Methods for constructing recombinant genetic transformation vectors of the ALMT10 gene to enhance PFOA uptake and accumulation in plants

By constructing a recombinant genetic transformation vector of the ALMT10 gene and utilizing the transmembrane transport function of the ALMT10 protein, the problem of low phytoremediation efficiency in PFOA-contaminated soil was solved, enabling lettuce to efficiently absorb and accumulate PFOA, thereby reducing the PFOA content in crops.

CN122168629APending Publication Date: 2026-06-09JINAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610586216.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-29
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively remediate PFOA-contaminated soil. Traditional microbial remediation methods are inefficient, and phytoremediation technologies lack the ability to significantly accumulate PFOA, resulting in high risks to the safety of agricultural products for consumption.

Method used

A recombinant genetic transformation vector for the ALMT10 gene was constructed. By regulating protoplast segregation and transient gene expression in lettuce, the absorption and accumulation of PFOA in plants were increased, utilizing the transmembrane transport function of the ALMT10 protein.

Benefits of technology

This technology enables lettuce to efficiently absorb and accumulate PFOA, providing an efficient phytoremediation system that reduces the risk of PFOA accumulation in crops and improves food safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168629A_ABST
    Figure CN122168629A_ABST
Patent Text Reader

Abstract

This invention relates to the field of agricultural environmental pollutant control technology, and more specifically, to a method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase the absorption and accumulation of emerging persistent organic pollutants (PFOA) in plants. The nucleotide sequence of the ALMT10 gene is shown in SEQ ID NO.1, and the ALMT10 gene can promote the absorption of PFOA by plants. Adding malic acid, the specific transporter of the protein encoded by the key gene ALMT10, can further activate ALMT10 expression and promote the absorption and accumulation of PFOA in crops, thereby achieving efficient enrichment and remediation of PFOA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural environmental pollutant control technology, and more specifically, to a method for constructing a recombinant genetic transformation vector of the ALMT10 gene to enhance the absorption and accumulation of PFOA in plants. Background Technology

[0002] Perfluoroalkyl acids (PFAAs), due to their unique hydrophobic and oleophobic properties and extreme chemical stability, are widely used in various commercial products and industrial fields. However, this also leads to their large-scale release into the environment, making them a globally significant emerging persistent organic pollutant. PFAAs have half-lives in the human body that can last for years or even more than 10 years, causing various toxic effects and even inducing cancer. PFAAs can enter farmland soil in large quantities through various pathways, including atmospheric dry and wet deposition, agricultural use of sewage sludge, surface runoff, and groundwater infiltration. It is important to note that PFAAs, especially their representative compound perfluorooctanoic acid (PFOA), have a unique anionic structure and high water solubility, making them easily absorbed and accumulated by crops, particularly leafy vegetables. Consuming crops has become one of the important pathways for human exposure to ionic PFOA and other compounds. Worryingly, due to the lowering of reference dose levels, crops previously considered low-risk actually pose a higher risk of food safety. Among these pathways, the accumulation of PFOA from soil by crops has become one of the main routes of human exposure to this compound.

[0003] Perfluorooctanoic acid (PFOA), a typical perfluorinated compound, has extremely high carbon-fluorine bond energies in its molecular structure, making it difficult to decompose effectively through biological or chemical pathways in the natural environment. Therefore, it persists in soil (and is even considered a permanent compound), posing a long-term threat to ecosystems and human health. Currently, remediation technologies for PFOA-contaminated soil still face significant challenges: while traditional microbial remediation methods are widely used in the treatment of organic pollutants, there is a lack of microbial strains capable of efficiently degrading PFOA; the few reported anaerobic degrading bacteria are not only demanding in terms of conditions and limited in efficiency, but also difficult to adapt to actual soil environments, failing to meet the needs of engineered remediation. Meanwhile, although phytoremediation technology has achieved success in the remediation of heavy metal pollution, the lack of plant resources in nature with a significant capacity to accumulate PFOA has prevented this technology from achieving a breakthrough in the treatment of such organic pollutants. Therefore, developing a phytoremediation system capable of actively and efficiently absorbing and accumulating PFOA has become an urgent technological need to solve this soil pollution problem. Summary of the Invention

[0004] This invention provides a method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase the absorption of perfluorooctanoic acid (PFOA) in plants and their cells. It utilizes genetic engineering techniques to regulate the absorption and transport of PFOA by protoplast separation and transient gene expression in lettuce, thereby increasing its accumulation in lettuce or Arabidopsis thaliana.

[0005] In a first aspect, the present invention provides an application of the ALMT10 gene in the absorption and enrichment of PFOA in plants through multiple transmembrane structures. The nucleotide sequence of the ALMT10 gene is shown in SEQ ID NO.1, and the ALMT10 gene has the function of improving the enrichment of PFOA in plants.

[0006] Preferably, the amino acid sequence of the protein encoded by the ALMT10 gene is shown in SEQ ID NO.2.

[0007] Preferably, the AtALMT10 gene of the plant is amplified to obtain the complete gene sequence of the synthesized ALMT10 protein, and the complete gene sequence of the ALMT10 protein is used to absorb and enrich PFOA.

[0008] Preferably, the ALMT10 protein interacts with the PFOA and induces changes in the protein's secondary structure, thereby enabling the protein to transport PFOA across the membrane.

[0009] Preferably, the plant is a dicotyledonous plant, preferably lettuce or Arabidopsis thaliana.

[0010] Secondly, the present invention provides a method for constructing a recombinant genetic transformation vector of the ALMT10 gene to absorb perfluorooctanoic acid, comprising:

[0011] Obtain the gene sequence of the ALMT10 gene;

[0012] The gene sequence of the ALMT10 gene was identified and arranged to obtain candidate sgRNA target sites;

[0013] The off-target sites of the predicted candidate sgRNA target sites are calculated to obtain target sgRNA-1 and target sgRNA-2;

[0014] The target sgRNA-1 and target sgRNA-2 were amplified respectively to obtain the amplified products;

[0015] The amplified product was used to construct a vector to obtain a plasmid for the ALMT10 overexpression vector.

[0016] Preferably, the sequences of target sgRNA-1 and target sgRNA-2 are as follows:

[0017] Target sgRNA-1: 5'-AAGGCAACAGAAGTGGCTAA-3';

[0018] Target sgRNA-2: 5'-CATCCCTGAAACCTCAGAAC-3'.

[0019] Preferably, the plasmid of the ALMT10 overexpression vector is transformed into protoplasts or Arabidopsis plants and incubated with different concentrations of PFOA, namely 0.2, 0.5, 1, and 5 mg / L.

[0020] Preferably, both PFOA and malic acid can activate ALMT10 gene expression, increasing the absorption and accumulation of PFOA by crops.

[0021] Thirdly, the present invention provides a plant constructed with high PFOA enrichment, in which the ALMT10 gene of claim 1 is expressed for the purpose of remediating environmental pollution.

[0022] In summary, the present invention has the following beneficial effects:

[0023] This invention constructs a highly efficient protoplast isolation and transient expression system by improving key conditions in the protoplast isolation and transfection process of lettuce. This system provides a powerful and multifunctional technique for the analysis of plant gene and protein functions. By optimizing the conditions of the polyethylene glycol (PEG)-mediated transient expression system in plants, highly efficient transfection of the target gene in lettuce protoplasts was achieved, with a transfection rate of up to 85%. Using the constructed lettuce protoplast isolation and transient expression cells, the key gene ALMT10 was found to be located in the cell membrane. Adding malic acid, the protein-specific transporter encoded by ALMT10, further activates ALMT10 expression and promotes the accumulation of PFOA in crops. These results elucidate the mechanism of key genes in the absorption and transport of PFOA in plants at the cellular level.

[0024] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and do not limit the scope of protection of the present invention. Attached Figure Description

[0025] Figure 1 The ALMT10 protein structure prediction in this embodiment of the invention is shown in (a) Arabidopsis thaliana and (b) lettuce.

[0026] Figure 2 This is a diagram showing the sequence alignment results of Arabidopsis thaliana and lettuce ALMT10 protein in an embodiment of the present invention.

[0027] Figure 3 This is a clustering analysis diagram of ALMT10 amino acid sequences among different species in an embodiment of the present invention.

[0028] Figure 4 This is a diagram showing the ALMT10 protein sequence detection results in an embodiment of the present invention.

[0029] Figure 5 This is a functional classification diagram of protein GO in an embodiment of the present invention.

[0030] Figure 6 This is a statistical chart of Pathway annotation results in an embodiment of the present invention.

[0031] Figure 7 This is a diagram showing the IPR structure domain annotation results in an embodiment of the present invention.

[0032] Figure 8 This is a graph showing the changes in the fluorescence spectrum of lettuce ALMT10 protein under different concentrations of PFOA treatment in this embodiment of the invention.

[0033] Figure 9 This is a Stern-Volmer diagram of PFOA and lettuce ALMT10 protein at different temperatures in an embodiment of the present invention.

[0034] Figure 10 This is a double logarithmic equation graph showing the interaction between PFOA and lettuce ALMT10 protein at different temperatures in embodiments of the present invention.

[0035] Figure 11 This describes the changes in the CD signal of lettuce ALMT10 protein under different concentrations of PFOA treatment in this embodiment of the invention.

[0036] Figure 12 This is a graph showing the accumulation of PFOA after overexpression of the ALMT10 gene in lettuce protoplasts in an embodiment of the present invention.

[0037] Figure 13 This is a diagram showing the growth of Arabidopsis thaliana plants in MS medium at different PFOA concentrations in this embodiment of the invention.

[0038] Figure 14 This is a biomass diagram of ALMT10 overexpressing Arabidopsis plants treated with different concentrations of PFOA in this embodiment of the invention.

[0039] Figure 15 This is a graph showing the PFOA content in Arabidopsis thaliana plants overexpressing ALMT10 under different concentrations of PFOA treatment in this embodiment of the invention.

[0040] Figure 16 This is a correlation analysis diagram of biomass and PFOA content in ALMT10 overexpressing plants in this embodiment of the invention.

[0041] Figure 17This is a graph showing the gene expression levels of Arabidopsis thaliana ALMT10 overexpressing plants under different PFOA concentration treatments in this embodiment of the invention.

[0042] Figure 18 This is a graph showing the PFOA uptake content in the aboveground parts of Arabidopsis thaliana overexpressing ALMT10 in an embodiment of the present invention.

[0043] Figure 19 This is a graph showing the PFOA uptake in the roots of Arabidopsis thaliana overexpressing ALMT10 in an embodiment of the present invention.

[0044] Figure 20 This is a graph showing the change in PFOA content in Arabidopsis thaliana plants when malic acid was added in an embodiment of the present invention (Col-0 is wild type, and ALMT10 is a plant overexpressing this gene). Detailed Implementation

[0045] The present invention will be further described in detail below with reference to the embodiments. It should be noted that: unless otherwise specified, the conditions in the following embodiments are carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following embodiments can be obtained from commercially available sources.

[0046] The amino acid sequence of the ALMT10 protein was obtained from NCBI, and its transmembrane domains were predicted using the NCBI website, BioEdit, GeneDoc, and other software, followed by sequence alignment.

[0047] Example

[0048] Example 1

[0049] Construction of a recombinant genetic transformation vector for the wild-type Arabidopsis thaliana ALMT10 gene

[0050] Using wild-type Arabidopsis thaliana as material, and referring to the seed disinfection and planting methods, Arabidopsis thaliana plants were obtained. RNA was extracted and reverse transcribed to synthesize cDNA, which was then temporarily stored in a -20℃ freezer.

[0051] The cDNA sequence of AtALMT10 was downloaded from the NCBI website. Based on the restriction endonuclease sites in the sequence and the multiple cloning site information in the expression vector pET-28a(+), 15 bp homologous arms of restriction enzyme sites were added to the 5' ends of the upstream and downstream primers. The restriction enzyme sites were determined as follows: AtALMT10-ORF-1-EcoRI-F / AtALMT10-ORF-2253-HindIII-R. Using Arabidopsis cDNA as a template, the ORF sequence of the AtALMT10 gene was amplified. The primers are shown in the table below. 15 μL of the PCR amplification product was taken for electrophoresis to detect whether the band size met expectations. The PCR product of the determined target fragment was extracted and recovered using a Tiangen gel extraction kit.

[0052] Primers for fragment amplification of target expression

[0053] AtALMT10-Fatgggtcgcggatccgaattc AAGGCAACAGAAGTGGCTAA

[0054] AtALMT10-Rtgcggccgcaagcttgtcgac CATCCCTGAAACCTCAGAAC

[0055] Note: F is the upstream primer, and R is the downstream primer.

[0056] Example 2

[0057] Obtaining lettuce ALMT10 protein using a cell-free expression system:

[0058] NCBI predictive analysis indicates that the lettuce ALMT10 protein possesses multiple transmembrane structures, making it a complex protein. Expression and purification using *E. coli* are challenging; therefore, a cell-free expression system was employed to obtain the ALMT10 protein. The complete gene sequence of the ALMT10 protein was artificially synthesized. Based on the priority codons of *E. coli*, the optimal cDNA for the ALMT10 gene was designed and synthesized, with restriction enzyme sites added to both ends of the cDNA. The modified gene was ligated into the expression vector pET-22b (T7 promoter, N-terminal 10*his) using T4 DNA ligase and double-digested overnight at 4°C. The expression vector was transformed into *E. coli* TOP10 competent cells for amplification. Positive colonies were selected, identified by PCR and sequencing, and then expanded. The plasmid of the target expression vector was obtained using a plasmid large-scale extraction kit. The ALMT10 protein was synthesized using the GeneCreate *E. coli* cell-free expression kit. 1 μg of plasmid was added to 50 μL of a reaction mixture containing cell extracts, amino acids, enzymes, and other essential substances. The mixture was thoroughly mixed, gently vortexed, and incubated at 30°C and 180 rpm for 6 h for protein expression. After the reaction, the product was collected, and cells were lysed with trypsin, lysozyme, and other enzymes. After centrifugation and filtration, a crude extract was prepared using column chromatography. After synthesis, the reaction mixture was centrifuged at 10,000 rpm for 10 min to obtain a supernatant containing dissolved protein for Western blotting analysis. After passing the test, the purity of the target protein was improved by ion exchange chromatography, affinity chromatography, and gel filtration. The structure and activity were identified using SDS-PAGE, Western blotting, and mass spectrometry. The obtained ALMT10 protein lyophilized powder was centrifuged at 12,000 rpm for 30 s and diluted with ultrapure water to 1.0 × 10⁻⁶. -3 The mol / L concentration is used for subsequent experiments.

[0059] Example 3: Determination of fluorescence spectrum

[0060] The changes in fluorescence spectra of lettuce ALMT10 recombinant protein bound to different concentrations of PFOA were determined using a fluorescence spectrophotometer. A 1.0 × 10⁻³ mol / L PFOA aqueous solution was prepared, and the protein was diluted to 1.0 × 10⁻⁶ mol / L. After preparing PFOA and protein solutions separately, PFOA was added to the protein solution to prepare mixed liquids, until the final molar ratio (PFOA:ALMT10 protein) was 0:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, and 100:1. 200 μL of the protein solution was transferred to a 350 μL four-sided transparent cuvette for detection. The detection conditions were as follows: the excitation wavelength was 280 nm, the excitation / emission slit width was 5 nm, and the wavelength changes were measured at three temperatures: 17 ℃ (290 K), 25 ℃ (298 K), and 30 ℃ (303 K).

[0061] Example 4: Determination of Circular Dichroism Chromatography

[0062] To clarify the structural changes of ALMT10 recombinant protein upon binding with different concentrations of PFOA, the recombinant protein solution was reacted with PFOA, and the results were analyzed using circular dichroism spectroscopy (CD). A 1.0 × 10⁻³ mol / L PFOA aqueous solution was prepared, and the protein solid was simultaneously diluted to a 1.0 × 10⁻⁶ mol / L aqueous solution. After preparing the PFOA and protein solutions separately, PFOA was added to the protein solution to prepare mixed liquids, until the final molar ratio (PFOA:ALMT10 protein) was 0:1, 10:1, 20:1, and 40:1. 200 µL of the mixed liquid was transferred to a cuvette, and the CD spectrum of the mixture was detected using a circular dichroism spectroscopy system at wavelengths of 195–260 nm. The obtained data were processed using bioinformatics software such as CDNN and CDpro to analyze the changes in the content of each component of the secondary structure of the ALMT10 recombinant protein under different concentrations of PFOA treatment.

[0063] Protein prediction and experimental results:

[0064] ALMT10 protein function and structure prediction, as follows Figure 1 As shown.

[0065] The presence of transmembrane structures in proteins is often closely related to their function. The predicted structures of ALMT10 proteins from lettuce and Arabidopsis thaliana are shown in the figure. AtALMT10 and LsALMT10 proteins are multichannel membrane proteins, mainly responsible for the transport of malic acid. AtALMT10 protein has 6 transmembrane structures, while LsALMT10 protein has 8 transmembrane structures.

[0066] The results of the ALMT10 protein sequence alignment between Arabidopsis thaliana and lettuce are as follows: Figure 2 As shown, the similarity of the two ALMT10 proteins reaches 50.1%, indicating that the function of this protein is significantly conserved and consistent between the two.

[0067] Cluster analysis of ALMT10 amino acid sequences among different species is shown in Figure 3. The phylogenetic tree shows that the key protein has high homology in Arabidopsis and lettuce, and their biological functions may be the same. This provides a feasible guarantee for subsequent research on Arabidopsis using model plants to reveal the functional mechanism of key gene-mediated absorption and transport of PFOA in plants (lettuce).

[0068] Example 5: Mass spectrometry detection of ALMT10 protein in lettuce

[0069] Through preliminary experiments, this invention conducted in-depth qualitative proteomic analysis on protein samples. Utilizing the efficient search capabilities of Proteinpilot software, under the conditions of a confidence threshold of ≥95% and the presence of at least one unique peptide, a total of 389 peptides were identified in the ALMT10 sample. Further screening conditions of ≥95% confidence and ≥1 unique peptides resulted in 59,634 secondary spectra from the ALMT10 sample, of which 2,250 were successfully resolved. These resolution results provided rich protein sequence information. The protein sequence detection results are shown in the figure below. In the sequence coverage pane of the Proteinpilot software, different colors indicate sequence segments with different confidence levels. Specifically, green represents sequences with a confidence level above 95%, yellow represents sequences with a confidence level between 50% and 95% (for reference), and red represents sequences with lower confidence levels, between 0% and 50% (to be treated with caution). Gray areas are generally considered completely unreliable. However, it is worth noting that even if the sequence is located at the -COOH terminus of a protein, a gray color does not necessarily indicate an error, as -COOH terms are easily filtered out in LC-MS / MS analysis. The coverage of the lettuce ALMT10 protein was 74.8%, and combined with the above SDS-PAGE and Western Blot results, it can be preliminarily determined that the protein was correctly expressed. The results are as follows... Figure 4 As shown.

[0070] Common methods for analyzing protein function and predicting the function of unknown proteins using known protein sequences include GO annotation and KEGG annotation. Furthermore, since protein domains are essential for the normal functioning of organisms, databases from various sources are used to comprehensively reflect the function and structure of proteins, revealing their biological significance in various life activities.

[0071] The three GO ontology types describe the molecular function, cellular component, and biological process involved in genes, respectively. The GO functional annotation results for proteins are shown in the figure below. The horizontal axis represents the three GO ontology entries, and the vertical axis represents the number of proteins annotated in each category. The biological processes involved by proteins include cellular processes, metabolic processes, response to stimulus, biological regulation, and localization. Proteins are mainly distributed in cellular anatomical entities and protein-containing complexes. Their molecular functions mainly focus on binding, catalytic activity, transport activity, structure molecule activity, ATP-dependent activity, translation regulator activity, and antioxidant activity. The results are as follows: Figure 4 As shown.

[0072] KEGG can be used to study and analyze metabolism and its networks in organisms. The most important biochemical metabolic pathways and signal transduction pathways involved by proteins can be identified through pathway significant enrichment. The results are shown in the figure below. Metabolism mainly focuses on carbohydrate metabolism, amino acid metabolism, energy metabolism, and the metabolism of cofactors and vitamins. Gene information processing includes translation, folding, sorting and degradation, replication and repair, and transcription. Environmental information processing includes membrane transport and signal transduction. Cellular processes include cell community-prokaryotes and cell activity. Human diseases include drug resistance and antimicrobial resistance. The results are as follows: Figure 6 As shown.

[0073] Protein domains are recurring specific components in different protein molecules, possessing similar sequences, structures, and functions. They are the units of protein structure, function, and evolution. Domains can replicate and recombine to form new proteins. The structural distribution among domains is not random, but rather exhibits a pattern where some domains are highly synthesized, while others rarely interact with other domains. The types of ALMT10 protein-binding domains are shown in the figure below. The horizontal axis represents the number of proteins, and the vertical axis represents the domain name. A larger value indicates a higher degree of protein enrichment in that domain. This mainly includes: P-loop containing nucleoside triphosphate hydro..., nucleic acid binding, OB-fold, NAD(P)-binding domain superfamily, AAA+ ATPase domain, pyridoxal phosphate-dependent transferase domain l, pyridoxal phosphate-dependent transferase, winged helix-like DNA-binding domain superfamily, ribosomal protein S5 domain 2-type fold, and small GTP-binding protein domain, etc. Results are as follows... Figure 7 As shown.

[0074] Example 6

[0075] The binding mechanism of ALMT10 protein to PFOA:

[0076] Intrinsic fluorescence is commonly used to study protein structure because aromatic amino acids in protein molecules fluoresce upon excitation by ultraviolet light. The intrinsic fluorescence of the ALMT10 protein is composed of tryptophan, tyrosine, and phenylalanine. The effect of different concentrations of PFOA on the fluorescence value of the ALMT10 protein at a sample cell temperature of 290 K is shown in the figure below. The results show that the ALMT10 protein exhibits a maximum emission peak at approximately 340 nm, and the intensity of the fluorescence emission peak shows a regular decreasing trend with increasing PFOA concentration. This result indicates an interaction between PFOA and the ALMT10 protein, thereby altering the microenvironment of the protein's amino acid residues and inducing the quenching of the ALMT10 protein's intrinsic fluorescence. The results are as follows... Figure 8 As shown.

[0077] Fluorescence quenching is classified into static quenching and dynamic quenching. The type of PFOA-induced fluorescence quenching of ALMT10 protein can be analyzed using the Stern-Volmer equation, as follows: F0 / F = 1 + Ksv[Q] = 1 + Kqτ0[Q], where F0 is the protein fluorescence value without PFOA, F is the protein fluorescence value after PFOA addition, Ksv is the fluorescence quenching constant, τ0 ≈ 10⁻⁸ S, [Q] is the PFOA concentration, and Kq is the quenching rate constant. The curve obtained by fitting the fluorescence data into the equation is shown below. Figure 9 As shown in the figure, the binding parameters of PFOA and ALMT10 protein are shown in the table below. From the figure and table, it can be seen that Ksv is directly proportional to temperature, increasing continuously with increasing temperature. The biological maximum diffusion constant is considered an important indicator for determining static and dynamic quenching. As shown in Table 1, at three different temperatures, Kq is higher than the biological maximum diffusion constant (2.0 × 10¹⁰ L·mol⁻¹·s⁻¹), indicating that the PFOA-induced fluorescence quenching of ALMT10 protein is a static quenching process.

[0078] Table 1. Binding parameters of PFOA to lettuce ALMT10 protein at different temperatures.

[0079]

[0080] To clarify the interaction information between PFOA and ALMT10 protein, based on the calculated binding parameter data, a double logarithmic curve equation log(F0 / F-1) = logKa + nlog[Q] was used to fit the equation, where Ka is the apparent binding constant and n is the number of binding sites. The results are shown in the table below. The fact that n is close to 1 indicates that there may only be one interacting binding site during the interaction between PFOA and ALMT10 protein. Furthermore, according to Van't Hoff's law, the interaction type between PFOA and ALMT10 was clarified. The calculation formula is: lnK = ΔS / R - ΔH / RT, where K is the binding constant between PFOA and ALMT10 protein, and R is the gas constant. Then, the change in free energy during the reaction between PFOA and ALMT10 protein was calculated using the thermodynamic formula: ΔG = ΔH - TΔS. The results are shown in Table 2. As the temperature increases, Ka gradually decreases, and the values ​​of ΔH and ΔS are less than 0, indicating that the binding of PFOA to ALMT10 protein is an exothermic reaction, mainly driven by hydrogen bonds and van der Waals forces. ΔG < 0 indicates that the interaction between PFOA and ALMT10 protein is spontaneous. The results are shown in Table 10.

[0081] Table 2. Thermodynamic parameters of PFOA reacting with lettuce ALMT10 protein

[0082]

[0083] Example 7

[0084] Effects of PFOA on the secondary structure of ALMT10 protein:

[0085] Small molecule ligands interact with proteins and influence their secondary structure. Circular dichroism (CD) chromatography can be used to determine the changes in the secondary structure of ALMT10 protein when different concentrations of PFOA interact with it. The results are as follows: Figure 11 As shown in Table 3, with the increase of PFOA concentration, the CD signal of ALMT10 protein showed an increasing trend, and the content of secondary structure in the protein also changed. The content of α-helices gradually increased, the content of β-sheets showed a decreasing trend, and the content of random coils showed an increasing trend. This indicates that the interaction between PFOA and ALMT10 protein changed the secondary structure of ALMT10 protein.

[0086] Table 3. Changes in the content of each component of the secondary structure of ALMT10 protein in lettuce under different concentrations of PFOA treatment.

[0087]

[0088] Example 8

[0089] Obtaining gene-expressing cells:

[0090] (1) Analysis of expression levels of key genes and PFOA content

[0091] Using lettuce cDNA as a template and pCHF1 as a vector, the full-length coding sequence of the ALMT10 gene was cloned using a high-fidelity enzyme. Based on this, a recombinant genetic transformation vector for this gene, pCHF1-KpnI-1-LsALMT10ORF-1617-BamHI, was constructed. Protoplasts were extracted from lettuce shoot tips, and the plasmid of the overexpression vector was transfected into cells using a protoplast transient transfection system. Untransfected cells served as a control group. After incubation at 25 °C for 14 h, RNA was extracted, and cDNA was obtained through reverse transcription. The gene expression level was then detected using quantitative real-time PCR.

[0092] To investigate the mechanism of PFOA uptake mediated by key genes in protoplasts, lettuce protoplast cells were obtained using the isolation method described above. The plasmid of the ALMT10 overexpression vector was transformed into protoplasts and incubated for 14 h. After treatment with different concentrations of PFOA, the PFOA content in the supernatant and cells was measured. Seven PFOA concentration gradients were set up: blank control group (no PFOA), 1 mg / L PFOA group, 2.5 mg / L PFOA group, 5 mg / L PFOA group, 10 mg / L PFOA group, 15 mg / L PFOA group, and 20 mg / L PFOA group. All concentrations were final PFOA concentrations. Each experimental group had three replicates. After culturing at 25 ℃ for 24 h, PFOA was extracted from cells and supernatant using the method described above. Origin 2021 software was used to fit a curve, with the PFOA content in the supernatant as the x-axis and the PFOA content in the cells as the y-axis.

[0093] (2) Function of PFOA uptake and accumulation in cells with overexpression:

[0094] After transfecting the LsALMT10 gene plasmid into protoplasts, the results of quantitative real-time PCR are shown in the figure. Compared with the control group, the expression levels of key genes in the transfected group (overexpression group) were significantly increased (p < 0.05). The detection of PFOA content directly reflects the level of PFOA uptake by cells. The results showed that the PFOA content in the transfected group cells was higher than that in the control group, and the uptake process conformed to the Michaelis-Menten equation. In the Michaelis-Menten equation, the Km value is mainly related to the plant's affinity for the substance and its uptake efficiency. The smaller the Km value, the higher the uptake rate at a lower substrate concentration, which usually means that the plant has high uptake efficiency and selectivity. The Vmax value mainly reflects the plant's maximum uptake rate. The Km values ​​of PFOA uptake in the transfected group cells were significantly lower than those in the untransfected protoplasts (p < 0.05), indicating that the overexpressing protoplasts can achieve a higher uptake rate at a lower PFOA concentration, demonstrating high affinity and selectivity for PFOA. The Vmax of LsALMT10 was significantly higher in untransfected protoplasts than in untransfected protoplasts (p < 0.05), indicating that this gene can promote the uptake and accumulation of PFOA in cells and can act as a protein carrier in the uptake and transport of PFOA. This result explains the functional mechanism of this gene in transporting PFOA at the cellular level. The results are as follows... Figure 12 As shown.

[0095] Example 9

[0096] (1) Obtaining and cultivating transgenic Arabidopsis thaliana:

[0097] Using the LsALMT10 gene cDNA from lettuce plants as a template and pCHF1 as a vector, the full-length coding sequence of the gene was cloned using a high-fidelity enzyme. Based on this, a recombinant genetic transformation vector was constructed. This vector was transformed into Agrobacterium, and after infecting wild-type Arabidopsis plants, transgenic plants were obtained. Homozygous plants were screened and identified, ultimately yielding homozygous Arabidopsis plants overexpressing OE-ALMT10. Homozygous seeds were then collected for further plant experiments.

[0098] Select an appropriate amount of Arabidopsis thaliana seeds and place them in 1.5 mL centrifuge tubes (wild-type Col-0, OE-ALMT10). Disinfect the tubes with 10% sodium hypochlorite (NaClO, v / v) for 10 min, continuously shaking the tubes during this time to ensure thorough disinfection. Then disinfect twice with 75% ethanol for 1 min each time, followed by washing 4-5 times with sterile water for 1 min each time. Vernalize the seeds at 4 ℃ for 2-3 days. Prepare 1 / 2 MS solid medium, sterilize at high temperature, and pour plates in a laminar flow hood, ensuring uniform medium thickness. Suspend the vernalized seeds in sterile water in a laminar flow hood and evenly place them on the 1 / 2 MS medium. Blow until watermarks disappear, then seal the plates. Incubate for 15 days in a constant temperature incubator to obtain Arabidopsis thaliana seedlings. The incubator temperature was 25 ℃, the light conditions were 18 h light and 6 h darkness, and the humidity was 60%. Select healthy seedlings and transplant them into vermiculite for two weeks, watering them with a 1 / 2 nutrient solution during this period. When the roots reach 3-5 cm in length and are relatively robust, transplant them into hydroponic pots and cultivate them in a greenhouse at 25 ℃. Change the nutrient solution every 7 days, with the formula shown in Table 4.

[0099] Table 4 Composition of different formulations

[0100]

[0101] Example 10

[0102] Phenotypic analysis experiments:

[0103] To investigate the changes in the physiological and biochemical properties of Arabidopsis thaliana overexpressing plants (OE-ALMT10) under PFOA treatment, Arabidopsis thaliana seeds were grown in disposable sterile culture dishes, and seed germination and plant growth under PFOA stress were observed. Five treatment groups were set up: a control group, and 0.2, 1, 5, and 10 mg / L PFOA treatment groups. Seeds of both overexpressing and wild-type plants were sterilized using the above-mentioned sterilization method and vernalized at 4 ℃ for 2-3 days. The PFOA stock solution (100 mg / L) was filtered into sterile 50 mL centrifuge tubes using a disposable sterile filter in a laminar flow hood to prepare MS solid medium. After high-temperature sterilization, the medium was cooled to approximately 60 ℃, and then sterilized PFOA solution was added to prepare MS medium with the corresponding PFOA concentration. Quickly pour the mixture into petri dishes. After the plates solidify and dry, evenly spot 8 seeds from both overexpression and wild-type plants onto the sides of the petri dish, ensuring the seeds are in a straight line. After drying, seal the petri dishes and place them in a 25°C incubator to allow the seeds to grow upright for approximately 10 days. Once the Arabidopsis plants have three leaves, photograph and observe their growth under different concentrations of PFOA treatment. Collect Arabidopsis plants of the same lineage from the same plate, weigh them, and measure their biomass. Extract PFOA from the samples using ultrasonic extraction. Simultaneously, extract RNA from different Arabidopsis lines to detect the expression levels of related genes, following the same experimental methods as described above. Three replicates were set up for each gene and each concentration. The results are shown in Table 5.

[0104] Table 5 Primer Table

[0105] Primers Sequences (5'-3') UBQ1-F TTCCTTGATGATGCTTGCTC UBQ1-R TTGACAGCTCTTGGGTGAAG ALMT10-F ATTTGGGCAGGATCTCAGCTTCAC ALMT10-R TGCTACACAGCCGTCTAACGAATC

[0106] Example 11

[0107] Analysis of PFOA content absorbed by Arabidopsis thaliana by competing agents:

[0108] Malic acid is an important substrate for the ALMT10 gene to function. In this experiment, 1 mg / L malic acid was selected as a competitive substrate to treat OE-ALMT10-overexpressing Arabidopsis thaliana to detect PFOA uptake. Wild-type (Col-0) Arabidopsis thaliana plants of uniform size and growth were selected and transferred to hydroponic pots containing fresh nutrient solution. Inhibitors were added to the treatment groups, and PFOA was added to the hydroponic pots to a concentration of 1 mg / L after 30 min. The control group was treated with PFOA only. After 6 h of exposure, samples were taken and washed with tap water and deionized water, respectively. Then, the aboveground and underground parts were separated using a scalpel. 1 g of aboveground and underground tissues were weighed separately, and the fresh samples were ground with a steel ball. PFOA was extracted using the above-mentioned method. Each treatment was performed in triplicate.

[0109] Example 12

[0110] Phenotypic analysis:

[0111] Arabidopsis seeds were grown in media with different concentrations of PFOA, and their phenotypes changed differently with increasing PFOA concentration. As shown in the figure: with increasing PFOA concentration, root growth in both wild-type and overexpressing plants was inhibited. Wild-type plants were less affected by PFOA, with only lateral root growth being inhibited; taproot growth showed no significant change compared to the control group. However, the root changes in ALMT10 overexpressing plants were more pronounced. Compared to the control group and wild-type plants, both taproot and lateral root growth were significantly inhibited, and the germination rate of overexpressing plants was also affected. When the PFOA concentration was 10 mg / L, the average germination rate was only 50%. The reason for these results may be that the overexpressing plants absorbed more PFOA, thus affecting seed germination and root growth. The results are as follows: Figure 13 As shown.

[0112] The biomass of overexpressing plants and wild-type plants was measured separately, and the results are as follows: Figure 14 As shown, with the increase of PFOA concentration, the biomass of overexpressing plants decreased significantly compared with wild-type plants (p < 0.05). This indicates that overexpression of the ALMT10 gene can enable plants to absorb more PFOA, thereby inhibiting the plant's own growth. This confirms the functional mechanism of the above key genes mediating the absorption and transport of PFOA in plants at the seedling level.

[0113] The enrichment coefficients of Arabidopsis thaliana plants are shown in Table 6. For the same variety of Arabidopsis, the enrichment coefficient decreased with increasing PFOA concentration. Under PFOA stress, the enrichment coefficient of overexpressing plants was significantly higher than that of wild-type plants (p < 0.05), indicating that the ALMT10 transporter plays an important role in the uptake and accumulation of PFOA in Arabidopsis. With increasing PFOA concentration, the enrichment coefficient decreased, indicating saturation of the transport process and a decline in the ability of Arabidopsis to transport PFOA.

[0114] Table 6. PFOA enrichment coefficient (BCF) of ALMT10 overexpression lines

[0115] Arabidopsis varieties 0.2 mg / L 1 mg / L 5 mg / L 10 mg / L Col-0 0.14±0.01 Bb 0.16±0.00 Da 0.12±0.01 Cb 0.09±0.00 Cc OE-ALMT10 0.50±0.07 Aa 0.37±0.00 Bb 0.19±0.02 Bc 0.20±0.01 Ac

[0116] Note: Uppercase letters indicate differences between different strains of Arabidopsis thaliana, while lowercase letters indicate differences between Arabidopsis thaliana strains at different concentrations.

[0117] To verify the above experimental results, the PFOA content absorbed by the plants was detected using ultrasonic extraction. The results are as follows: Figure 15As shown, under different concentrations of PFOA treatment, the PFOA uptake of overexpressing plants was significantly higher than that of wild-type plants (p < 0.05).

[0118] Correlation analysis was performed on plant biomass and PFOA content, and the results are as follows: Figure 16 As shown, the biomass of overexpressing plants was negatively correlated with the amount of PFOA absorbed (p < 0.05), meaning that the lower the biomass, the higher the PFOA content in the plant, indicating that the overexpressing plants absorbed more PFOA during growth, which led to the inhibition of Arabidopsis thaliana plants.

[0119] Simultaneously, the relative expression levels of key genes in overexpressed and wild-type plants were detected, and the results were as follows: Figure 17 As shown, the gene expression levels in overexpressing plants were significantly higher than those in wild-type plants, but these levels were not correlated with PFOA concentration. These results indicate that ALMT10 accumulation in crops plays a crucial role in PFOA uptake, providing a basis for further research on gene action mechanisms.

[0120] Example 13

[0121] Analysis of PFOA content and translocation coefficient in mature Arabidopsis thaliana plants overexpressing PFOA:

[0122] Arabidopsis thaliana plants overexpressing PFOA were treated with 0.2, 0.5, and 1 mg / L PFOA, and the results were as follows: Figure 18 and 19 As shown in Table 7, compared with wild-type Arabidopsis thaliana (Col-0) plants, the PFOA uptake in both the aboveground and underground parts of the overexpressing Arabidopsis thaliana plants was increased, and the results were significantly different in the 0.5 and 1 mg / L PFOA treatment groups (p < 0.05). The PFOA translocation coefficient of Arabidopsis thaliana is shown in Table 7. Under different concentrations of PFOA treatment, the translocation coefficient of ALMT10 overexpressing plants was significantly increased (p < 0.05), indicating that this gene plays an important role in the uptake and translocation of PFOA.

[0123] Table 7. PFOA transport coefficient (TF) in Arabidopsis thaliana overexpressed with ALMT10

[0124]

[0125] Note: Uppercase letters indicate significance analysis of translocation coefficients in overexpression lines of different genes, while lowercase letters indicate significance analysis of translocation coefficients in Arabidopsis thaliana at different concentrations in the same line.

[0126] Example 14

[0127] Analysis of the effects of inhibitors and competitors on PFOA uptake in Arabidopsis thaliana:

[0128] When malic acid was added, PFOA uptake significantly increased in both wild-type and overexpressing plants (p < 0.05). This result is related to the fact that both PFOA and malic acid can activate ALMT10 gene expression, and their co-existence exhibits a significant synergistic effect. High expression of the ALMT10 gene not only effectively transports malic acid but also further increases its uptake and transport of PFOA, thus increasing PFOA uptake in Arabidopsis plants. The results are as follows... Figure 20 As shown, the above results further illustrate the important role of the ALMT10 gene in the process of PFOA uptake and transport in plants.

[0129] The above description is merely an exemplary embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Application of ALMT10 gene in plant absorption and enrichment of PFOA through multiple transmembrane structures, characterized in that, The nucleotide sequence of the ALMT10 gene is shown in SEQ ID NO.

1. The ALMT10 gene has the function of improving the enrichment of PFOA in plants.

2. The application of the ALMT10 gene according to claim 1 in the absorption and enrichment of PFOA in plants through multiple transmembrane structures, characterized in that, The amino acid sequence of the protein encoded by the ALMT10 gene is shown in SEQ ID NO.

2.

3. The application of the ALMT10 gene according to claim 1 in the absorption and enrichment of PFOA in plants through multiple transmembrane structures, characterized in that, The AtALMT10 gene of a plant was amplified to obtain the complete gene sequence of the synthesized ALMT10 protein, which was used to absorb and enrich PFOA.

4. The application of the ALMT10 gene according to claim 1 in the absorption and enrichment of PFOA in plants through multiple transmembrane structures, characterized in that, The ALMT10 protein interacts with PFOA and induces changes in the protein's secondary structure, enabling the protein to transport PFOA across the membrane.

5. The application of the ALMT10 gene according to claim 1 in the absorption and enrichment of PFOA in plants through multiple transmembrane structures, characterized in that, The plant is a dicotyledonous plant, preferably lettuce or Arabidopsis thaliana.

6. A method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase PFOA uptake in plants, characterized in that, include: Obtain the gene sequence of the ALMT10 gene; The gene sequence of the ALMT10 gene was identified and arranged to obtain candidate sgRNA target sites; The off-target sites of the predicted candidate sgRNA target sites are calculated to obtain target sgRNA-1 and target sgRNA-2; The target sgRNA-1 and target sgRNA-2 were amplified respectively to obtain the amplified products; The amplified product was used to construct a vector to obtain a plasmid for overexpressing the ALMT10 gene.

7. The method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase PFOA uptake in plants according to claim 6, characterized in that, The sequences of the target sgRNA-1 and target sgRNA-2 are as follows: Target sgRNA-1: 5'-AAGGCAACAGAAGTGGCTAA-3'; Target sgRNA-2: 5'-CATCCCTGAAACCTCAGAAC-3'.

8. The method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase PFOA uptake in plants according to claim 6, characterized in that, The ALMT10 overexpression vector plasmid was transformed into protoplasts or plants and incubated with different concentrations of PFOA, namely 0.2, 0.5, 1, and 5 mg / L.

9. The method for constructing a recombinant genetic transformation vector of the ALMT10 gene to increase PFOA uptake in plants according to claim 6, characterized in that, Both PFOA and malic acid can activate ALMT10 gene expression, increasing the absorption and accumulation of PFOA by crops.

10. A plant that has been constructed to highly enrich PFOA, characterized in that, Expressing the ALMT10 gene as described in any one of claims 1 to 5 in plants for the purpose of remediating environmental pollution.