Antifungal nanoparticles, combination drugs and uses thereof

Abstract

This invention relates to the field of biomedical technology, specifically to an antifungal nanoparticle, a combination drug, and its application. The antifungal nanoparticle is prepared by covalently linking the aptamer AU1 to drug-loaded silk fibroin nanoparticles via amide bonds. The mass ratio of the drug-loaded silk fibroin nanoparticles to the aptamer AU1 is 20:0.5~2.0. The antifungal nanoparticles of this invention are prepared by a desolvation method using voriconazole-loaded silk fibroin nanoparticles, and the targeting aptamer AU1 is attached to their surface using a carbodiimide chemical cross-linking method. This allows for specific recognition of Candida albicans, increasing drug accumulation at the infection site. Further combination with methylene blue-mediated photodynamic therapy can disrupt biofilm structures, enhance nanoparticle penetration, achieve synergistic bactericidal activity, and reduce systemic toxicity, providing a novel, highly effective, and low-toxicity treatment strategy for fungal biofilm infections.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an antifungal nanoparticle, a combination drug, and its application. Background Technology

[0002] Candida albicans ( Candida albicans It is the most common opportunistic pathogenic fungus in clinical practice. It can colonize mucosal sites such as the human oral cavity, upper respiratory tract and vagina, and cause invasive infections in immunocompromised hosts. Its morbidity and mortality rates are rising year by year with the widespread use of broad-spectrum antimicrobial drugs, immunosuppressants and invasive diagnostic and treatment technologies, and have become an important challenge in the field of public health.

[0003] The refractory nature of Candida albicans infections is largely attributed to its ability to form biofilms. Biofilms are dense, three-dimensional networks composed of hyphal cells, yeast cells, and the extracellular matrix. They not only physically hinder the penetration of antifungal drugs but also lead to significant drug resistance by upregulating the expression of resistance genes, making traditional drug treatments ineffective in biofilm-associated infections. Therefore, overcoming the biofilm barrier and developing novel treatment strategies are key directions for addressing refractory Candida albicans infections.

[0004] Voriconazole, a broad-spectrum triazole antifungal drug, offers advantages over traditional drugs like fluconazole, including stronger antibacterial activity, a broader antibacterial spectrum, and effectiveness against some drug-resistant strains. However, its poor water solubility limits its clinical application. Current injectable formulations often require the addition of sulfobutyl β-cyclodextrin as a solubilizer, but this excipient poses potential safety risks such as nephrotoxicity. Furthermore, even potent drugs like voriconazole have limited ability to penetrate biofilms.

[0005] Therefore, there is an urgent need to provide a new treatment strategy for Candida albicans biofilm infections. Summary of the Invention

[0006] To address the above problems, this invention provides antifungal nanoparticles, a combination drug, and its application.

[0007] This invention is achieved through the following technical solution: An antifungal nanoparticle is obtained by covalently linking an aptamer AU1 with a drug-loaded silk fibroin nanoparticle via an amide bond; the mass ratio of the drug-loaded silk fibroin nanoparticle to the aptamer AU1 is 20:0.5~2.0.

[0008] The drug-loaded silk fibroin nanoparticles were prepared by a desolvation method, which involved mixing an aqueous solution of silk fibroin with an anhydrous ethanol solution containing voriconazole.

[0009] The volume ratio of the silk fibroin aqueous solution to the anhydrous ethanol solution containing voriconazole is 1:1~10.

[0010] The concentration of the silk fibroin aqueous solution is 8 mg / mL to 15 mg / mL; the concentration of the anhydrous ethanol solution containing voriconazole is 0.8 mg / mL to 1.5 mg / mL.

[0011] Preferably, the nucleotide sequence of the aptamer AU1 is as shown in SEQ ID NO.1, with an amino group modified at the 3' end by 0.5 mM.

[0012] Preferably, the procedure specifically includes the following steps: Drug-loaded silk fibroin nanoparticles were activated in an activation buffer by adding 1-ethyl-3-dimethylaminopropylcarbodiimide and N-hydroxysuccinimide to undergo a carboxyl activation reaction, followed by the addition of aptamer AU1 to obtain antifungal nanoparticles.

[0013] The mass ratio of the drug-loaded silk fibroin nanoparticles, 1-ethyl-3-dimethylaminopropylcarbodiimide, and N-hydroxysuccinimide is 20 mg: 20 mg to 60 mg: 20 mg to 60 mg; the mass ratio of the drug-loaded silk fibroin nanoparticles to aptamer AU1 is 20 mg: 0.5 mg to 2.0 mg.

[0014] Preferably, the activation buffer is a MES buffer with a pH of 5-6.

[0015] The application of the antifungal nanoparticles in the preparation of drugs for treating fungal biofilm infections.

[0016] Preferably, the fungus includes Candida albicans ( Candida albicans ).

[0017] A combination drug for fungal biofilm infection, wherein the combination drug is composed of the aforementioned antifungal nanoparticles and a photosensitizer.

[0018] Preferably, the photosensitizer is methylene blue.

[0019] Preferably, the dosage of the antifungal nanoparticles is 6 mg / kg; the concentration of the methylene blue is 10 µg / mL, and the volume of each administration is 50 µL.

[0020] Compared with the prior art, the present invention has the following beneficial effects: Compared with existing technologies, this invention provides an antifungal nanoparticle, which is obtained by covalently linking the aptamer AU1 to drug-loaded silk fibroin nanoparticles via amide bonds; the mass ratio of the drug-loaded silk fibroin nanoparticles to the aptamer AU1 is 20:0.5~2.0. Firstly, at the dosage level, the hydrophobic drug voriconazole is encapsulated using the biocompatible silk fibroin nanocarrier, significantly improving the drug's solubility and delivery characteristics without relying on toxic solubilizing excipients, and endowing it with pH-responsive sustained-release behavior. This allows for faster drug release in the acidic environment simulating the infection site, facilitating long-term therapeutic effects at the lesion. Secondly, regarding targeting and permeability, the surface coupling of the AU1 aptamer, which specifically recognizes Candida albicans, endows the nanosystem with active targeting capabilities, enabling efficient accumulation in fungal cells and biofilms. Furthermore, combined with photodynamic therapy, the generated reactive oxygen species disrupt the dense biofilm structure, significantly enhancing the nanodrug's penetration ability through the biofilm barrier, solving the problem of drugs failing to reach the core of infection. In terms of therapeutic efficacy and safety, this targeted nanosystem exhibited a significant synergistic antibacterial effect with photodynamic therapy, substantially reducing the minimum inhibitory concentration (MIC) in in vitro experiments and demonstrating near-complete clearance of mature biofilms. In vitro and in vivo safety evaluations consistently showed that this nanosystem effectively reduced the inherent hepatotoxicity and nephrotoxicity of free voriconazole, achieving potent bactericidal effects while exhibiting good biocompatibility. In summary, this invention, through the synergistic effect of multiple mechanisms—active targeted delivery, physical membrane disruption, and chemical sterilization—constructs a novel, highly efficient, and low-toxicity strategy for combating fungal biofilm infections, providing a potentially transformative new approach for clinically addressing refractory fungal infections. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Characterization diagrams of the various groups of nanomaterials in this invention; Figure 1 In the diagram, A shows the SEM and TEM images of each group of SFNPs, VCZ@SFNPs, and VCZ@SFNPs-AU1; B shows the average particle size distribution and PDI dispersion of the SFNPs group; C shows the average particle size distribution and PDI dispersion of the VCZ@SFNPs group; D shows the average particle size distribution and PDI dispersion of the VCZ@SFNPs-AU1 group; and G shows the Zeta potential diagrams of each group of SFNPs, VCZ@SFNPs, and VCZ@SFNPs-AU1.

[0023] Figure 2 This is a graph showing the release and stability of the VCZ@SFNPs-AU1 nanoparticles of this invention; Figure 2 In the figure, A shows the release of VCZ@SFNPs-AU1 under three in vitro simulated Candida albicans infection environments at different pH levels; B shows the particle size changes of VCZ@SFNPs and VCZ@SFNPs-AU1 in PBS buffer at pH 7.4 over 7 days.

[0024] Figure 3 This image shows the effect of photodynamic therapy combined with VCZ@SFNPs-AU1 on the in vitro inhibition of planktonic Candida albicans according to the present invention. Figure 3 In the diagram, A shows the inhibition zone images of different groups of nanomaterials; B shows the area of ​​the inhibition zones of different groups of nanomaterials; C shows the growth inhibition curves of different groups of nanomaterials at a concentration of 2 µg / mL; D shows the H&E staining and SEM morphology observation images of different groups of nanomaterials; * indicates... p <0.05, ** indicates p <0.01, *** indicates p <0.001, ns indicates no significant difference compared to the control group.

[0025] Figure 4 The image shows the inhibitory effect of photodynamic therapy combined with VCZ@SFNPs-AU1 on Candida albicans biofilm in vitro. Figure 4 In the diagram, A shows the crystal violet staining of the Control group on the inhibition of Candida albicans biofilm in vitro; B shows the crystal violet staining of the VCZ group on the inhibition of Candida albicans biofilm in vitro; C shows the crystal violet staining of the VCZ@SFNPs group on the inhibition of Candida albicans biofilm in vitro; D shows the crystal violet staining of the VCZ@SFNPs-AU1 group on the inhibition of Candida albicans biofilm in vitro; E shows the crystal violet staining of the VCZ@SFNPs-AU1+PDT group on the inhibition of Candida albicans biofilm in vitro; and F shows the quantitative evaluation of the inhibitory effect of different groups of nanomaterials on Candida albicans biofilm in vitro using the XTT reduction method.

[0026] Figure 5 This is an image of an in vitro Candida albicans biofilm observed using LSCM according to the present invention. Figure 5In the diagram, A represents the morphological structure of the Candida albicans biofilm inhibited in vitro by the VCZ group; B represents the morphological structure of the Candida albicans biofilm inhibited in vitro by the VCZ@SFNPs group; C represents the morphological structure of the Candida albicans biofilm inhibited in vitro by the VCZ@SFNPs-AU1 group; D represents the morphological structure of the Candida albicans biofilm inhibited in vitro by the VCZ@SFNPs-AU1+PDT group; E represents the targeting effect of Dil@SFNPs on mature Candida albicans biofilm observed by LSCM; and F represents the targeting effect of Dil@SFNPs-AU1+PDT on mature Candida albicans biofilm observed by LSCM.

[0027] Figure 6 The diagram shows the biocompatibility test results of different groups of nanoparticles in this invention. Figure 6 In the diagram, A is a hemolysis experiment diagram; B is a hemolysis experiment diagram; and C is a cytotoxicity experiment diagram.

[0028] Figure 7 The images show the in vivo therapeutic effects of the various drug treatments of this invention. Figure 7 In the diagram, A is the flowchart of the mouse experiment; B is a diagram of cysts at the infection site in mice during treatment; C is a diagram of the changes in the size of cysts at the infection site in each group after treatment; D is a diagram of H&E staining of cysts at the infection site in mice after treatment and a diagram of fungal load (CFU) at the infection site; E is a diagram of CFU quantification at the infection site in mice after treatment; F is a diagram of serum inflammatory factor IL-10 in each treatment group after treatment; G is a diagram of serum inflammatory factor IL-1β in each treatment group after treatment; H is a diagram of collagen production rate at the infection site in each treatment group after treatment; * indicates p <0.05, ** indicates p <0.01, *** indicates p <0.001, ns, no significant difference compared with the control group.

[0029] Figure 8 This is a diagram illustrating the in vivo biocompatibility analysis of the nanoparticles of this invention. Figure 8 In the figures, A shows H&E stained sections of mouse heart, liver, spleen, lungs, and kidneys treated with different groups of nanomaterials; B shows the results of AST detection in mouse blood biochemical index; C shows the results of ALT detection in mouse blood biochemical index; D shows the results of CREA detection in mouse blood biochemical index; and E shows the results of BUN detection in mouse blood biochemical index.

[0030] Figure 9 This is a diagram illustrating the in vivo targeting effect of VCZ@SFNPs-AU1 according to the present invention; Figure 9In the diagram, A is the experimental flowchart; B is the fluorescence distribution map in mice 24 hours after injection of VCZ@SFNPs-AU1; C is the fluorescence distribution map of major organs and infection sites in mice 24 hours after injection of VCZ@SFNPs-AU1; D is the quantitative statistical graph of the average fluorescence intensity of major organs and infection sites in mice; * indicates... p <0.05, ** indicates p <0.01, *** indicates p <0.001, ns, no significant difference compared with the control group. Detailed Implementation

[0031] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0032] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0033] The materials and reagents used in this invention are as follows: Silkworm cocoons (Xi'an Ruixi Biotechnology Co., Ltd.); voriconazole (VCZ) (Ron Technology); methylene blue (MB), anhydrous ethanol, crystal violet (CV), 2-N-morpholinoethanesulfonic acid (MES), 1-3-dimethylaminopropyl-3-ethylcarbodiimide hydrochloride (EDC), and N-hydroxysuccinimide (NHS) were all purchased from Sinopharm Chemical Co., Ltd.; sterile defibrinated sheep blood (Henan Yuechi Biotechnology Co., Ltd.); DiI cell membrane red fluorescent probe, AO / EB dual fluorescent staining kit, and Cy5-SE were all purchased from Shanghai Yuanye Biotechnology Co., Ltd.; calcium fluorescent white (CFW) (Shanghai Maclean Biochemical Technology Co., Ltd.); CCK-8 cytotoxicity kit, ROS reactive oxygen species detection kit, and paraformaldehyde were all purchased from Biosharp.

[0034] The aptamer AU1 sequence is derived from the study by Tang et al. (Improved detection of deeply invasive candidiasis with DNA aptamers specific binding to (1→3)-β-D-glucans from Candida albicans) and was synthesized by Shanghai Sangon Biotech Co., Ltd. AU1: Kd = 103.7 nM, nucleotide sequence as shown in SEQ ID NO.1, is 5'-GCGGAATTCGAACAGTCCGAGCCACATAGACAGCCTATCCTCGATTACTTGTTGTTATGGTCCTATTCTCTCCATTCCGCTGTGGGTAAATGCGTCATAGGATCCCGC-3', 3' modified amino group.

[0035] This invention C. albicans The strains and biofilm formation methods are as follows: The Candida albicans used in the experiment ( Candida albicans ATCC strain 10231 was purchased from the China General Culture Collection Center for Microbial Cultures. After revival, the strain was streaked on Sabouraud dextrose agar (SDA) plates for isolation. A single colony was picked and inoculated into 100 mL of Sabouraud dextrose medium. The culture was then shaken at 37 °C and 200 rpm for 24 hours to prepare a bacterial suspension in the logarithmic growth phase, which was stored at 4 °C for later use.

[0036] Biofilm formation was modeled using an in vitro static model. The bacterial suspension was inoculated at an appropriate concentration into 6-well plates of RPMI 1640 medium containing 10% fetal bovine serum (FBS) and incubated at 37°C for 48 hours to promote biofilm formation and maturation. Biofilm formation was qualitatively observed using crystal violet staining and quantitatively evaluated using the XTT reduction method.

[0037] Silk fibroin (SF) was extracted and purified according to the method of Rockwood DN et al., using silkworm cocoons as raw material, and a high molecular weight water-soluble silk fibroin solution was obtained through mild degumming and calcium alcohol degradation. The molecular weight of silk fibroin ranged from 350 kDa to 450 kDa.

[0038] The reference for the extraction and purification of silk fibroin (SF) is: Rockwood DN, Preda RC, Yücel T, et al. Materials Fabrication from Bombyx mori Silk Fibroin[J]. Nature Protocols, 2011, 6(10): 10.1038 / nprot.2011.379. 1612-1631.DOI:10.1038 / nprot.2011.379. The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0039] Example 1: A method for preparing antifungal nanoparticles VCZ@SFNPs-AU1 Drug-loaded silk fibroin nanoparticles were prepared via a solvent removal method: an aqueous solution of silk fibroin (10 mg / mL) was slowly added dropwise to an anhydrous ethanol solution containing voriconazole (VCZ, 1 mg / mL), and the mixture was stirred continuously at room temperature for 2 h. This allowed the drug to be encapsulated in the silk fibroin matrix through hydrophobic interactions and hydrogen bonds. The volume ratio of the aqueous silk fibroin solution to the anhydrous ethanol solution containing voriconazole was 1:5. After the reaction was complete, the precipitate was collected by centrifugation at 12000 rpm for 20 min, washed three times with deionized water to remove unencapsulated drug and residual organic solvent, and then lyophilized to obtain drug-loaded silk fibroin nanoparticles, namely VCZ@SFNPs.

[0040] The coupling of aptamer AU1 was performed using a carbodiimide chemical cross-linking method: 20 mg of VCZ@SFNPs was resuspended in 2 mL of MES buffer (pH 5.5), and 40 mg of EDC was added for pre-incubation for 10 min to activate the carboxyl groups on the surface of silk fibroin. Then, 40 mg of NHS was added, and the mixture was gently stirred at room temperature for 2 h to form an activated ester intermediate. Subsequently, 0.5 mM of amino-modified aptamer AU1 (1 mg dissolved in 60 µL pH 8.0 MES buffer) was added to this activated ester intermediate, and the mixture was reacted at 4 °C for 12 h to covalently link the aptamer to the nanoparticles via amide bonds. After the reaction, the nanoparticles were centrifuged at 8000 rpm for 5 min, and washed three times with double-distilled water to remove unreacted coupling agent and free aptamer. Finally, the nanoparticles, VCZ@SFNPs-AU1, were lyophilized and stored at 4 °C for later use.

[0041] Example 2: A method for preparing antifungal nanoparticles VCZ@SFNPs-AU1 In this embodiment, the volume ratio of the silk fibroin aqueous solution to the anhydrous ethanol solution containing voriconazole is 1:1. The concentration of the silk fibroin aqueous solution was 8 mg / mL; the concentration of the anhydrous ethanol solution containing voriconazole was 0.8 mg / mL. The mass ratio of drug-loaded silk fibroin nanoparticles, 1-ethyl-3-dimethylaminopropylcarbodiimide, and N-hydroxysuccinimide was 20 mg:20 mg:20 mg; the mass ratio of drug-loaded silk fibroin nanoparticles to aptamer AU1 was 20 mg:0.5 mg. MES buffer was used, with a pH of 5. The remaining steps were exactly the same as in Example 1 to prepare the antifungal nanoparticles.

[0042] Example 3: A method for preparing antifungal nanoparticles VCZ@SFNPs-AU1.

[0043] In this embodiment, the volume ratio of the silk fibroin aqueous solution to the anhydrous ethanol solution containing voriconazole was 1:10; the concentration of the silk fibroin aqueous solution was 15 mg / mL; and the concentration of the anhydrous ethanol solution containing voriconazole was 1.5 mg / mL. The mass ratio of the drug-loaded silk fibroin nanoparticles, 1-ethyl-3-dimethylaminopropylcarbodiimide, and N-hydroxysuccinimide was 20 mg:60 mg:60 mg; the mass ratio of the drug-loaded silk fibroin nanoparticles to the aptamer AU1 was 20 mg:2.0 mg. MES buffer was used, with a pH of 6. The remaining steps were exactly the same as in Example 1, resulting in the preparation of antifungal nanoparticles.

[0044] Comparative Example 1 DiI-loaded silk fibroin nanoparticles (DiI@SFNPs) and aptamer AU1-modified DiI-loaded silk fibroin nanoparticles (DiI@SFNPs-AU1) were prepared using the same method as in Example 1 for subsequent experiments.

[0045] Example 4: A combination drug.

[0046] The combined drug regimen consisted of antifungal nanoparticles VCZ@SFNPs-AU1 and the photosensitizer methylene blue. The administration method was as follows: VCZ@SFNPs-AU1 (6 mg / kg) was administered intravenously, followed by a 1-hour incubation period to allow the nanoparticles to accumulate at the infection site. Then, 50 µL of a 10 µg / mL MB solution was injected into the infection site. Both VCZ@SFNPs-AU1 and MB were dissolved in PBS. The mixture was incubated at 37°C in the dark for 20 minutes to allow MB to penetrate and enter the biofilm. Subsequently, a 660 nm semiconductor laser at a power density of 50 mW / cm² was used at the infection site. 2 The light was applied for 20 minutes. The irradiation process was carried out at 37°C.

[0047] 660nm semiconductor laser (purchased from Taobao, D650N100-T1685).

[0048] Experimental Example 1: Basic Properties and Characterization of VCZ@SFNPs-AU1 The following experiments were conducted using VCZ@SFNPs-AU1 prepared in Example 1.

[0049] 1. Successful construction and basic properties of VCZ@SFNPs-AU1 Key physicochemical property measurements showed that the particle size of blank SFNPs was 134.12±4.54 nm, the polydispersity index (PDI) was 0.102, and the zeta potential was -17.6±1.5 mV; while after loading voriconazole (VCZ), the particle size of VCZ@SFNPs increased to 156±3.79 nm, the PDI slightly increased to 0.159, and the zeta potential changed to -33.2±2.5 mV. Figure 1 (As shown in B~D and G in the diagram). The increase in particle size and the slight rise in PDI indicate that VCZ was successfully loaded into the SFNPs support. The mechanism may originate from non-covalent interactions between the drug and the support material, such as hydrogen bonding, hydrophobic interactions, or π–π stacking. These forces lead to adjustments in molecular conformation and a moderate expansion of the particle structure. After VCZ@SFNPs were linked to the aptamer AU1, the particle size increased to 157±1.23 nm, the PDI increased to 0.163, and the Zeta potential became -33.2±2.5 mV. Notably, the PDI remained below 0.2, indicating that the nanoparticles maintained a highly uniform dispersion in solution, meeting the requirements for colloidal stability. The Zeta potential decreased significantly from -17.6 mV to -33.2 mV. This negative increase indicates that the introduction of VCZ altered the charge characteristics of the particle surface, which may be related to the charge of the drug molecule itself and the changes in the protonation state of surface groups caused by its interaction with the support material. Furthermore, based on the standard curve calculation, the encapsulation efficiency (EE) and loading capacity (LE) of VCZ@SFNPs-AU1 were 83.92±1.25% and 9.74±0.09%, respectively. The high drug loading efficiency further verified the effectiveness of the synthesis strategy and laid the foundation for subsequent functional applications.

[0050] 2. Characterization of VCZ@SFNPs-AU1 2.1 Analysis of Electron Microscopy Results The microstructure of VCZ@SFNPs-AU1 nanoparticles was systematically evaluated using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to verify their structural integrity and drug encapsulation effectiveness. Figure 1As shown in Figure A, the blank silk fibroin nanoparticles (SFNPs) without voriconazole (VCZ) loading exhibit a regular spherical structure with a uniform particle size distribution of approximately 120 nm. The smooth surface and clear edges indicate that the preparation process has good controllability and repeatability. This spherical morphology is a typical characteristic of the silk fibroin self-assembly process and contributes to the stable dispersion of nanoparticles in solution.

[0051] Compared to blank SFNPs, the nanoparticles coated with VCZ (VCZ@SFNPs) exhibited significant morphological changes. For example... Figure 1 As shown in Figures B-D, the particle size of VCZ@SFNPs increased to approximately 150 nm, and the shape changed from a regular sphere to an irregular quasi-sphere, with slight surface roughening. This change indicates that VCZ was successfully embedded in the silk fibroin matrix, possibly binding to the carrier through non-covalent forces such as hydrogen bonds and hydrophobic interactions, leading to nanoparticle expansion and morphology reconstruction. Notably, after connecting the targeting aptamer AU1 (VCZ@SFNPs-AU1), its microstructure was basically consistent with VCZ@SFNPs, with the particle size remaining around 150 nm and the shape still irregular. This shows that the aptamer modification did not destroy the core framework of the nanoparticles, achieving targeting function only through surface chemical cross-linking, confirming the mildness and effectiveness of the carbodiimide method of connection.

[0052] 2.2 XRD Result Analysis XRD analysis results showed that VCZ@SFNPs-AU1 nanoparticles were successfully prepared, and neither the loading of voriconazole (VCZ) nor the modification with aptamer AU1 disrupted the crystal structure of the silk fibroin carrier SFNPs. XRD patterns ( Figure 1 As shown in Figure E, blank SFNPs exhibit distinct diffraction peaks at 2θ of 8.12°, 16.85°, 20.34°, 24.71°, and 28.65°, which corresponds to the typical crystalline structure of silk fibroin. After loading VCZ, the diffraction peak positions of VCZ@SFNPs are basically consistent with those of SFNPs, but the peak intensity is slightly weakened, and a slight broadening occurs near 25.50°, indicating that VCZ molecules are dispersed amorphously in the SFNP matrix and do not form an independent crystalline phase, consistent with literature descriptions. After aptamer AU1 is connected, the XRD pattern of VCZ@SFNPs-AU1 does not show new diffraction peaks, and the characteristic peak positions do not shift significantly, indicating that AU1, introduced through surface modification, does not cause reconstruction of the carrier crystal structure.

[0053] 2.3 FT-IR Result Analysis FT-IR analysis results ( Figure 1Figure F in the figure reveals the intermolecular interactions and chemical structural changes of the components in VCZ@SFNPs-AU1 nanoparticles. The VCZ active pharmaceutical ingredient was obtained at 1500 cm⁻¹. -1 and 1106cm -1 Characteristic absorption peaks appeared at 1628 cm⁻¹, attributed to the stretching vibration of the CF bond and the skeletal vibration of the fluorinated aromatic ring, respectively, consistent with its molecular structure characteristics. Blank silk fibroin nanoparticles (SFNPs) showed an absorption peak at 1628 cm⁻¹. -1 The peak at the α-side shows a typical amide I band absorption peak, corresponding to the β-sheet conformation, indicating that silk fibroin undergoes a conformational transition from random coil to ordered structure during nanoparticle formation.

[0054] In the spectrum of VCZ@SFNPs, the characteristic peak of VCZ (1500 cm⁻¹) is... -1 and 1106cm -1 It is still visible but has widened significantly, and at 1600cm -1 A new absorption peak appears at 1260 cm⁻¹, which may originate from the π-π stacking or hydrogen bonding interaction between the aromatic ring of VCZ and the silk fibroin backbone. Notably, the spectrum of VCZ@SFNPs-AU1 shows a peak at 1260 cm⁻¹. -1 and 1100cm -1 Two new absorption peaks appeared, which were caused by the asymmetric and symmetric stretching vibrations of the P=O bond in the phosphodiester bond, respectively, confirming that the aptamer AU1 was successfully modified onto the nanoparticle surface via covalent linkage. Furthermore, the amide I band peak of SFNPs was observed at 1628 cm⁻¹. -1 The results showed that the drug loading and aptamer linkage remained stable in VCZ@SFNPs and VCZ@SFNPs-AU1 without significant shifts, indicating that the core secondary structure of the silk fibroin carrier was not disrupted.

[0055] 3. In vitro release and stability studies Results of in vitro release study ( Figure 2 As shown in Figure A), VCZ@SFNPs-AU1 nanoparticles exhibited typical sustained-release characteristics under three different pH conditions: the release rate was fastest in the first 4 hours, reaching 51.7%, 40.5%, and 39%, respectively; subsequently, the release gradually slowed down, with cumulative release rates of 70.1%, 54.1%, and 53.4% ​​after 12 hours, and final release rates of 77.8%, 67%, and 64.8% after 24 hours. This release behavior indicates that the nanosystem is pH-responsive, with accelerated release in acidic environments (e.g., pH 5.5), possibly due to protonation or structural reorganization of the silk fibroin carrier under acidic conditions, leading to an expansion of the drug diffusion channel, consistent with the pH-sensitive nanocarrier mechanism reported in the literature. Stability was assessed using dynamic light scattering (DLS) monitoring. Figure 2As shown in Figure B), the hydrodynamic size of VCZ@SFNPs-AU1 remained stable and showed no aggregation within one week in PBS solution, confirming its excellent colloidal stability. This is attributed to the rigid structure of silk fibroin and the electrostatic repulsion provided by the zeta potential (-26.3 mV) on the nanoparticle surface. In summary, the sustained-release properties and stability of this nanosystem not only ensure the continuous release of the drug at the site of infection but also reduce the toxic side effects of systemic exposure, providing an ideal delivery platform for the clinical treatment of fungal biofilm infections.

[0056] Experimental Example 2: In vitro antibacterial activity of photodynamic therapy combined with VCZ@SFNPs-AU1 The following experiments were performed using VCZ@SFNPs-AU1 prepared in Example 1. In this example, methylene blue (MB) was added to all photodynamic treatment (PDT) groups; the PDT was performed using a 660nm semiconductor laser at a power density of 50mW / cm². 2 The light was applied for 20 minutes. The irradiation process was carried out at 37°C.

[0057] I. Experimental Methods 1. Determination of minimum inhibitory concentration (MIC) and analysis of antibacterial activity A bacterial suspension of Candida albicans in the logarithmic growth phase was prepared according to the method described in this invention. The bacterial suspension was then diluted to 1×10⁻⁶ with Sabouraud dextrose liquid medium. 5 CFU / mL. 100 µL of diluted bacterial suspension was added to each well of a 96-well plate. Then, 100 µL of VCZ, VCZ@SFNPs, or VCZ@SFNPs-AU1 solution (initial drug concentration of 2048 µg / mL, PBS phosphate buffered saline) was added to the first well of each experimental group. A negative control group containing only culture medium and sterile suspension was used, and a positive control group containing only culture medium and bacterial suspension was used. The VCZ@SFNPs-AU1+PDT group received additional treatment with MB at a final concentration of 10 µg / mL in addition to the drug solution. The concentrations were diluted using a 2-fold serial dilution method. OD was measured after 12 h of incubation at 37℃. 600 Calculate the MIC value based on the absorbance at that point.

[0058] The antibacterial activity of the material was determined by the filter paper diffusion method. Briefly, 100 µL of 1×10⁻⁶ filter paper was used. 5 A CFU / mL Candida albicans suspension was spread onto Sabouraud dextrose agar plates. After attaching sterile filter paper, 20 µL of a solution containing the test sample (concentration equivalent to 64 µg / mL voriconazole (4MIC)) was added. PBS was used as a negative control. After incubation at 37°C for 24 hours, the diameter of the inhibition zone was measured.

[0059] 2. Determination of growth inhibition curve A Candida albicans suspension in the logarithmic growth phase was prepared according to the method described in this invention, and the concentration of the Candida albicans suspension in the logarithmic growth phase was adjusted to 1×10⁻⁶. 5 CFU / mL was inoculated into 96-well plates, with 100 µL of bacterial suspension added to each well. Experimental groups were prepared by adding 100 µL of drug-containing medium. Two treatment groups were established: a VCZ@SFNPs-AU1 drug concentration of 2 µg / mL (MIC of the VCZ@SFNPs-AU1+PDT group, see Table 1); and a VCZ@SFNPs-AU1+PDT treatment group (VCZ@SFNPs-AU1 drug concentration of 1 µg / mL, with the addition of MB to a final concentration of 0.01% (w / v)). The following controls were established: medium without bacterial suspension as a blank control; and bacterial suspension without drug as a growth control. The 96-well plates were placed in a constant temperature shaking incubator and cultured continuously at 37℃ and 150 rpm. From inoculation, the absorbance (OD) at 600 nm was measured every 3 hours using a microplate reader. 600 The mixture was shaken for 30 seconds before each measurement. All OD values ​​were subtracted from the blank control. Each treatment had three replicates. OD values ​​were plotted with incubation time on the x-axis. 600 The values ​​are plotted on the ordinate to create growth curves for each treatment group.

[0060] 3. SYTO 9 / PI fluorescent staining The effects of each treatment group on the cell membrane integrity of *Candida albicans* were assessed using the SYTO 9 / PI staining kit. The simplified procedure is as follows: A bacterial suspension of *Candida albicans* in the logarithmic growth phase was prepared according to the method described in this invention. 3 mL of *Candida albicans* cells in the logarithmic growth phase were collected, centrifuged at 3500 rpm for 10 min, and washed three times with PBS buffer to remove the culture medium. The bacterial cells were resuspended in 200 µL of PBS solution containing different treatment groups. The drug concentration for each treatment group was the equivalent VCZ concentration of 16 µg / mL (i.e., free VCZ MIC). The treatment groups included: PBS (negative control), free VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT. The same volume was added to each group, except for the VCZ@SFNPs-AU1+PDT group, which was added with MB to a final concentration of 0.01% (w / v). All samples were incubated at 37°C in the dark for 2 h. After incubation, cells were collected by centrifugation, and a mixed staining solution containing SYTO 9 and propidium iodide was added. Staining was performed in the dark for 10 minutes. After staining, 10 µL of cell suspension was added to a glass slide, and images were immediately observed and acquired using a fluorescence microscope (Nexcope NIB600). Live bacteria (intact cell membranes) exhibited green fluorescence (SYTO 9), while dead bacteria (damaged cell membranes) exhibited red fluorescence (PI).

[0061] 4. Effects of nanomaterial treatment on fungal cell morphology A suspension of Candida albicans in the logarithmic growth phase was prepared according to the method described in this invention. Candida albicans cells in the logarithmic growth phase were collected, centrifuged, and resuspended in PBS to obtain a suspension with an effective viable count of 1 × 10⁻⁶ cells / mL. 5 CFU / mL. The experimental groups were treated with VCZ solutions of equivalent concentrations of 16 µg / mL, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT, respectively. The VCZ@SFNPs-AU1+PDT group was treated with MB at a final concentration of 0.01% (w / v), with a total drug volume of 2 mL for each group. All samples were incubated at 37℃ and 150 rpm for 3 h with constant temperature shaking. After incubation, the bacterial cells were collected by centrifugation at 4℃ and 4000 rpm for 10 min, and gently washed twice with pre-cooled PBS buffer. Subsequently, the cells were fixed with 2.5% glutaraldehyde solution at 4℃ for 12 h. The fixed samples were washed with PBS, and then subjected to a gradient dehydration with 30%, 50%, 70%, 90%, and 100% ethanol for 15 min each time, and finally replaced twice with 100% acetone. The treated bacterial culture was then dropped onto a clean silicon wafer and dried at room temperature. The ultrastructure morphology was observed under a scanning electron microscope. Cells treated with PBS were used as a blank control.

[0062] 5. Qualitative and quantitative analysis of biofilm growth inhibition Crystal violet staining was used to qualitatively observe and quantitatively evaluate the inhibitory effects of different nano-preparations on Candida albicans biofilm formation. The simplified procedure is as follows: 1 mL of Sabouraud dextrose agar was added to a 6-well plate, and 1% (v / v) of Candida albicans in the logarithmic growth phase (1×10⁻⁶) was inoculated. 6 CFU / mL). Free VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT were added at an equivalent voriconazole concentration of 16 µg / mL, respectively. The VCZ@SFNPs-AU1+PDT group was supplemented with MB at a final concentration of 0.01% (w / v). The untreated group served as a negative control. All tubes were incubated in a constant temperature shaking incubator (150 rpm, 37 °C) for 48 h to promote biofilm formation.

[0063] After culturing, gently discard the culture supernatant and wash three times with PBS buffer to remove airborne bacteria. Add 1 mL of 0.1% (w / v) crystal violet solution and stain at room temperature for 20 minutes. Discard the staining solution and wash repeatedly with ultrapure water until the eluent is colorless. Take pictures under a microscope to record the staining of biofilms in each group.

[0064] The crystal violet-stained biofilm was desorbed by adding 1 mL of 95% ethanol for 30 minutes, followed by thorough shaking to dissolve the dye. 200 µL of the ethanol eluate was transferred to a 96-well plate, and the absorbance was measured at 590 nm using a microplate reader. The relative biomass of the biofilm is expressed as the measured OD value. 590 Values ​​are represented. Each experiment has 3 replicates, and is independently repeated 3 times.

[0065] 6. Observation of the morphology and structure of Candida albicans biofilm in vitro using photodynamic therapy combined with VCZ@SFNPs-AU1 To evaluate the effects of different treatments on cell viability within mature biofilms, live / dead bacterial staining (Calcein-AM / PI) combined with laser scanning confocal microscopy (CLSM) was used for observation. 1 mL of free VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT were added to each well of a six-well plate containing 16 µg / mL of voriconazole, respectively. The VCZ@SFNPs-AU1+PDT group was supplemented with MB at a final concentration of 0.01% (w / v). The plates were incubated at 37°C for 48 hours. After treatment, the culture supernatant was gently aspirated, and the biofilms were carefully washed twice with PBS. Subsequently, 50 µL of Calcein-AM / PI mixed staining working solution (0.5 µL of Component A (Calcein-AM) and 2 µL of Component B (PI) dissolved in 1 mL of PBS) was added to each well, and the plates were incubated at 37°C in the dark for 20 minutes. After incubation, rinse twice gently with PBS to remove excess dye. Immediately observe the biofilm using CLSM. Viable bacteria produce green fluorescence due to the hydrolysis of Calcein-AM by esterase activity, while dead bacteria produce red fluorescence due to PI labeling caused by loss of cell membrane integrity.

[0066] 7. Targeted study of photodynamic therapy combined with VCZ@SFNPs-AU1 on Candida albicans biofilm Equal amounts of DiI@SFNPs, DiI@SFNPs-AU1+PDT, and VCZ@SFNPs-AU1+PDT were added to mature Candida albicans biofilms. MB was added to the VCZ@SFNPs-AU1+PDT group at a final concentration of 0.01% (w / v); the concentration for all groups was 16 µg / mL. After 24 h of cultivation, unadhered nanoparticles on the biofilm surface were gently rinsed away. Subsequently, the Candida albicans biofilms were labeled with CFW, and the targeting of nanoparticles within the biofilm was observed using LSCM.

[0067] 8. Biocompatibility Testing 8.1 In vitro hemolytic activity of the material Take 5 mL of sterile defibrinated sheep blood, wash and centrifuge repeatedly with PBS until the supernatant no longer appears red. Take 200 µL of lower layer red blood cells, dilute with PBS to 10 mL, and prepare a 2% (v:v) red blood cell solution.

[0068] VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT solutions were prepared with 2% (v / v) erythrocyte solution at concentrations of 1 / 2 MIC, MIC, 2 MIC, and 4 MIC, respectively. MB was added to the VCZ@SFNPs-AU1+PDT group to a final concentration of 0.01% (w / v). After incubation at 37°C for 3 h, the solutions were centrifuged at 1000 rpm for 10 min. The supernatant was used to measure OD. 570 The absorbance value is recorded as OD. The group with distilled water is used as a positive control and is recorded as OD positive, while the group with PBS is used as a negative control and is recorded as OD negative. A hemolytic reaction occurs when the hemolysis rate exceeds 5%.

[0069] 8.2 Effects of materials on cell viability The effects of VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT on L929 cell viability were analyzed using a CCK-8 assay kit. A concentration of 5 × 10⁻⁶ was used. 4 90 µL of L929 cell suspension (CFU / mL) was seeded into 96-well plates. Then, 10 µL of VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT were added to each well, bringing the final concentrations to 1 / 2 MIC, MIC, 2 MIC, and 4 MIC, respectively. The VCZ@SFNPs-AU1+PDT group received MB at a final concentration of 0.01% (w / v). After incubation in a CO2 incubator for 12 h, CCK-8 reagent was added, and incubation continued for another 4 h before measuring OD. 450 Absorbance value.

[0070] OD samples : Absorbance of wells containing culture medium, cells, CCK-8 solution, and drug solution.

[0071] OD blank : It contains culture medium, CCK-8 solution, drug solution, and absorbance values ​​of pores without cells.

[0072] OD0: Absorbance of wells containing culture medium, CCK-8 solution, but without drug solution.

[0073] II. Experimental Results 1. Determination of minimum inhibitory concentration (MIC) and its antibacterial ability Table 1. Minimum inhibitory concentrations of VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT Note: " / " indicates that this item is not present.

[0074] The VCZ@SFNPs-AU1 nanosystem targets Candida albicans ( Candida albicans The inhibitory effect was significant, and a synergistic enhancement effect was observed when combined with photodynamic therapy (PDT). The antibacterial activity of free VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and their combined PDT treatments were evaluated by minimum inhibitory concentration (MIC) determination and inhibition zone assays. The results showed that the MIC of free VCZ against Candida albicans was 16 µg / mL, while the MIC of VCZ@SFNPs decreased to 8 µg / mL, and VCZ@SFNPs-AU1 further reduced the MIC to 4 µg / mL. When VCZ@SFNPs-AU1 was combined with methylene blue (MB)-mediated PDT (VCZ@SFNPs-AU1+PDT), the MIC significantly decreased to 2 µg / mL, indicating a greatly enhanced antibacterial activity (Table 1). The inhibition zone assay showed that the VCZ@SFNPs-AU1+PDT treatment group had the largest inhibition zone diameter, clearly indicating its strongest diffusion and inhibitory ability. Figure 3 (As shown in A in the diagram).

[0075] 2. Determination of growth inhibition curve Growth curves showed that free VCZ interfered with the proliferation of *Candida albicans*, manifested as a prolonged lag phase, consistent with previous reports. At VCZ and VCZ@SFNPs concentrations of 2 µg / mL, *Candida albicans* in the VCZ@SFNPs-AU1 treatment group at a concentration of 1 µg / mL entered the exponential growth phase approximately 6, 12, and 18 hours after inoculation, respectively, with the lag time increasing sequentially, and the growth slope decreasing sequentially after entering the logarithmic phase. The antibacterial effect of VCZ@SFNPs-AU1 exhibited significant concentration dependence and formulation superiority. At equivalent concentrations, its inhibitory efficacy was significantly stronger than that of free VCZ and non-targeted nanoparticles VCZ@SFNPs. Simultaneously, the introduction of photodynamic therapy also enhanced its inhibitory effect on *Candida albicans*. The growth curve of the VCZ@SFNPs-AU1+PDT treatment group at a concentration of 2 µg / mL remained flat throughout the monitoring period (0 h–48 h), with OD... 600 The value did not increase significantly, indicating that the growth of Candida albicans was completely inhibited.

[0076] 3. H&E fluorescent staining The effect of VCZ@SFNPs-AU1 nanomaterials on the cell membrane integrity of Candida albicans was evaluated using cell fluorescence staining technology. Fluorescence microscopy observation showed ( Figure 3 As shown in Figure D), the control group of Candida albicans cells without nanomaterial treatment exhibited uniform green fluorescence, indicating that the cell membrane structure was intact and the cells were in an active state. After treatment with free VCZ, some fungal cells began to show scattered red fluorescence, suggesting that the drug caused reversible damage to some fungal cell membranes, but there were still a large number of green fluorescent areas, indicating limited antibacterial effect. In the VCZ@SFNPs-AU1 treatment group, the red fluorescence signal was significantly enhanced, and the green fluorescent area was correspondingly reduced, indicating that the permeability of the Candida albicans cell membrane was increased and a large number of cells died. When combined with photodynamic therapy (PDT), almost the entire field of view was red fluorescence, and the green fluorescence basically disappeared, indicating that VCZ@SFNPs-AU1+PDT induced complete cell membrane rupture, leading to the death of a large number of fungi.

[0077] 4. Effects of nanomaterial treatment on fungal cell morphology Scanning electron microscopy (SEM) revealed that different treatment groups caused varying degrees of damage to the morphology of Candida albicans cells. For example... Figure 3 As shown in Figures A through C, compared to the PBS-treated control group, the surface of some bacteria in the free VCZ-treated group showed slight shrinkage, but the cell morphology remained largely intact. The VCZ@SFNPs-treated group exhibited more pronounced morphological changes, including localized cell membrane indentation, leakage of contents, and deformation of the bacterial structure. The VCZ@SFNPs-AU1-treated group further exacerbated cell damage, with large areas of ruptured pores appearing on the bacterial surface, significant leakage of intracellular material, and aggregation and adhesion between adjacent bacteria. Notably, the VCZ@SFNPs-AU1+PDT combined treatment group showed the most significant morphological destruction, with complete disintegration of the bacterial structure and only residual cell fragments, indicating a synergistic killing effect between photodynamic therapy and targeted nanomedicine.

[0078] 5. Qualitative and quantitative analysis of biofilm growth inhibition Crystal violet can be used to C. albicansThe biofilm was stained, allowing for a relatively direct observation of the biofilm formation. The inhibitory efficacy of the VCZ@SFNPs-AU1 nanosystem on Candida albicans biofilm growth was systematically studied using qualitative analysis with crystal violet staining and quantitative evaluation with the XTT reduction method. Qualitative analysis showed that the control group formed a deep and dense three-dimensional network structure, while the VCZ-treated group only caused slight inhibition, with a slight decrease in membrane thickness; the VCZ@SFNPs group showed moderate inhibition, with local disintegration of the biofilm structure; the VCZ@SFNPs-AU1 group significantly reduced the amount of biofilm formation and disrupted its continuity; after combined PDT treatment (VCZ@SFNPs-AU1+PDT group), the biofilm almost completely disappeared, leaving only scattered cell fragments, indicating that photodynamic therapy can completely destroy the integrity of the biofilm. Quantitative data further confirmed that VCZ@SFNPs-AU1 reduced the biofilm metabolic activity to 29.6% of the control group at the MIC concentration, and further decreased to 8.2% after combined PDT treatment. Figure 4 As shown.

[0079] 6. Observation on the morphological structure of Candida albicans biofilm inhibited in vitro by photodynamic therapy combined with VCZ@SFNPs-AU1 The results of laser scanning confocal microscopy (CLSM) observations show (e.g.) Figure 5 As shown in Figures A through D), the different treatment groups exhibited significant differences in their clearance effects on mature Candida albicans biofilms. In the free VCZ treatment group, green fluorescence (live bacteria) dominated the biofilm, with only sporadic red fluorescence (dead bacteria), indicating that the free drug had limited penetration and killing effects on mature biofilms, making it difficult to effectively overcome their inherent physical barriers and drug resistance. After encapsulation with nanocarriers (VCZ@SFNPs group), the red fluorescence area significantly increased, confirming that the nanoparticles promoted drug accumulation in the biofilm through enhanced penetration and retention effects. The targeted nanoparticles modified with the AU1 aptamer (VCZ@SFNPs-AU1 group) showed a stronger bactericidal effect, with a denser and more continuous red fluorescence signal. The mechanism lies in AU1's specific recognition of (1,3)-β-D-glucan in the Candida albicans cell wall, achieving active targeted drug delivery and greatly increasing the local drug concentration at the lesion site. The most significant effect was observed in the VCZ@SFNPs-AU1+PDT combined treatment group, where green fluorescence in the field of view was almost completely replaced by intense red fluorescence. This indicates that the reactive oxygen species generated by photodynamic therapy (PDT) and the targeted delivery of voriconazole produced a synergistic antibacterial effect, which can effectively destroy the biofilm structure and kill the internal bacteria, thereby achieving near-complete removal of mature biofilms.

[0080] 7. Targeted study of photodynamic therapy combined with VCZ@SFNPs-AU1 on Candida albicans biofilm Results of observation by laser confocal microscopy (e.g.) Figure 5 As shown in E and F in the figure, the DiI@SFNPs-AU1+PDT treatment group (as shown in the figure) Figure 5 As shown in Figure E), the AU1 aptamer- and MB-modified nanoparticles exhibited significantly more and stronger fluorescence signals in the CFW-labeled biofilm, indicating that the nanoparticles were efficiently and specifically enriched within the biofilm. In contrast, the unmodified DiI@SFNPs group (as shown in Figure E) showed significantly more and stronger fluorescence signals. Figure 5 The fluorescence signal (shown in F) was weak and sparse. This difference confirms the active targeting effect mediated by AU1: the AU1 aptamer can specifically recognize and bind to relevant components of the Candida albicans biofilm, thereby anchoring the nanoparticles to the target site. Meanwhile, the introduction of MB may further optimize the surface properties of the nanoparticles through its amphiphilicity, enhancing the interaction with the biofilm matrix.

[0081] 8. Biocompatibility testing 8.1 nanoparticles' in vitro hemolytic activity The blood compatibility of the nanomaterials was evaluated using a hemolysis experiment. Figure 6 As shown in Figures A and B, the hemolysis rate of VCZ@SFNPs-AU1 at a concentration of 32 µg / mL (8 times the MIC) was 4.94 ± 0.32%, slightly below the 5% biosafety threshold, and the hemolysis rate remained stable with concentration changes. Furthermore, no significant hemolytic reaction (3.82%–4.21%) was induced in any of the experimental groups at their MIC concentrations, showing no statistically significant difference compared to the nano-formulation. p >0.05), indicating that the modification of silk fibroin carrier and aptamer did not introduce additional risk of hemolysis.

[0082] 8.2 Effects of nanoparticles on cell viability The effect of nanomaterials on the proliferation of L929 cells was detected using the CCK-8 assay. Figure 6 As shown in C, the cell viability of VCZ@SFNPs-AU1 remained at 80.2±3.5% at a concentration of 4MIC, significantly higher than that of the free VCZ group (52.8±4.1%). p <0.01). Concentration-dependent experiments showed that as the concentration of VCZ@SFNPs-AU1 increased from 1 / 2 MIC to 4 MIC, cell viability gradually decreased from 95.3% to 80.2%, but remained higher than that of the free VCZ control group (78.6%~52.8%).

[0083] Experimental Example 3: In vivo antibacterial activity of photodynamic therapy combined with VCZ@SFNPs-AU1 The following experiments were conducted using VCZ@SFNPs-AU1 prepared in Example 1.

[0084] I. Experimental Methods 1. Construction and treatment of a mouse subcutaneous Candida albicans biofilm model Fifteen 5-week-old SPF-grade C57 mice, weighing approximately 20g, were selected after two weeks of stable rearing. All normal C57 mice were immunosuppressed for 72 hours with a 1mg / L dexamethasone solution. Mature mice cultured for 48 hours were then harvested on the fourth day. C. albicans 200 µL of the biofilm resuspension was locally injected into the buttocks of mice in the experimental group, while the blank control group was injected with an equal volume of PBS. During this period, the mice were given a standard diet, and the temperature was kept constant at 24°C and the humidity at 55%.

[0085] In establishing C. albicans On the fifth day of the infection model, mice in the experimental group were intravenously injected with VCZ, VCZ@SFNPs, VCZ@SFNPs-AU1, and VCZ@SFNPs-AU1+PDT at an equivalent VCZ concentration of 6 mg / kg body weight (clinical dose). All drugs were prepared in PBS. In the photodynamic therapy group, VCZ@SFNPs-AU1+PDT was first intravenously injected with VCZ@SFNPs-AU1 at a concentration of 6 mg / kg. After 1 hour, the nanoparticles accumulated at the infection site. Then, 50 µL of 10 µg / mL MB solution (MB solution in PBS) was injected into the infection site, and the mixture was incubated at 37°C in the dark for 20 minutes to allow MB to penetrate and enter the biomembrane. Subsequently, a 660 nm semiconductor laser at a power density of 50 mW / cm² was used at the infection site. 2 The mice were exposed to light for 20 minutes. The irradiation process was conducted at 37°C. The blank control group was injected with an equal volume of PBS. The mice were continuously observed, and changes in the infection sites were recorded daily.

[0086] Two weeks after treatment, the mice were euthanized and dissected under sterile conditions to obtain samples of the heart, liver, spleen, lungs, kidneys, and infected sites. The samples were embedded in paraffin, sectioned, stained with H&E, and examined under an inverted fluorescence microscope (OLYMPUS, CKX53). Images were acquired and analyzed.

[0087] Under sterile conditions, tissue samples from subcutaneous infection sites in C57 mice treated with different treatment groups were collected, and 9 times the volume of physiological saline was added to prepare a 10% tissue homogenate. This homogenate was then diluted to 1% with physiological saline and inoculated onto TTC-Sapper's agar medium. C. albicans After incubation at 37°C for 24 hours in the identification medium, the results of different treatment groups were observed and recorded. C. albicans Colony count. Simultaneously, the level of collagen in mice was detected using enzyme-linked immunosorbent assay (ELISA).

[0088] Mouse blood was collected, centrifuged, and serum was obtained. The levels of inflammatory factors IL-10 and IL-1β in mouse serum were detected by enzyme-linked immunosorbent assay (ELISA).

[0089] 2. In vivo biosafety analysis of nanoparticles Blood was collected from mice, and the supernatant was placed in a fully automated biochemical analyzer (Shenzhen Leidu Life Science & Technology, Chemray 240) to measure and analyze liver and kidney function indicators such as ALT, AST, CREA, and BUN.

[0090] Hearts, livers, spleens, lungs, and kidneys of treated C57 mice were harvested in a sterile environment. After fixation with paraformaldehyde, the tissue samples were dehydrated using a gradient of ethanol, followed by clearing and paraffin embedding before sectioning. The paraffin sections were then dewaxed sequentially in xylene, anhydrous ethanol, 90% ethanol, 80% ethanol, 70% ethanol, and 50% ethanol to water. The paraffin sections were stained with hematoxylin for 1 min, rinsed with running water, differentiated with 1% hydrochloric acid alcohol for 20 s, rinsed with running water, then blued with 1% ammonia solution for 1 min, rinsed with running water for 20 s, stained with eosin for 30 s, and rinsed with running water. The paraffin sections were then sequentially immersed in 75% ethanol, 85% ethanol, anhydrous ethanol, and xylene until clear. The sections were removed from xylene and mounted with neutral resin. The images were acquired and analyzed using an inverted fluorescence microscope (OLYMPUS, CKX53).

[0091] 3. Research on the in vivo targeting effect of nanoparticles Prepare a 0.1 mg / mL solution of fluorescent reagent CY5 in PBS, then mix it separately with equal concentrations of VCZ, VCZ@SFNPs, and VCZ@SFNPs-AU1 at room temperature. Stir at a constant speed for 12 h, centrifuge at 5000 rpm for 10 min, discard the supernatant, freeze-dry, and remove any unlinked fluorescent reagent CY5. Then, resuspend the above drugs in PBS and administer via tail vein injection. C. albicans Mice with subcutaneous infection were used to establish a model, with the concentration controlled at 6 mg / kg (clinical dose). The control group was injected with an equal volume of 0.1 mg / mL of the fluorescent reagent CY5. Fluorescence intensity was measured at 0, 1, 2, 4, 8, 12, and 24 h using a small animal in vivo optical imaging system (IVIS Lumina LT Series III, PerkinElmer). Mice were sacrificed after 24 h, and the fluorescence intensity of their heart, liver, spleen, lungs, and kidneys was measured. Images were acquired and analyzed.

[0092] II. Experimental Results 1. Evaluation of therapeutic efficacy in mice like Figure 7As shown in A, the targeted nano-drug delivery system constructed, which integrates multiple indicators such as infection site healing, fungal clearance, histopathology, and serum inflammatory factor levels, showed good therapeutic effects in a mouse model of subcutaneous Candida albicans infection. Figure 7 The photo of the infected site shown in B clearly shows that during the 14-day treatment period, the subcutaneous cysts in the VCZ@SFNPs-AU1+PDT combined treatment group healed the fastest, and by the 14th day, they had basically disappeared, while the other groups still had subcutaneous cysts of varying degrees. Figure 7 The quantitative data shown in C further confirms that the cyst area in the combined treatment group was significantly reduced to 0%±2.1%, which was significantly better than the VCZ@SFNPs-AU1 group (21%±4.96%), the VCZ@SFNPs group (42%±4.05%), and the free VCZ group (60%±5.17%). p <0.001). Consistent with the trend of cyst reduction, tissue fungal load (CFU) analysis showed that the combined treatment achieved the most thorough pathogen clearance, with an antifungal rate of 2.6% ± 0.76%, significantly lower than other groups ( p <0.001). Figure 7 The H&E staining results shown in Figure D reveal the treatment efficacy from a histopathological perspective: In the control group (Control), extensive inflammatory cell infiltration, tissue necrosis, and structural destruction were observed at the infection site; free VCZ treatment showed only slight improvement; while the VCZ@SFNPs-AU1+PDT combined treatment group exhibited significantly reduced inflammatory infiltration, good granulation tissue formation, and a more intact skin tissue structure, demonstrating excellent anti-inflammatory and tissue protective effects. This is consistent with the results of serum inflammatory factor detection. Serum inflammatory factor detection results showed that the combined treatment group significantly downregulated the pro-inflammatory factor IL-1β (IL-1β). Figure 7 The level of G (as shown in the figure) was 3.6% ± 0.8%, while the level of the anti-inflammatory factor IL-10 (as shown in the figure) was significantly upregulated. Figure 7 (As shown in F) Level (19.7% ± 0.9%) p <0.001). Upregulation of IL-10 not only negatively inhibits excessive inflammation, but it has also been shown to promote fibroblast proliferation and collagen synthesis by activating pathways such as STAT3, making it a key regulator of tissue repair. Quantitative analysis results of collagen occupancy ( Figure 7 The H in the figure confirms this point, with the most significant collagen deposition (85% ± 2.4%) in the combined treatment group, which is completely consistent with the good tissue repair observed in H&E staining.

[0093] The aforementioned therapeutic effects are attributed to a multi-level synergistic mechanism. First, AU1 aptamer-mediated active targeting ensures the specific enrichment of nanoparticles at the fungal infection site, significantly increasing local drug concentration. Second, the reactive oxygen species (ROS) generated by photodynamic therapy (PDT) can directly disrupt the fungal cell membrane and biofilm structure, synergizing with the antibacterial effect of voriconazole and overcoming biofilm-related drug resistance. This strategy of "actively targeting and enriching" and "physicochemical synergistic killing" is the core of achieving highly effective antibacterial activity. The efficient clearance of pathogens directly reverses the immune imbalance caused by infection.

[0094] 2. In vivo biosafety analysis of nanoparticles 2.1 H&E staining of major organs in mice The in vivo biosafety of the VCZ@SFNPs-AU1 nanosystem was evaluated by systematically observing H&E-stained sections of vital organs (heart, liver, spleen, lungs, and kidneys) in mice after treatment. Histological examination revealed significant inflammatory cell infiltration and localized vacuolar degeneration of renal tubular epithelial cells in the kidney tissue of mice treated with free VCZ, indicating that the original VCZ drug has a certain toxic effect on kidney tissue. In contrast, the kidney tissue morphology of the VCZ@SFNPs-AU1 treatment group and the VCZ@SFNPs-AU1+PDT combined treatment group was basically consistent with that of the blank control group, with intact glomerular structure, neatly arranged renal tubules, and no obvious pathological changes. In other major organs (heart, liver, spleen, and lungs), no significant tissue structural abnormalities or inflammatory cell infiltration were observed in any of the experimental groups, indicating that the nano-formulation did not cause significant toxic damage to the major organs. Figure 8 As shown in A in the diagram.

[0095] 2.2 Detection of Blood Biochemical Indicators in Mice The protective effect of the VCZ@SFNPs-AU1 nanosystem on liver and kidney function was systematically evaluated by quantitative detection of serum biochemical indicators in the treatment group mice. Figure 8As shown in Figures B and E, the serum AST (aspartate aminotransferase) and BUN (blood urea nitrogen) levels in mice treated with free VCZ were 68.3±5.2 U / L and 12.7±1.3 mmol / L, respectively, significantly higher than the normal reference range (AST: 10 U / L~40 U / L; BUN: 5 mmol / L~10 mmol / L), indicating that the drug caused significant hepatocellular damage and renal dysfunction. In contrast, the AST (35.2±3.1 U / L) and BUN (7.8±0.9 mmol / L) levels in the VCZ@SFNPs-AU1 treatment group remained within the normal range, and there was no statistically significant difference compared with the VCZ@SFNPs-AU1+PDT combined treatment group (AST: 32.6±2.8 U / L; BUN: 6.9±0.7 mmol / L). p >0.05). Regarding ALT (alanine aminotransferase) and CREA (creatinine) indicators ( Figure 8 As shown in Figures D and C), all nanoparticle-treated groups remained at normal physiological levels with no obvious abnormalities. This demonstrates that silk fibroin nanoparticles encapsulating VCZ can reduce its hepatotoxicity and nephrotoxicity.

[0096] 3. Research on the in vivo targeting effect of nanoparticles like Figure 9 As shown, drug-loaded nanoparticles exhibited significant targeted enrichment effects in mice infected with Candida albicans. (In vivo imaging) Figure 9 As shown in Figure B), the proportion of fluorescent signals at the infection site gradually increased in the infected group within 1-24 hours after injection. Ex vivo organ imaging ( Figure 9 (as shown in C) and quantitative analysis ( Figure 9 (As shown in D) further confirms that the average fluorescence intensity of the infected tissues in the experimental group was significantly higher than that in major organs such as the heart, liver, spleen, lungs, and kidneys (***, p The difference was <0.001), while there were no significant differences between the groups in different organs. This indicates that nanoparticles can specifically accumulate in infectious lesions.

[0097] Its targeting mechanism primarily stems from the inflammatory microenvironment triggered by infection. Candida albicans infection leads to the release of large amounts of pro-inflammatory factors (such as TNF-α and IL-1β) in local tissues, causing vasodilation and increased permeability. Nanoparticles can passively target and accumulate in this area through enhanced penetration and retention effects. This targeting capability provides a crucial delivery basis for subsequent anti-infective therapies based on this nanosystem.

[0098] In summary, this invention successfully developed a novel AU1 aptamer-modified voriconazole-loaded silk fibroin nanoparticle (VCZ@SFNPs-AU1) and combined it with methylene blue-mediated photodynamic therapy (PDT) as a highly efficient synergistic strategy for treating refractory Candida albicans biofilm infections. Compared with VCZ alone, this nanosystem exhibits superior performance, including enhanced drug encapsulation efficiency and pH-responsive sustained-release properties, significantly improved in vitro antibacterial activity, and effective penetration and disruption of biofilms. The introduction of PDT further amplifies its bactericidal effect by generating a burst of reactive oxygen species (ROS) and synergistic cell membrane damage. In vivo experiments confirmed that VCZ@SFNPs-AU1 can specifically target the infection site, achieving highly efficient bactericidal and tissue repair effects, while significantly reducing the hepatotoxicity and nephrotoxicity of voriconazole.

[0099] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0100] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. An antifungal nanoparticle, characterized in that, Antifungal nanoparticles were obtained by covalently linking aptamer AU1 with drug-loaded silk fibroin nanoparticles via amide bonds; the mass ratio of the drug-loaded silk fibroin nanoparticles to aptamer AU1 was 20:0.5~2.

0. The drug-loaded silk fibroin nanoparticles were prepared by a desolvation method, which involved mixing an aqueous solution of silk fibroin with an anhydrous ethanol solution containing voriconazole. The volume ratio of the silk fibroin aqueous solution to the anhydrous ethanol solution containing voriconazole is 1:1~10. The concentration of the silk fibroin aqueous solution is 8 mg / mL to 15 mg / mL; the concentration of the anhydrous ethanol solution containing voriconazole is 0.8 mg / mL to 1.5 mg / mL.

2. The antifungal nanoparticles according to claim 1, characterized in that, The nucleotide sequence of the aptamer AU1 is shown in SEQ ID NO.1, with an amino group modified at the 3' end by 0.5 mM.

3. The method for preparing antifungal nanoparticles according to claim 1, characterized in that, Specifically, the following steps are included: Drug-loaded silk fibroin nanoparticles were placed in an activation buffer and 1-ethyl-3-dimethylaminopropylcarbodiimide and N-hydroxysuccinimide were added for carboxyl activation reaction. Then, aptamer AU1 was added to obtain antifungal nanoparticles. The mass ratio of the drug-loaded silk fibroin nanoparticles, 1-ethyl-3-dimethylaminopropylcarbodiimide, and N-hydroxysuccinimide is 20 mg: 20 mg to 60 mg: 20 mg to 60 mg; the mass ratio of the drug-loaded silk fibroin nanoparticles to aptamer AU1 is 20 mg: 0.5 mg to 2.0 mg.

4. The preparation method according to claim 3, characterized in that, The activation buffer is a MES buffer with a pH of 5-6.

5. The use of the antifungal nanoparticles according to claim 1 in the preparation of a medicament for treating fungal biofilm infections.

6. The application according to claim 5, characterized in that, The fungi include Candida albicans ( Candida albicans ).

7. A combination drug for fungal biofilm infections, characterized in that, The combined drug consists of the antifungal nanoparticles and photosensitizer described in claim 1.

8. The combination drug according to claim 8, characterized in that, The photosensitizer is methylene blue.

9. The combination drug according to claim 8, characterized in that, The dosage of the antifungal nanoparticles is 6 mg / kg; the concentration of the methylene blue is 10 µg / mL, and the volume of each administration is 50 µL.

Images