification primers SEQ ID NO.2, and water were added to bring the volume to 50 μL. The amplification program was 94℃ pre-denaturation for 1 min, followed by 30 cycles: 98℃, 10 sec; 55℃, 15 sec; 68℃, 15 sec. The obtained PCR products were sent to a biotechnology company for first-generation sequencing. The sequencing results are shown in Table 1. In 6 samples with fruit facing down, the SNP site was G, and in 14 samples with fruit facing up, the SNP site was A. These results indicate that site A is highly associated with the fruit-facing phenotype, and site G is highly associated with the fruit-facing phenotype.
[0026] Table 1. Statistical results of SNP sites.
[0027] Example 2: Validation of SNP molecular markers based on Kompetitive Allele Specific PCR (KASP) technology.
[0028] The sequence of 200 bp upstream and 200 bp downstream of the 39737613th base position on chromosome 12 in the reference genome version CNA0036143 of pepper was extracted and arranged into the following format, where G and A are the two haplotypes of pepper fruit facing down and facing up, respectively.
[0029] The GG genotype sequence is shown in SEQ ID NO.3: AAAGGAAGGGGAATTGAAAGGGTAGCCCAAGTAAATAGAGGTGTCTTCCTTGTGAGATTCAGTTCACAAGAGGAGAAAGTGAGAGAAGTGGAAGAGGGTGTATTGTTATTTGATCGCAAGCCAATAGTGGTAAAAACTTGGAAAACAAATTGTGATGTCACAAAGGAGACAATTACTAGGGTTCCAGTGTGGGTTTCAGTT G CCAGGATTGAACATCAAATACTGGGGTAAAGCAGCATTGACTAAAATAGCTAGCCTAATTGGAAAGTCACTGCGAGCAGATAGAGCTATATCAAACAAGCAACGTATGACATATGCACGGTTCTAGTGGAGTTACCTATGGACAAAGTGTACCCAACGGGAGTGATGTTTGAGAATGAGGTTGGATGTATTGTTGAACAA;
[0030] The AA genotype sequence is shown in SEQ ID NO.4: AAAGGAAGGGGAATTGAAAGGGTAGCCCAAGTAAATAGAGGTGTCTTCCTTGTGAGATTCAGTTCACAAGAGGAGAAAGTGAGAGAAGTGGAAGAGGGTGTATTGTTATTTGATCGCAAGCCAATAGTGGTAAAAACTTGGAAAACAAATTGTGATGTCACAAAGGAGACAATTACTAGGGTTCCAGTGTGGGTTTCAGTTA CCAGGATTGAACATCAAATACTGGGGTAAAGCAGCATTGACTAAAATAGCTAGCCTAATTGGAAAGTCACTGCGAGCAGATAGAGCTATATCAAACAAGCAACGTATGACATATGCACGGTTCTAGTGGAGTTACCTATGGACAAAGTGTACCCAACGGGAGTGATGTTTGAGAATGAGGTTGGATGTATTGTTGAACAA.
[0031] Using the Primer3Plus online website (https: / / www.primer3plus.com / ), two forward primers and one reverse universal primer were designed. The 3' end of the forward primer is located at position 39737613 on chromosome 12, where the bases are G and A. The nucleotide sequences of the two forward primers are shown in SEQ ID NO.5 (F1, for the G allele, FAM fluorescent label): 5'-GAAGGTGACCAAGTTCATGCTTTCCAGTGTGGGTTCAGTTG-3' and SEQ ID NO.6 (F2, for the A allele, HEX fluorescent label): 5'-GAAGGTCGGAGTCAACGGATTTTCCAGTGTGGGTTCAGTTA-3', respectively. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.7 (R, 5'-TAGCTCTATCTGCTCGCAGT-3').
[0032] The plant materials used for KASP validation included: 10 U1 plants (derived from the fruit-facing homozygous plant CT4), 10 D1 plants (derived from the fruit-facing homozygous plant D60), 5 F1 plants (hybrid generation U1×D1 obtained by artificial hybridization with U1 as the female parent and D1 as the male parent), and 50 pepper plants exhibiting the fruit-facing trait selected from the F2 segregating population produced by self-pollination of F1 plants for competitive allele-specific polymerase chain reaction, totaling 75 samples.
[0033] The KASP genotyping kit (FLU-ARMS for KASP2× PCR Mix, catalog number GBS-1016-012) from Guangzhou Good Biotech Co., Ltd. was used to perform KASP genotyping to verify the SNPs in Example 1, following the instructions in the manufacturer's manual. The reaction system is shown in Table 2, the reaction process is shown in Table 3, and the KASP genotyping results are as follows: Figure 2As shown in the diagram. The genotyping results indicate that the 10 U1 plants with upward-facing fruits only produced HEX-specific fluorescence signals, clustered in the upper left corner of the genotyping diagram, i.e., distributed along the vertical axis, as shown below. Figure 2 The green dots; 10 D1 plants with fruit facing downwards and 50 F2 plants only produced FAM-specific fluorescence signals, clustered in the lower right corner of the typography, distributed along the horizontal axis, as shown. Figure 2 The blue dots indicate that all five F1 plants (U1×D1) simultaneously produced two fluorescence signals, such as... Figure 2 The red dot in the middle.
[0034] It should be noted that, Figure 2 The red dots do not represent the actual red fluorescence signals detected by the instrument. The detection instrument only collects signals from the FAM and HEX fluorescence channels. The genotyping software performs cluster analysis based on the FAM and HEX fluorescence intensities of each sample and automatically renders heterozygotes (samples that simultaneously detect FAM and HEX signals) as red to visually distinguish between homozygotes and heterozygotes. This color is generated by the software and is not the fluorescence color of the sample itself.
[0035] Table 2: Components of the Reaction System
[0036] Table 3: Reaction Process Table
[0037] The material with a G base at chromosome Chr12: 39737613 can bind to and extend the F1 primer (SEQ ID NO.5), and FAM fluorescence can be detected at wavelengths of 465-510 nm. Figure 2 The blue dot in the middle); the material with base A at chromosome Chr12: 39737613 can bind to and extend the F2 primer (SEQ ID NO.6), and HEX fluorescence can be detected at wavelengths of 533-580 nm. Figure 2 (Green dots). If only FAM fluorescence is detected, it indicates that the genotype of this material at Chr12: 39737613 is GG, with the pepper fruit facing down. If only HEX fluorescence is detected, it indicates that the genotype of this material at Chr12: 39737613 is AA, with the pepper fruit facing up. If both HEX and FAM fluorescence are detected, it indicates that the genotype of this material at Chr12: 39737613 is GA. Figure 2 (The red dot in the middle).
[0038] In summary, the molecular marker Chr12: 39737613 related to fruit orientation proposed in this application has high stability and high reliability. Compared with traditional methods, the application of this invention can improve the selection efficiency for fruit orientation traits by several times, shorten the breeding cycle by a full growing season, and significantly reduce the blindness and cost of field management.
[0039] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A KASP primer related to the orientation of pepper fruits, characterized in that, The KASP primers comprise two forward primers with nucleotide sequences as shown in SEQ ID NO. 5 and SEQ ID NO. 6, and one reverse primer with nucleotide sequences as shown in SEQ ID NO.
7. The KASP primers are used to identify the orientation of pepper fruits. The KASP primers are developed from an SNP site located at position 39737613 on chromosome 12 of the pepper genome version CNA0036143, with a base polymorphism of G or A. When the genotype at the site is GG, the pepper fruit faces downwards; when the genotype is AA, the pepper fruit faces upwards.
2. A kit for identifying the orientation of chili pepper fruits, characterized in that, It contains the KASP primers as described in claim 1.
3. The application of the KASP primer according to claim 1 in identifying the orientation of pepper fruits, characterized in that, The application includes the following steps: PCR amplification is performed on the genomic DNA of the pepper to be tested. If the fluorescence signal color in the PCR amplification result is consistent with the fluorescence adapter color of the forward primer as shown in SEQ ID NO.5, then the pepper to be tested is homozygous genotype GG, with the phenotype of fruit facing down. If the fluorescence signal color is consistent with the fluorescence adapter color of the forward primer as shown in SEQ ID NO.6, then the pepper to be tested is homozygous genotype AA, with the phenotype of fruit facing up. If fluorescence signals consistent with the forward primers as shown in SEQ ID NO.5 and SEQ ID NO.6 are detected simultaneously, then the pepper to be tested is heterozygous genotype GA.
Citation Information
Patent Citations
Improvements in or relating to apparatus for mechanically handling bricks or the like
GB1016012A
Application of SNP37458393 closely related to pepper fruit orientation and specific dCAPS primer
CN113652497A
Molecular marker related to Chinese pepper fruit orientation, primer combination, kit and application
CN119592740A
Apparatus and Method for Optimizing Trajectory of Relay UAV
KR1020240053194A