Genetically engineered neumococcin b0 producing strain, method for preparing the same and use thereof

By conducting genomic and metabolomics studies on the Neomocontin B0 producing strain and implementing multi-level gene modification and polyethylene glycol-mediated transformation technology, the problem of insufficient yield increase of Neomocontin B0 was solved, achieving high-efficiency production and reducing production costs.

CN122168432APending Publication Date: 2026-06-09SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Filing Date
2024-12-06
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing technologies lack a hierarchical and systematic approach to increasing the yield of Numocontin B0, failing to effectively optimize primary and secondary metabolic processes, resulting in limited yield increases. Furthermore, they do not focus on the transcriptional regulatory system, leading to high production costs for caspofungin.

Method used

Using genetic engineering techniques, we conducted genomic, transcriptomic, and metabolomics studies on the Neomocontin B0 producing strain G. lozoyensis, and implemented multi-level and systematic gene modifications, including overexpression of the GLcs gene, overexpression of the GLhyd gene, and knockout of the GL6ma gene and GLpyrE gene, to construct a high-yielding strain. Gene modifications were then carried out using polyethylene glycol-mediated protoplast transformation technology.

Benefits of technology

It significantly increased the yield of Numocontin B0 by 40% to over 100%, reduced production costs, and met the demand for caspofungin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168432A_ABST
    Figure CN122168432A_ABST
Patent Text Reader

Abstract

The present application discloses a genetically engineered strain for producing neomycin B0, which is obtained from a mutant strain of the starting strain G. lozoyensis ATCC 74030 by modifying specific genes, and has an improved yield of neomycin B0 compared with the starting strain, wherein the genetic modification comprises overexpression of GLcs gene and overexpression of GLhyd gene, and preferably, the genetic modification further comprises one or more genetic modifications selected from the group consisting of knockout of GL6ma gene, knockout of GLpyrE gene, overexpression of GLp450-1 gene, overexpression of GLp450-2 gene, and overexpression of GLhyp gene. The present application also discloses a method for preparing the genetically engineered strain, and a method for preparing neomycin B0.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology. Specifically, this application discloses a method for constructing a high-yield Neomocontin B0 producing strain, the strain constructed according to the method, and its applications. Background Technology

[0002] Invasive fungal diseases (IFDs) impose a huge medical burden on the world, causing more than 300 million severe cases and 1.5 million deaths annually. 1 In October 2022, the World Health Organization released its first-ever report on "Priority Fungal Pathogens," emphasizing the importance and urgency of addressing fungal infections. 2 Over the past 40 years, echinocandins and triterpenoids (ibrexafungerp) have been the only two classes of novel antifungal drugs. 3 Due to their high efficacy and low toxicity, echinocandins have rapidly become first-line treatments for intraepithelial fibrillary disease (IFD). Caspofungin was the first echinocandin antifungal drug approved for marketing. Its chemical precursor is Numocontin B0 (PB0), produced by fermentation of the filamentous fungus Glarea lozoyensis. Currently, demand for Caspofungin continues to grow significantly, with production falling short of supply. However, the low yield of PB0 increases fermentation and purification costs, making Caspofungin expensive and unaffordable for many patients. Therefore, increasing the production of Numocontin B0, the biosynthetic precursor of Caspofungin, is urgently needed.

[0003] Initially, the increase in PB0 yield was mainly achieved through classic methods such as strain selection and fermentation process optimization. For example, high-yielding strain Q1 could be obtained through strain mutagenesis, with a PB0 yield of 1.87 g / L. 4 Regarding fermentation process optimization, adding 1.0 g / L sodium dodecyl sulfate on day 13 of fermentation significantly increased PB0 yield by 37.6%. 5 .

[0004] With the identification of the neomoContin biosynthetic gene cluster in 2013 6 This involves analyzing the subsequent biosynthetic pathway of PB0. Researchers have begun using genetic engineering and metabolic engineering techniques to edit the PB0 gene cluster in order to increase PB0 production. For example, knocking out the GLoxy4 gene in the gene cluster can eliminate the production of the byproduct nimocontin A0. 7 Using CRISPR / Cas9 gene editing technology, the gloF gene in a gene cluster can be replaced with the ap-htyE gene, thereby eliminating the production of the byproduct nimocontin CO. 8 Another team increased PB0 production by regulating the redox balance of the strain by knocking out Glyap1. 9 .

[0005] Although some teams have modified strain gene clusters using genetic engineering and metabolic engineering, current modifications still have shortcomings: 1. Most modifications are single-step processes, lacking hierarchy and systematic approach; 2. Modifications primarily target PB0 secondary metabolic pathways, while PB0 biosynthesis involves many primary metabolites such as amino acids, which are crucial for increasing PB0 yield; 3. Current modifications mainly focus on byproducts in PB0 synthesis, neglecting similar competing metabolites; 4. No studies have yet optimized the transcriptional regulatory system in PB0 synthesis. Therefore, there is still a need in this field to develop a multi-level, systematic strain modification approach that integrates PB0 primary and secondary metabolic processes, addressing substrate supply (such as amino acids), elimination of competing metabolites, and optimization of transcriptional regulators, thereby providing high-yielding PB0 strains. Summary of the Invention

[0006] The inventors of this application, through genomics, transcriptomics, and metabolomics studies of the existing Neomocontin B0 producing strain G. lozoyensis, provide a method for constructing a high-yield Neomocontin B0 producing strain, the strain constructed according to this method, and its applications. Specifically, this application solves the technical problems in this field through the following technical solutions.

[0007] 1. A genetically engineered bacterium, which, compared to the original strain, contains the following gene modifications in its genome:

[0008] Overexpression of the GLcs gene and overexpression of the GLhyd gene, wherein the originating strain is a filamentous fungus G. lozoyensis deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCCNO:M 20242524, and wherein the engineered strain has increased yield of nimocontin B0 compared with the originating strain.

[0009] 2. The genetically engineered bacteria according to Project 1, wherein the genetically engineered bacteria further comprises one or more gene modifications selected from the following: knockout of the GL6ma gene, knockout of the GLpyrE gene, overexpression of the GLp450-1 gene, overexpression of the GLp450-2 gene, and overexpression of the GLhyp gene.

[0010] 3. The genetically engineered bacteria according to Project 2, wherein the genetically engineered bacteria, compared with the starting strain, includes overexpression of the GLcs gene, overexpression of the GLhyd gene, and overexpression of the GLp450-2 gene.

[0011] 4. The genetically engineered bacteria according to Project 2, wherein the genetically engineered bacteria, compared with the starting strain, includes overexpression of the GLcs gene, overexpression of the GLhyd gene, knockout of the GL6ma gene, knockout of the GLpyrE gene, and overexpression of the GLhyp gene.

[0012] 5. The genetically engineered bacteria according to any one of items 1-4, wherein the yield of nimocontin BO of the genetically engineered bacteria is increased by 40%, 50%, 60%, 70%, 80%, 90%, or 100% or more, preferably by more than 100%, compared with the original strain.

[0013] 6. The genetically engineered bacteria described in any one of items 1-5, wherein the genetically engineered bacteria are identified by the accession numbers CCTCC NO:M20242525, CCTCC NO:M20242526, or CCTCC NO:M

[0014] 20242527 and CCTCC NO:M 20242528 are deposited at the China Center for Type Culture Collection (CCTCC).

[0015] 7. A method for preparing genetically engineered bacteria according to any one of items 1-6, comprising the following steps:

[0016] 1) Construct overexpression vectors of single genes or combined gene overexpression vectors of two or more genes selected from GLcs, GLhyd, GLp450-1, GLp450-2 and GLhyp.

[0017] 2) Construct knockout vectors of a single gene selected from GL6ma and GLpyrE or combined gene knockout vectors of two genes.

[0018] 3) Transform the starting strain described in Project 1 using the overexpression vector of step 1) and the knockout vector of step 2), respectively or in combination, preferably by the polyethylene glycol method;

[0019] 4) Screen for strains that have been correctly transformed and have increased yields of nimocontin B0 compared to the starting strain.

[0020] 8. The method according to Project 7, wherein the overexpression vector and the knockout vector are respectively constructed in plasmids.

[0021] 9. The use of the genetically engineered bacteria described in any one of items 1-6 in the preparation of Numocontin B0.

[0022] 10. A method for preparing Numococtin B0, comprising culturing the genetically engineered bacteria described in any one of items 1-6 or the genetically engineered bacteria prepared by the method of item 7 under conditions suitable for producing Numococtin B0, and isolating Numococtin B0.

[0023] Attached Figure Description

[0024] Figure 1 Shake-flask fermentation results of gene-overexpressing strains. Three replicates were performed for each strain, and the average value was taken. Statistical analysis was conducted using a t-test, and P < 0.05. Z11 =0.0016, P Z12 =0.2675, P Z13 =0.0007, P Z15 =0.0108, P Z18 =0.0015, P Z23 <0.0001, P Z24 <0.0001, P Z26 <0.0001, P Z28 =0.0003, P Z29 =0.0021.

[0025] Figure 2 Shake-flask fermentation results of gene knockout strains. Three replicates were performed for each strain, and the average value was taken. Statistical analysis was performed using a t-test, and P < 0.05. Z16 =0.0163, P Z17 =0.0007, P Z21 <0.0001.

[0026] Figure 3 Shake-flask fermentation results of gene overexpression and knockout combined metabolic engineered strains. Three replicates were performed for each strain, and the average value was taken. Statistical analysis was performed using a t-test, and P < 0.05. Z32 <0.0001, P Z33 =0.0002, P Z35 =0.0006, P Z37 =0.0003, P Z38 <0.0001. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0028] definition

[0029] It will be understood that the invention is not limited to any particular methodology or approach. It will also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which will be defined only by the appended claims. The term “about” is used herein to mean approximately, roughly, substantially, or in a region. When the term “about” is used with a numerical range, it modifies the range by extending the boundaries above and below the given numerical value. Typically, the term “about” is used herein to modify the numerical value above and below by a variation of about 20%, preferably about 10% (higher or lower). The term “or” as used herein refers to any member of the specific list and also includes any combination of members of the list. The terms “comprising” and “including” when used in the specification and the following claims are intended to indicate the presence of one or more of the stated features, integers, ingredients, or steps, but they do not exclude the presence or addition of one or more other features, integers, ingredients, steps, or groups thereof. For clarity, certain terms used in the specification are defined and used below:

[0030] The term "gene" refers to a region that effectively connects to suitable regulatory sequences that can regulate the expression of a gene product (e.g., a polypeptide or functional RNA) in some way. A gene comprises non-translated regulatory regions of DNA (e.g., promoters, enhancers, repressors, etc.) preceding (upstream) and following (downstream) the coding region (ORF). As used herein, the term "structural gene" refers to a DNA sequence that is transcribed into mRNA, which is then translated into the characteristic amino acid sequence of a specific polypeptide.

[0031] The term "genome" or "genomic DNA" refers to the heritable genetic information of a host organism. Genomic DNA includes nucleoid DNA and the DNA of autonomously replicating plasmids.

[0032] The term "expression" refers to the biosynthesis of a gene product, preferably a nucleotide sequence, such as the transcription and / or translation of an endogenous or heterologous gene in a cell. For example, in the case of a structural gene, expression involves the transcription of the structural gene into mRNA, and optionally, the mRNA is subsequently translated into one or more polypeptides. In other cases, expression may simply refer to the transcription of DNA containing RNA molecules.

[0033] The term "overexpression" refers to the accumulation of more transcripts and, in particular, more of the polypeptide or protein, than the endogenous copy of the genetic element that produces the polypeptide or protein under the same biological background. Methods for gene overexpression are known in the art. For example, stable expression is achieved by integrating a foreign gene into the genome of a host cell using a lentiviral vector. Alternatively, gene editing tools such as CRISPR-Cas9 can be used to activate the expression of a target gene by designing gRNAs to target the promoter region of a specific gene and fusing the dCas9 protein with a transcription activator. Recombinant vectors can also be used to construct overexpression vectors containing one or more copies of the target gene, which are then transfected into cells to achieve overexpression of the target gene.

[0034] The term "gene knockout" is a gene-editing technique that uses homologous recombination to inactivate or delete specific genes in an organism. This method uses a designed homologous fragment to replace the target gene fragment, thereby achieving gene knockout. Gene knockout technology not only overcomes the blindness and randomness of random integration but also allows for the inference of a gene's biological function by observing the organism's behavior after deletion or inactivation. Gene knockout can be achieved through homologous recombination, gene editing (such as CRISPR / Cas9), RNA interference, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs).

[0035] The terms “promoter” or “promoter sequence” are equivalent and, as used herein, refer to a DNA sequence that, when effectively linked to a target nucleotide sequence, controls the transcription of that nucleotide sequence into RNA. A promoter is located at the 5' (i.e., upstream) adjacent to the transcription start point of the target nucleotide sequence (which controls the transcription of said target nucleotide sequence into mRNA) and provides a site for RNA polymerase-specific binding and the initiation of transcription by other transcription factors. The promoter does not include a coding region or a 5' untranslated region. A promoter can be, for example, heterologous or homologous to its respective cell. A nucleic acid molecule sequence is “heterologous” to an organism or a second nucleic acid molecule sequence if it originates from a foreign species, or if it originates from the same species but is modified from its original form. For example, a promoter effectively linked to a heterologous coding sequence means that the coding sequence and the promoter originate from different species, or, if from the same species, the coding sequence and the promoter are not naturally bound (e.g., a genetically modified coding sequence or an allele from a different ecotype or variety). A suitable promoter can originate from a gene in the host cell where expression should occur or from a pathogen of that host.

[0036] The “GLcs gene” described herein includes the GLcs gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:35. The GLcs gene described herein also includes homologous GLcs genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLcs gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:35.

[0037] The “GLhyd gene” described herein includes the GLhyd gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:33. The GLhyd gene described herein also includes homologous GLhyd genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLhyd gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:33.

[0038] The “GL6ma gene” described herein includes the GL6ma gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:38. The GL6ma gene described herein also includes homologous GL6ma genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GL6ma gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:38.

[0039] The “GLpyrE gene” described herein includes the GLpyrE gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:39. The GLpyrE gene described herein also includes homologous GLpyrE genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLpyrE gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:39.

[0040] The “GLp450-1 gene” described herein refers to the GLp450-1 gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:36. The GLp450-1 gene described herein also includes homologous GLp450-1 genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLp450-1 described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:36.

[0041] The “GLp450-2 gene” described herein refers to the GLp450-2 gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:37. The GLp450-2 gene described herein also includes homologous GLp450-2 genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLp450-2 gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:37.

[0042] The “GLhyp gene” referred to herein is the GLhyp gene from G. lozoyensis strain Z00, the sequence of which is shown in SEQ ID NO:34. The GLhyp gene described herein also includes homologous GLhyp genes from other known or unknown strains of other G. lozoyensis species. These homologous genes can be obtained from the NCBI database, for example, using a BLAST method. Therefore, in some embodiments, the GLhyp gene described herein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, or 100% identity with the sequence shown in SEQ ID NO:33.

[0043] The strain Z00 of G. lozoyensis described in this article is a mutant strain of the filamentous fungus G. lozoyensis ATCC 74030, with accession number CCTCC NO:M 20242524, which is also the starting strain of this application.

[0044] The names, genotypes, or characteristics of other strains of G. lozoyensis mentioned in this article are shown in Table 1.

[0045] OE-PCR (Overlap Extension PCR) refers to the use of primers with complementary ends to form overlapping strands of PCR products, which are then spliced ​​together by extending the overlapping strands in subsequent amplification reactions.

[0046] Polyethylene glycol (PEG)-mediated protoplast transformation is a method that transfers genetic material into recipient cell protoplasts through the mediation of PEG. Protoplast preparation and regeneration are crucial for transformation, and CaCl2 is also an indispensable component. This method first requires obtaining protoplasts with dewalled cells, which can be achieved by removing the cell walls of germ tubes or hyphae using cell wall-degrading enzymes. Enzyme mixtures are commonly used, such as cellulase, snailase, and cell wall-degrading enzymes. The combined use of these enzymes usually enhances cell wall removal. Osmotic stabilizers are required during protoplast preparation. In 1987, Penttila et al. first achieved PEG-mediated transformation of *Trichoderma reesei* based on protoplast preparation. Subsequent researchers have largely modified this approach, successfully using sorbitol at a concentration of 1.2 M to maintain osmotic stability during protoplast preparation; MgSO4 can be used as a substitute. Furthermore, mannitol or NaCl is also feasible for some fungi (Fincham et al., 1989). With the assistance of PEG, the insorption of exogenous DNA by the protoplast allows it to enter the protoplast, randomly insert, and integrate into the chromosome.

[0047] "Increased yield of Numocontin B0" means that the yield of Numocontin B0 of the engineered strain of the present invention is increased by more than 10%, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% or more, and more preferably by more than 100%.

[0048] Example

[0049] All molecular biology procedures were performed according to standard methods, such as those described in Fritsch, Sambrook, and Maniatis, "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press, New York, 1989, or comparable related works. Enzymes, kits, and instruments were used according to the respective manufacturers' instructions.

[0050] The reagents used in this invention are as follows:

[0051] Potato glucose solution (Qingdao Haibo, HB0233-4)

[0052] Glucose (aladdin, G116306-500g)

[0053] Mannitol (solarbio, M8141)

[0054] Tryptone (Shanghai Maclean Biochemical Technology Co., Ltd., T819615-500g)

[0055] Yeast extract (Sigma-Aldrich, V900886-500g)

[0056] Agar (Sangon Biotech (Shanghai) Co., Ltd., A505255-0250)

[0057] Chromatographically pure organic reagents (methanol and acetonitrile) were purchased from Thermo Fisher.

[0058] Phanta DNA polymerase (Nanjing Novizan Biotechnology Co., Ltd., P505-d1)

[0059] Taq DNA polymerase (Nanjing Novizan Biotechnology Co., Ltd., P222-01)

[0060] Plasmid miniprep kit (Nanjing Novizan Biotechnology Co., Ltd., DC201-1)

[0061] Kit for general gel recovery (Omega, D2500-02)

[0062] Gibson assembly kit (Yisheng Biotechnology Co., Ltd., 10912-A)

[0063] T4 DNA ligase (New England Biolabs, M0202V)

[0064] All DNA restriction endonucleases were purchased from Thermo Fisher Scientific.

[0065] The instruments used in this invention are as follows:

[0066] The high-performance liquid chromatography instrument used for PB0 yield determination was a Thermo Scientific Dionex Ultimate 3000U HPLC system.

[0067] The PCR instrument used was the Bio-Rad CFX96 Touch system.

[0068] The nucleic acid gel imaging instrument used was Syngene's G:BOX.

[0069] The electrophoresis tanks were Bio-Rad Mini-PROTEAN Tetra System and Bio-Rad Sub-Cell GT.

[0070] The ultra-micro UV-Vis spectrophotometer used for nucleic acid concentration measurement is Thermo Scientific's NanodropONEC.

[0071] Example 1: Construction of Overexpression Vector

[0072] 1.1 Construction of single gene overexpression plasmids

[0073] The genome of *G. lozoyensis* strain Z00 (deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20242524 on November 11, 2024; strain Z00 is a mutant strain of the filamentous fungus *G. lozoyensis* ATCC 74030) was obtained by phenol-chloroform extraction. Using the *G. lozoyensis* Z00 genome as a template, primer pairs GLhyd-F, 5'-CTTCACCAGAAAACAATCTCGAGATGGATCAAAATCCAATATTAATT C-3' (SEQ ID NO.1) and GLhyd-R, 5'-AATGAGTGGTGAAGACCGTCGACCTAGGACTTCATTACAAG-3' (SEQ ID NO.2) and GLhyp-F, 5'-TCACCAGAAAACAATCTCGAGATGGACCTTTTCCAAAGCCCTG-3' were obtained.

[0074] (SEQ ID NO. 3) and GLhyp-R, 5'-TGGTGAAGACCGGATCCTCAGATATGGCTGTTTGATATC-3' (SEQ ID NO. 4), GLp450-1-F, 5'-CACCAGAAAACAATCTCGAGATGCTTTCGGAAGTTATTG-3' (SEQ ID NO.5) and GLp450-1-R, 5'-GAGTGGTGAAGACCGTCGACTCACACCTTTCGTCTTTTC-3' (SEQ ID NO.6), GLp450-2-F, 5'-TCACCAGAAAACAATCTCGAGATGATTGCGGCACTCTTTAC-3' (SEQ ID NO.7) and GLp450-2-R, 5'-TGAGTGGTGAAGACCTCTAGACTACCTCTTGCCAACTGAC-3' (SEQ ID NO.8); GLcs-F, 5'-TCACCAGAAAACAATCTCGAGATGTCTACATTTGGAGATTTC-3' (SEQ ID NO.9) and GLcs-R, 5'-GTGGTGAAGACCGTCGACCTATGGTCCATCCTCTAC-3' (SEQ ID NO.10) were used to amplify the genes GLhyd, GLp450-1, GLp450-2, GLcs and GLhyp by PCR. The vector plasmid pGB114 was linearized using HindIII / MreI. The amplified gene and the linearized vector were then assembled using the Gibson method (Gibson DG, Young L, Chuang RY, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. NatMeth, 2009, 6(5):343–345.) to obtain the corresponding gene overexpression vectors pYX33 (ablated using primers SEQ ID NO:1 and SEQ ID NO:2), pYX34 (ablated using primers SEQ ID NO:3 and SEQ ID NO:4), pYX35 (ablated using primers SEQ ID NO:5 and SEQ ID NO:6), pYX37 (ablated using primers SEQ ID NO:7 and SEQ ID NO:8), and pYX41 (ablated using primers SEQ ID NO:9 and SEQ ID NO:10). The constructed vectors were validated by first-generation sequencing, and the results showed that the vectors were successfully constructed.

[0075] 1.2 Construction of Gene Combination Overexpression Plasmids

[0076] The construction procedure of the GLhyp and GLcs co-overexpression plasmid is as follows. Using plasmid pYX41 as a template, PCR amplification of PglgpdA-GLhyp-TglgpdA was performed using the upstream primer V-PglgpdA-F, 5'-CAATATCATCTTCTGGCTAGCAAGTCAGATAAAAGGCGTG-3' (SEQ ID NO.11) and the downstream primer TglgpdA-PR, 5'-CCTTTTATCTGACTTTCTAGAGTGAGTCGATGGCGAAATCG-3' (SEQ ID NO.12). The plasmid pYX37 was linearized using the XbaI restriction site. The GLhyp and GLcs co-overexpression vector pYX46 was obtained via Gibson assembly. The constructed vector was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0077] The construction procedure for the combined overexpression plasmids of GLhyp, GLcs, and GLhyd is as follows. Using plasmid pYX33 as a template, the upstream primer T-PglgpdA-F, 5'-TTCGCCATCGACTCACTCTAGAAAGTCAGATAAAAGGCGTG-3' (SEQ ID NO. 13) and the downstream primer TglgpdA-VR, 5'-CGATTTCGCCATCGACTCACGACGTCTTTCCATAGGCTCCGCC-3' were used.

[0078] (SEQ ID NO.14) PCR amplification of PglgpdA-GLhyd-TglgpdA was performed, and plasmid pYX46 was linearized by selecting the SpeI restriction site. The combined overexpression vector pYX47 of GLhyp, GLcs, and GLhyd was obtained by Gibson assembly. The constructed vector was verified by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0079] The construction procedure of the combined overexpression plasmid of GLhyp, GLcs, and GLp450-2 is as follows. Using plasmid pYX35 as a template, PCR amplification of PglgpdA-GLp450-2-TglgpdA was performed using the upstream primer T-PglgpdA-F, 5'-TTCGCCATCGACTCACTCTAGAAAGTCAGATAAAAGGCGTG-3' (SEQ ID NO. 13) and the downstream primer TglgpdA-VR, 5'-CGATTTCGCCATCGACTCACGACGTCTTTCCATAGGCTCCGCC-3' (SEQ ID NO. 14). Plasmid pYX46 was linearized using the SpeI restriction site. The combined overexpression vector pYX48 of GLhyp, GLcs, and GLp450-2 was obtained via Gibson assembly. The constructed vector was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0080] The construction procedure for the combined overexpression plasmids of GLhyp, GLcs, GLp450-1, and GLp450-2 is as follows. Using plasmid pYX34 as a template, PCR amplification of PglgpdA-GLp450-1-TglgpdA was performed using the upstream primer T-PglgpdA-F, 5'-TTCGCCATCGACTCACTCTAGAAAGTCAGATAAAAGGCGTG-3' (SEQ ID NO.13) and the downstream primer TglgpdA-PR, 5'-CCTTTTATCTGACTTTCTAGAGTGAGTCGATGGCGAAATCG-3' (SEQ ID NO.12). The plasmid pYX48 was linearized using the NotI restriction site. The combined overexpression vector pYX50 for GLhyp, GLcs, and GLp450-2 was obtained via Gibson assembly. The constructed vector was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0081] The construction process of the combined overexpression plasmids of GLhyp, GLcs, GLp450-1, GLp450-2, and GLhyd is as follows. Using plasmid pYX33 as a template, PglgpdA-GLhyd-TglgpdA was amplified using the upstream primer T-PglgpdA-F, 5'-TTCGCCATCGACTCACTCTAGAAAGTCAGATAAAAGGCGTG-3' (SEQ ID NO.13) and the downstream primer TglgpdA-VR, 5'-CGATTTCGCCATCGACTCACGACGTCTTTCCATAGGCTCCGCC-3' (SEQ ID NO.14). The plasmid pYX50 was linearized using the PacI restriction site. The combined overexpression vector pYX51 of GLhyp, GLcs, and GLp450-2 was obtained via Gibson assembly. The constructed vector was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0082] Example 2 Construction of the knockout vector

[0083] Gene knockout was performed using the CRISPR / Cas genetic operating system. The sgRNA expression cassette was inserted into a vector plasmid containing the cas9 gene, hygromycin gene, and fungal replication element using T4 ligase. Using the genome of *G. lozoyensis* Z00 as a template, the 5S rRNA promoter was amplified by PCR using the upstream primer 5S-F, 5'-AACGGTGAGAGTCCAGGATCCGCTTCATTTGATCGATGTTC-3' (SEQ ID NO.15) and the downstream primer GLpyrE-N20-R, 5'-ACCAAGTACAGCGTCACTGGTACATACGACAGTAGGTATTC-3' (SEQ ID NO.16). Using plasmid pSC249 as a template, PCR amplification of the sgRNA and the U6 terminator fragment GLpyrE sgRNA-U6ter was performed using the upstream primer GLpyrE-N20-F, 5'-TGTACCAGTGACGCTGTACTTGGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO.17) and the downstream primer U6ter-R, 5'-ATCCAGATCGCGGCCGCGCTAGCAGCAGCTCTATATCACGTG-3' (SEQ ID NO.18). The two fragments were then assembled using OE-PCR to obtain the sgRNA expression cassette p5SRNA-GLpyrE sgRNA-U6ter. The expression cassette and vector plasmid pSC251 were linearized using BamHI / NotI, and the GLpyrE knockout vector pYX38 was obtained using T4 ligase. The vector construction was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0084] Following the above procedure, a vector for knocking out GL6ma was constructed. Using the genome of *G. lozoyensis* Z00 as a template, the 5S rRNA promoter was amplified by PCR using the upstream primer 5S-F, 5'-AACGGTGAGAGTCCAGGATCCGCTTCATTTGATCGATGTTC-3' (SEQ ID NO. 15) and the downstream primer GL6ma-N20-R, 5'-ACGCGAGACTCTGGGGTGGGATCATACGACAGTAGGTATTC-3' (SEQ ID NO. 19). Using plasmid pSC249 as a template, the upstream primer GL6ma-N20-F, 5'-TGATCCCACCCCAGAGTCTCGCGTTTTAGAGCTAGAAATAGC-3' was used.

[0085] The sgRNA and the U6 terminator fragment GL6ma sgRNA-U6ter were amplified by PCR using primers (SEQ ID NO.20) and the downstream primer U6ter-R, 5'-ATCCAGATCGCGGCCGCGCTAGCAGCAGCTCTATATCACGTG-3' (SEQ ID NO.18). The two fragments were then assembled using OE-PCR to obtain the sgRNA expression cassette p5SRNA-GL6ma sgRNA-U6ter. The expression cassette and vector plasmid pSC251 were linearized using BamHI / NotI, and the GL6ma knockout vector pYX39 was obtained using T4 ligase. The vector construction was validated by first-generation sequencing, indicating successful construction.

[0086] The vector construction procedure for simultaneously knocking out GLpyrE and GL6ma is as follows. Using the G. lozoyensis Z00 genome as a template, the 5S rRNA promoter was amplified by PCR using the upstream primer 5S-F, 5'-AACGGTGAGAGTCCAGGATCCGCTTCATTTGATCGATGTTC-3' (SEQ ID NO.15) and the downstream primer GLpyrE-N20-R, 5'-ACCAAGTACAGCGTCACTGGTACATACGACAGTAGGTATTC-3' (SEQ ID NO.16). Using plasmid pSC249 as a template, PCR amplification of sgRNA and the U6 terminator fragment GLpyrE sgRNA-U6ter2 was performed using upstream primer GLpyrE-N20-F, 5'-TGTACCAGTGACGCTGTACTTGGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO.17) and downstream primer U6ter-R2, 5'-TCGATCAAATGAAGCTCTAGAAGCAGCTCTATATCACGTG-3' (SEQ ID NO.21). The two fragments were then assembled using OE-PCR to obtain the sgRNA expression cassette p5S RNA-GLpyrE sgRNA-U6ter-NdeI. Using the genome of G. lozoyensis Z00 as a template, the NdeI-5S rRNA promoter was amplified by PCR using the upstream primer 5S-F2, 5'-TGATATAGAGCTGCTTCTAGAGCTTCATTTGATCGATGTTC-3' (SEQ ID NO.22) and the downstream primer GL6ma-N20-R, 5'-ACGCGAGACTCTGGGGTGGGATCATACGACAGTAGGTATTC-3' (SEQ ID NO.19). Using plasmid pSC249 as a template, PCR amplification of the sgRNA and the U6 terminator fragment GL6ma sgRNA-U6ter was performed using the upstream primer GL6ma-N20-F, 5'-GATCCCACCCCAGAGTCTCGCGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO. 20) and the downstream primer U6ter-R, 5'-ATCCAGATCGCGGCCGCGCTAGCAGCAGCTCTATATCACGTG-3' (SEQ ID NO. 18). The two fragments were then assembled using OE-PCR to obtain the sgRNA expression cassette NdeI-p5SRNA-GL6ma sgRNA-U6ter.BamHI / NdeI was used to treat p5S RNA-GLpyrE sgRNA-U6ter-NdeI, and NdeI / NotI was used to treat NdeI-p5S RNA-GL6ma sgRNA-U6ter. The BamHI / NotI vector plasmid pSC251 was linearized, and the GLpyrE and GL6ma knockout vector pYX44 was obtained by T4 ligase reaction. The constructed vector was validated by first-generation sequencing, and the results showed that the vector was successfully constructed.

[0087] Example 3 Construction of gene overexpression strains

[0088] 3.1 Protoplast transformation of G. Lozoyensis

[0089] The *G. lozoyensis* culture medium was inoculated onto PDA solid medium, which consisted of 26 g / L potato dextrose solution (Qingdao Haibo) and 1.6% agar powder, and sterilized at 115°C for 30 min. After inoculation, the medium was incubated at 25°C for 5 days. Mycelia were then collected and placed in 50 ml of PDB liquid medium, and cultured at 25°C and 180 rpm for 6 days. The culture was transferred to sterile 50 mL centrifuge tubes, centrifuged at 8000 rpm for 10 min to collect the mycelia. The supernatant was discarded, and 30 mL of a mixed enzymatic hydrolysate containing 20 g / L yatalase, 30 g / L lysing enzymes, and 10 g / L snailase was added. The mixture was then incubated at 30°C and lysed at 80 rpm for 3.5 h. The protoplasts were then collected by filtration through four layers of gauze. The protoplast suspension was washed with sorbitol buffer (1.2M sorbitol, 10mM CaCl2, 10mM Tris-HCl, pH 7.5) to adjust the protoplast count to 1×10⁻⁶. 7 per mL. Mix 200 μL of protoplast suspension with 50 μL of pre-chilled polyethylene glycol buffer (40% PEG6000, 100 mM CaCl2, 50 mM Tris-HCl, pH 7.5) and 5 μg of the constructed overexpression plasmid in a pre-chilled 15 mL centrifuge tube. After incubating on ice for 20 min, add 2 mL of polyethylene glycol buffer and mix thoroughly, then incubate statically at 25 °C for 5 min. Finally, add 4 mL of sorbitol buffer, spread on PDA solid medium containing 1 M sorbitol and 200 μg / mL hygromycin B, and incubate at 25 °C.

[0090] 3.2 Screening of correct transformants of G. lozoyensis

[0091] Transformants of *G. lozoyensis* were selected and cultured on PDA solid medium (containing 200 μg / mL hygromycin B) for 6 days. Afterward, mycelia were scraped to extract the genome for verification. The genome extraction procedure was as follows: Mycelia were scraped into 300 μL of lysis buffer (400 mM Tris-HCl, pH 7.5; 50 mM EDTA, pH 7.5; 150 mM NaCl; 1% SDS) and incubated at room temperature for 10 min. 150 μL of potassium acetate solution (60 mL 5 M potassium acetate, 11.5 mL glacial acetic acid, 28.5 mL distilled water) was added, and the mixture was vortexed for 2 min, followed by centrifugation at 12000 g for 2 min. The supernatant was collected and added to an equal volume of isopropanol, mixed by inversion, centrifuged at 12000 g for 2 min, the supernatant was discarded, and the genome was washed twice with 75% ethanol. After the ethanol evaporated, appropriate amounts of distilled water were added to dissolve the genome. Using the corresponding gene-specific verification primers, PCR identification was performed with the transformant genome as a template. Correctly overexpressing strains will show corresponding bands during agarose gel electrophoresis.

[0092] Specifically: Primer pairs YZ-GLhyd-F, 5'-CCAATATTAATTCAACGACACCAC-3' (SEQ ID NO. 23) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO. 24) were used to verify the overexpression of the GLhyd gene, with a correct electrophoretic band size of 1445 bp. Primer pairs YZ-GLp450-1-F, 5'-TGCTTTCGGAAGTTATTGCAC-3' (SEQ ID NO. 25) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO. 24) were used to verify the overexpression of the GLp450-1 gene, with a correct electrophoretic band size of 2240 bp. Primer pairs YZ-GLp450-2-F, 5'-ATGATTGCGGCACTCTTTAC-3' (SEQ ID NO. 25) were used to verify the overexpression of the GLp450-1 gene, with a correct electrophoretic band size of 2240 bp. Overexpression of the GLp450-2 gene was verified using primers YZ-GLcs-F, 5'-CATTTGGAGATTTCTTCAAGGTC-3' (SEQ ID NO.26) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO.24), with a correct electrophoretic band size of 2167 bp. Overexpression of the GLcs gene was verified using primers YZ-GLhyp-F, 5'-GGACCTTTTCCAAAGCCCTG-3' (SEQ ID NO.28) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO.24), with a correct electrophoretic band size of 1798 bp. Overexpression of the GLcs gene was verified using primers YZ-GLhyp-F, 5'-GGACCTTTTCCAAAGCCCTG-3' (SEQ ID NO.28) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO.26) and YZ-TglgpdA-R, 5'-CGATTTCGCCATCGACTCAC-3' (SEQ ID NO.24), with a correct electrophoretic band size of 1798 bp. NO.24) Verify the overexpression of the GLhyp gene; the correct electrophoretic band size is 2865bp.

[0093] Example 4: Construction of gene knockout strains

[0094] Following the protoplast transformation protocol for *G. lozoyensis*, 200 μL of the prepared protoplast suspension was mixed with 50 μL of pre-chilled polyethylene glycol buffer (40% PEG6000, 100 mM CaCl2, 50 mM Tris-HCl, pH 7.5) and 5 μg of the constructed knockout plasmid in a pre-chilled 15 mL centrifuge tube. After incubating on ice for 20 minutes, 2 mL of polyethylene glycol buffer was added and mixed thoroughly, followed by static incubation at 25°C for 5 minutes. Finally, 4 mL of sorbitol buffer was added, and the mixture was spread on PDA medium containing 1 M sorbitol and 150 μg / mL G418, and incubated at 25°C. *G. lozoyensis* transformants were picked and expanded on PDA solid medium (containing 150 μg / mL G418). After 6 days of culture, mycelia were scraped to extract the genome for verification.

[0095] The knockout of the GL6ma gene was verified using primer pairs YZ-GL6ma-F, 5'-GGTAACACTACAGAGCGAGATTG-3' (SEQ ID NO.29) and YZ-GL6ma-R, 5'-GGCAGGAGCAGGAACAGATTC-3' (SEQ ID NO.30), with a correct electrophoretic band size of 953 bp. The knockout of the GLpyrE gene was verified using primer pairs YZ-GLpyrE-F, 5'-GCTTGGCTTGAAGTCTGAGTAAAAG-3' (SEQ ID NO.31) and YZ-GLpyrE-R, 5'-AGGAGGCTGAGGCTATGGATC-3' (SEQ ID NO.32), with a correct electrophoretic band size of 861 bp.

[0096] Example 5: Construction of gene overexpression and knockout combo strains

[0097] Following the protoplast transformation protocol for *G. lozoyensis*, 5 μg of the constructed knockout plasmid and overexpression plasmid were mixed with 200 μL of prepared protoplast suspension and 50 μL of pre-chilled polyethylene glycol buffer (40% PEG6000, 100 mM CaCl2, 50 mM Tris-HCl, pH 7.5) in pre-chilled 15 mL centrifuge tubes. After incubating on ice for 20 minutes, 2 mL of polyethylene glycol buffer was added and mixed thoroughly, followed by static incubation at 25°C for 5 minutes. Finally, 4 mL of sorbitol buffer was added, and the mixture was spread on PDA medium containing 1 M sorbitol, 150 μg / mL G418, and 200 μg / mL hygromycin B, and incubated at 25°C. *G. lozoyensis* transformants were picked and expanded on PDA solid medium (containing 150 μg / mL G418). After 6 days of culture, mycelia were scraped to extract the genome for verification. The corresponding validation primers for knockout and overexpression genes are as described above.

[0098] The overexpression strains, knockout strains, and gene overexpression and knockout combination strains constructed using the methods in Examples 3-5 are shown in Table 1. Z00 is the starting strain of this invention, which is obtained by mutating G. lozoyensis ATCC 74030. Z11 is a strain prepared by overexpressing the GLhyd gene from the starting strain; Z12 is a strain prepared by overexpressing the GLp450-1 gene from the starting strain; Z13 is a strain prepared by overexpressing the GLp450-2 gene from the starting strain; Z15 ​​is a strain prepared by overexpressing the GLcs gene from the starting strain; Z16 is a strain prepared by knocking out the GLpyrE gene from the starting strain; Z17 is a strain prepared by knocking out the GL6ma gene from the starting strain; Z18 is a strain prepared by overexpressing the GLhyp gene from the starting strain; Z21 is a strain prepared by knocking out both the GLpyrE and GL6ma genes from the starting strain; Z23 is a strain prepared by overexpressing both the GLhyp and GLcs genes from the starting strain; Z24 is a strain prepared by overexpressing the GLhyp, GLhyd, and GLcs genes from the starting strain; and Z26 is a strain prepared by overexpressing the GLhyp, GLp450-2, and GLcs genes from the starting strain. Strain Z28 is a strain prepared from the starting strain by overexpressing the GLhyp, GLp450-1, GLp450-2, and GLcs genes; Z29 is a strain prepared from the starting strain by overexpressing the GLhyp, GLhyd, GLp450-1, GLp450-2, and GLcs genes; Z32 is a strain prepared from strain Z21 by overexpressing the GLhyp and GLcs genes; and Z33 is a strain prepared from strain Z21 by overexpressing the GLhyp and GLhyd genes. Z35 is a strain prepared by overexpressing the GLhyp, GLp450-2, and GLcs genes from strain Z21; Z37 is a strain prepared by overexpressing the GLhyp, GLp450-1, GLp450-2, and GLcs genes from strain Z21; and Z38 is a strain prepared by overexpressing the GLhyp, GLhyd, GLp450-1, GLp450-2, and GLcs genes from strain Z21.

[0099] Table 1: Strains used in this patent and their sources

[0100]

[0101] The preservation information for the relevant G. lozoyensis strains in this application is as follows:

[0102] G. lozoyensis Z00 was deposited at the China Center for Type Culture Collection (CCTCC) on November 11, 2024, accession number: CCTCC NO: M20242524;

[0103] G. lozoyensis Z26 was deposited at the China Center for Type Culture Collection (CCTCC) on November 11, 2024, accession number: CCTCC NO: M20242525;

[0104] G. lozoyensis Z29 was deposited at the China Center for Type Culture Collection (CCTCC) on November 11, 2024, accession number: CCTCC NO: M20242526;

[0105] G. lozoyensis Z33 was deposited at the China Center for Type Culture Collection (CCTCC) on November 11, 2024, accession number: CCTCC NO: M20242527;

[0106] G. lozoyensis Z38 was deposited at the China Center for Type Culture Collection (CCTCC) on November 11, 2024, accession number: CCTCC NO: M20242528.

[0107] Example 6: Fermentation and Product Detection of Mutant Strains

[0108] The concentration of PB0 was determined by high-performance liquid chromatography (HPLC). 3 mL of fermentation broth was mixed with 5 mL of ethanol, sonicated for 30 min, and then centrifuged at 3200 g for 15 min. A 3 g / L standard solution of PB0 was prepared and subsequently diluted to 2.5 g / L, 2 g / L, 1.5 g / L, and 1 g / L. Yield analysis was performed by HPLC using an ODS C18 HPLC column (4.6 × 250 mm, 5 μm, Agela, Tianjin). The mobile phase was a mixture of 57% water and 43% acetonitrile (v / v), the flow rate was 1.0 mL / min, and isocratic elution was performed for 20 min. The yield of PB0 in each strain was detected at 220 nm. Results are shown below. Figure 1-3 As shown. Figure 1 The statistical results of PB0 yield after shake-flask fermentation of the gene-overexpressing strains are shown. Each strain underwent fermentation in triplicate, and the average value was taken. Statistical analysis was performed using a t-test, and P < 0.05. Z11 =0.0016, P Z12 =0.2675, P Z13 =0.0007, P Z15 =0.0108, P Z18 =0.0015, P Z23 <0.0001, P Z24 <0.0001, P Z26 <0.0001, P Z28 =0.0003, P Z29 =0.0021. Figure 2This presents the statistical results of PB0 yield after shake-flask fermentation of gene knockout strains. Each strain underwent fermentation in triplicate, and the average value was taken. Statistical analysis was performed using a t-test, with P < 0.05. Z16 =0.0163, P Z17 =0.0007, P Z21 <0.0001. Figure 3 Shake-flask fermentation results of metabolically engineered strains with gene overexpression and knockout combinations are shown. Three replicates were performed for each strain, and the average value was taken. Statistical analysis was performed using a t-test; P < 0.05. Z32 <0.0001, P Z33 =0.0002, P Z35 =0.0006, P Z37 =0.0003, P Z38 <0.0001. It can be seen that, compared with the original strain Z00, both the overexpressing and knockout strains showed increased PB0 production. Furthermore, the Z33 strain, which knocked out GLpyrE and GL6ma and overexpressed GLcs, GLhyp, and GLhyd, achieved a 108.7% increase in PB0 production compared to the original strain, reaching 2.63 g / L (see [link to original text]). Figure 3 ).

[0109] Table 2: Plasmids used in this application

[0110]

[0111]

[0112] Table 3: Primer names and sequences used in this application

[0113]

[0114] The genomic DNA sequences of the relevant genes in the G. Lozoyensis Z00 strain are as follows:

[0115] GLhyd

[0116] ATGGATCAAAATCCAATATTAATTCAACGACACCACCATCGCCAGAATTTCGCACAGAAGGCACCTCCAGCGCCCTTGTTTCTGATACATGATGGAGGCGGAACAGTTTTCTCCTACTTTCTTCTAGAATCACTTGGGCGTACTGTCTACGGAATCTCCAATCCAAATTTCGAAACTGAGTCAACATGGGAAAATGGCATTGCGAGCATGGCGGAATACTACGTCAATTTGATCAAAGCTACTTATCCTTCAGGCCACATACTTCTAGGTGGTAAGCCAAAGTCATTTCCTGGTTTTACAAAATTTGAAGCTGACGCTTTTCCTAGGCTGGTCTCTCGGTGGTCTTATCGCTATCCAAGCGGCACACATTCTCTCCAATGATCCCGAACTGAAAGTTGTTGGTATCGTTATGATAGATAGCACATTTCCTGTAGAAGGGCAATTCAATAAGGCGCGCAGACTTGCGTTCATGGCAGAAACATCTACAAGTCCAGACATGAAAGAGAAGACAAGAAAGTGTATGGATGAGGCTCGAATACAAAGCAGAGAATGGAAGGCTCCATCCTGGCGGAGTTCTGCTACTGAGACCCTGGATAATCATAGCCAGACTATCAATGTGCAGATCCATGATCATGTAACGCCTACGTGCCCTCCTACAGTACTAATTCGGGCCCTTGACGACGGCTCTAATAACAGTCGAGATTTGAATGAAACGTCTCCTACGGAGACATCCAACGACAGTGAAACGCAAGCGTTAGGGTTCGACAGATATCAGAACTTCAACTTGCGATATGTAGTGAATACTCCAGGTGACCATTTCAGTATTTTCAACAAGGAAAACGTAAGCAGAAAGATTCTCACATTAACAGAACTACGAGATCTAATAGTAGTTTTATAGGTTAAGGAGCTGAGCAAAAAAGTCAAAGAGGCATGCGATAAGCTTGTAATGAAGTCCTAG(SEQ ID NO:33)

[0117] GLhyp

[0118]

[0119] GLcs

[0120]

[0121] GLp450-1

[0122]

[0123] GLp450-2

[0124]

[0125] GL6ma

[0126]

[0127] GLpyrE

[0128]

[0129] Equivalent scheme

[0130] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0131] References

[0132] (1) Li, P.; Tedersoo, L.; Crowther, TW; Wang, B.; Shi, Y.; Kuang, L.; Li, T.; Wu, M.; Liu, M.; Luan, L.; Liu, J.; Li, D.; Li, Y.; Wang, S.; Saleem, M.; Dumbrell, AJ; Li, Z.; Jiang, J. Biogeography of Potential PhytopathogenicFungiin a Changing World. Nat Commun 2023,14(1),6482.https: / / doi.org / 10.1038 / s41467-023-42142-4.

[0133] (2)WHO fungal priority pathogens list to guide research, development and public health action. https: / / www.who.int / publications-detail-redirect / 9789240060241(accessed 2023-05-07).

[0134] (3)Hu, X.; Yang, P.; Chai, C.; Liu, J.; Sun, H.; Wu, Y.; Zhang, M.; Zhang, M.; Liu, X.; 2023,616(7955),190–198. https: / / doi.org / 10.1038 / s41586-023-05856-5.

[0135] (4)Qin,T.;Song,P.;Wang,X.;Ji,X.;Ren,L.;Huang,H.Protoplast MutantSelection of Glarea Lozoyensis and Statistical Optimization of Medium forPneumocandin B0 Yield-Up.Biosci Biotechnol Biochem 2016,80(11),2241–2246.https: / / doi.org / 10.1080 / 09168451.2016.1196575.

[0136] (5)Yuan,K.;Huang,B.;Qin,T.;Song,P.;Zhang,K.;Ji,X.;Ren,L.;Zhang,S.;Huang,H.Effect of SDS on Release of Intracellular Pneumocandin B0 inExtractive Batch Fermentation of Glarea Lozoyensis.Appl Microbiol Biotechnol2019,103(15),6061–6069.https: / / doi.org / 10.1007 / s00253-019-09920-x.

[0137] (6)Chen,L.;Yue,Q.;Zhang,X.;Xiang,M.;Wang,C.;Li,S.;Che,Y.;Ortiz-López,F.J.;Bills,G.F.;Liu,X.;An,Z.Genomics-Driven Discovery of the PneumocandinBiosynthetic Gene Cluster in the Fungus Glarea Lozoyensis.BMC Genomics 2013,14,339.https: / / doi.org / 10.1186 / 1471-2164-14-339.

[0138] (7)Chen,L.;Yue,Q.;Li,Y.;Niu,X.;Xiang,M.;Wang,W.;Bills,G.F.;Liu,X.;An,Z.Engineering of Glarea Lozoyensis for Exclusive Production of thePneumocandin B0 Precursorof the Antifungal Drug Caspofungin Acetate.ApplEnviron Microbiol 2015,81(5),1550–1558.https: / / doi.org / 10.1128 / aem.03256-14.

[0139] (8)Wei,T.-Y.;Wu,Y.-J.;Xie,Q.-P.;Tang,J.-W.;Yu,Z.-T.;Yang,S.-B.;Chen,S.-X.CRISPR / Cas9-Based Genome Editing in the Filamentous Fungus GlareaLozoyensis and Its Application in Manipulating gloF.ACS Synth.Biol.2020,9(8),1968–1977.https: / / doi.org / 10.1021 / acssynbio.9b00491.

[0140] (9)Dong,Y.;Zhang,L.;Zhang,W.;Cao,J.;Wei,Y.;Song,P.;Xu,Q.Glyap1Regulates Pneumocandin B0 Synthesis by Controlling the Intracellular RedoxBalance in Glarea Lozoyensis.Appl Microbiol Biotechnol 2021,105(18),6707–6718.https: / / doi.org / 10.1007 / s00253-021-11522-5.

[0141] (10)Men,P.;Zhou,Y.;Xie,L.;Zhang,X.;Zhang,W.;Huang,X.;Lu,X.Improvingthe Production of the Micafungin Precursor FR901379 in an IndustrialProduction Strain.Microb Cell Fact 2023,22,44.https: / / doi.org / 10.1186 / s12934-023-02050-0.

[0142] (11)Choi,K.R.;Jang,W.D.;Yang,D.;Cho,J.S.;Park,D.;Lee,S.Y.SystemsMetabolic Engineering Strategies:Integrating Systems and Synthetic Biologywith Metabolic Engineering.Trends in Biotechnology 2019,37(8),817–837.https: / / doi.org / 10.1016 / j.tibtech.2019.01.003.

[0143] (12)Bian,G.;Deng,Z.;Liu,T.Strategies for Terpenoid Overproduction andNew Terpenoid Discovery.Current Opinion in Biotechnology 2017,48,234–241.https: / / doi.org / 10.1016 / j.copbio.2017.07.002.

[0144] (13)Lyu,Z.-Y.;Bu,Q.-T.;Fang,J.-L.;Zhu,C.-Y.;Xu,W.-F.;Ma,L.;Gao,W.-L.;Chen,X.-A.;Li,Y.-Q.Improving the Yield and Quality of Daptomycin inStreptomyces Roseosporus by Multilevel Metabolic Engineering.Front Microbiol2022,13,872397.https: / / doi.org / 10.3389 / fmicb.2022.872397.

[0145] (14)Li,L.;Zhao,Y.;Ruan,L.;Yang,S.;Ge,M.;Jiang,W.;Lu,Y.A StepwiseIncrease in Pristinamycin II Biosynthesis by Streptomyces Pristinaespiralisthrough Combinatorial Metabolic Engineering.Metabolic Engineering 2015,29,12–25.https: / / doi.org / 10.1016 / j.ymben.2015.02.001.

[0146] (15)Bian,G.;Han,Y.;Hou,A.;Yuan,Y.;Liu,X.;Deng,Z.;Liu,T.Releasing thePotential Power of Terpene Synthases by a Robust Precursor SupplyPlatform.Metabolic Engineering 2017,42,1–8.https: / / doi.org / 10.1016 / j.ymben.2017.04.006.

[0147] (16)Yuan,Y.;Cheng,S.;Bian,G.;Yan,P.;Ma,Z.;Dai,W.;Chen,R.;Fu,S.;Huang,H.;Chi,H.;Cai,Y.;Deng,Z.;Liu,T.Efficient Exploration of TerpenoidBiosynthetic Gene Clusters in Filamentous Fungi.Nat Catal 2022,5(4),277–287.https: / / doi.org / 10.1038 / s41929-022-00762-x。

Claims

1. A genetically engineered bacterium, which, compared with a starting strain, includes the following gene modifications in its genome: overexpression of the GLcs gene and overexpression of the GLhyd gene, wherein the starting strain is a filamentous fungus *G. lozoyensis* strain deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20242524, wherein the engineered bacterium has an increased yield of nimocontin B0 compared with the starting strain.

2. The genetically engineered bacteria according to claim 1, wherein the genetically engineered bacteria further comprises one or more gene modifications selected from the following: knockout of the GL6ma gene, knockout of the GLpyrE gene, overexpression of the GLp450-1 gene, overexpression of the GLp450-2 gene, and overexpression of the GLhyp gene.

3. The genetically engineered bacteria according to claim 2, wherein the genetically engineered bacteria, compared with the starting strain, includes overexpression of the GLcs gene, overexpression of the GLhyd gene, and overexpression of the GLp450-2 gene.

4. The genetically engineered bacteria according to claim 2, wherein the genetically engineered bacteria, compared with the starting strain, includes overexpression of the GLcs gene, overexpression of the GLhyd gene, knockout of the GL6ma gene, knockout of the GLpyrE gene, and overexpression of the GLhyp gene.

5. The genetically engineered bacteria according to any one of claims 1-4, wherein the yield of nimocontin BO in the genetically engineered bacteria is increased by 40%, 50%, 60%, 70%, 80%, 90%, or 100% or more, preferably by more than 100%, compared with the starting strain.

6. The genetically engineered bacteria according to any one of claims 1-5, wherein the genetically engineered bacteria are deposited at the China Center for Type Culture Collection (CCTCC) with accession numbers CCTCC NO:M20242525, CCTCC NO:M 20242526, CCTCC NO:M 20242527 and CCTCC NO:M 20242528.

7. The method for preparing genetically engineered bacteria according to any one of claims 1-6, comprising the following steps: 1) Construct overexpression vectors of single genes or combined gene overexpression vectors of two or more genes selected from GLcs, GLhyd, GLp450-1, GLp450-2 and GLhyp. 2) Construct knockout vectors of a single gene selected from GL6ma and GLpyrE or combined gene knockout vectors of two genes. 3) Transform the starting strain described in claim 1 using the overexpression vector of step 1) and the knockout vector of step 2), respectively or in combination, preferably by the polyethylene glycol method; 4) Screen for strains that have been correctly transformed and have increased yields of nimocontin B0 compared to the starting strain.

8. The method according to claim 7, wherein the overexpression vector and the knockout vector are respectively constructed in plasmids.

9. Use of the genetically engineered bacteria according to any one of claims 1-6 in the preparation of Numocontin BO.

10. A method for preparing Numocodin B0, comprising culturing the genetically engineered bacteria according to any one of claims 1-6 or the genetically engineered bacteria prepared by the method of claim 7 under conditions suitable for producing Numocodin B0, and isolating Numocodin B0.