A multi-gene tandem plant expression vector for improving soybean alkali tolerance and a construction method and application thereof

Abstract

This invention relates to a multi-gene tandem plant expression vector for improving soybean alkali tolerance, its construction method, and its application, belonging to the field of genetic engineering technology. To address the technical problem that simple superposition of multiple genes in soybean sodium salt tolerance improvement easily leads to pathway interference, increased metabolic burden, and poor growth, making it difficult to systematically improve alkali tolerance, this invention utilizes homologous recombination to express genes from the same metabolic pathway... GmNAC133 , GmC2H2 , GmPET6 By constructing a multi-gene tandem plant expression vector and utilizing a soybean hairy root transformation method based on the RUBY reporter gene, a systematic improvement in soybean alkali tolerance was successfully achieved. This invention is not only applicable to improving soybean alkali tolerance but also provides an efficient and reliable technical approach for breeding other crops that are difficult to genetically transform or require multi-gene synergistic regulation, and has broad prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a multi-gene tandem plant expression vector for improving the alkali resistance of soybeans, its construction method, and its application. Background Technology

[0002] Soybeans Glycine max Soybeans are a globally important food and economic crop, possessing value for food, feed, and industry. They are a major source of plant protein and oil, playing a vital role in ensuring national nutrition and health, and supporting the development of animal husbandry and the food processing industry. As the world's largest importer of soybeans, my country has seen its demand for soybeans rise continuously in recent years, placing enormous pressure on national food security.

[0003] my country possesses nearly 1.5 billion mu (100 million hectares) of saline-alkali land, of which approximately 300 million mu (20 million hectares) have agricultural development potential, representing a crucial reserve of arable land and a "potential granary." my country's saline-alkali land is mainly concentrated in the arid and semi-arid regions of central and western China, the soda saline-alkali region of Northeast China, and the coastal saline-alkali region of eastern China. Among these, the soda saline-alkali region of Northeast China has relatively good water resources and flat terrain, making it one of the areas with the greatest potential for soybean cultivation. However, the high pH value and heavy clay texture of soda saline-alkali land make it difficult for traditional crops to grow, severely restricting soybean planting and production in this region. Therefore, cultivating soybean varieties adapted to soda saline-alkali environments is of great significance for effectively increasing domestic soybean supply, reducing import dependence, and enhancing national food security.

[0004] Polygenic aggregation breeding is a core strategy for modern crop genetic improvement. Its core lies in the precise and efficient aggregation of multiple beneficial genes dispersed across different germplasm resources into a single superior genetic background, creating breakthrough new varieties with outstanding comprehensive traits. However, soybean alkali tolerance is a complex quantitative trait controlled by multiple genes working together, involving intricate signaling networks and resource allocation mechanisms. Different alkali tolerance genes may act on independent or even antagonistic pathways. Simply superimposing different genes may lead to signal interference between pathways or competition for limited resources (such as energy, precursor substances, transcription / translation factors, etc.), thus weakening the plant's overall alkali tolerance and making it difficult for soybeans to simultaneously and optimally allocate resources to cope with all stresses. Furthermore, overexpression of multiple exogenous genes significantly increases the metabolic burden on soybeans, exacerbates resource consumption, and induces undesirable phenotypes such as stunted growth, abnormal development, and reduced yield, ultimately offsetting the gains in stress tolerance.

[0005] Therefore, improving soybean alkali tolerance requires going beyond simple gene accumulation. Aggregating multiple genes within the same regulatory pathway (functional module) may be a more effective approach. Genes within the same pathway typically regulate different steps of complex traits; their synergistic aggregation helps enhance the stability of the regulatory network, making alkali tolerance more consistent and reliable under different environmental conditions. Simultaneously, key steps in the pathway often become limiting factors. Aggregating and improving these key steps and their upstream and downstream related genes can more precisely and efficiently open up the entire pathway, thereby systematically improving soybean alkali tolerance.

[0006] In summary, there is an urgent need in this field to develop efficient multi-gene transformation systems along the same pathway to systematically improve the soda-alkali tolerance trait in soybeans, and to selectively breed new soda-alkali tolerant soybean varieties, thereby providing new genetic resources and breeding strategies for soybean cultivation in the soda-alkali areas of Northeast China. Summary of the Invention

[0007] To address the technical problem that simple superposition of multiple genes in soybean sodium salt tolerance improvement easily leads to pathway interference, increased metabolic burden, and poor growth, making it difficult to systematically improve alkali tolerance, this invention utilizes homologous recombination to combine genes from the same metabolic pathway. GmNAC133 , GmC2H2 , GmPET6 Gene tandem was used to construct a multi-gene tandem plant expression vector and transform it into Agrobacterium. Then, a high-throughput visualization soybean salt-alkali tolerance gene screening system was used to transform the multi-gene tandem plant expression vector into soybeans, resulting in mixed-type soybean plants with red transgenic hairy roots, which are soybean plants with improved alkali tolerance.

[0008] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution: The first objective of this invention is to provide a multi-gene tandem plant expression vector for improving alkali tolerance in soybeans. This multi-gene tandem plant expression vector comprises a pRUBY vector backbone and sequentially tandemly connected... GmNAC133 Gene, first linker segment, GmPET6 Genes, second linker segments and GmC2H2 Genes; the stated GmNAC133 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.1. GmPET6 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.3. GmC2H2 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.2; the nucleotide sequences of the first linker fragment and the second linker fragment are shown in SEQ ID NO.33 and SEQ ID NO.34, respectively.

[0009] A second objective of this invention is to provide a method for constructing the aforementioned multi-gene tandem plant expression vector, the method comprising the following steps: S1. Total RNA was extracted from soybean root tissue and reverse transcribed into cDNA. Using this cDNA as a template, specific primer pairs were used to... GmNAC133 , GmC2H2 , GmPET6 The gene fragments were amplified separately to obtain three single gene fragments with homologous arms; S2. Design primers P2A-1-F and P2A-1-R for amplifying the first ligation fragment, and primers P2A-2-F and P2A-2-R for amplifying the second ligation fragment. After annealing, the two pairs of primers are used to obtain double-stranded P2A-1 and P2A-2 fragments, namely the first ligation fragment and the second ligation fragment. S3. The pRUBY vector is double-digested to obtain a linearized pRUBY vector, and the vector with homologous arms is then introduced via homologous recombination. GmNAC133 Gene fragments, P2A-1 Fragments, with homologous arms GmPET6 Gene fragments and linearization pRUBY The vectors are connected to obtain intermediate expression vectors; S4. Amplify the intermediate expression vector using specific primers to obtain a double-gene polymerized fragment with homologous arms. Combine this fragment with the P2A-2 fragment and a gene containing homologous arms. GmC2H2 Gene fragments and linearized pRUBY vectors were linked by homologous recombination to obtain the multi-gene tandem plant expression vector GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2.

[0010] In one embodiment of the present invention, S1 is used to amplify the component with homologous arms. GmNAC133 The primer sequences for the gene fragment are shown in SEQ ID NO.17 and SEQ ID NO.18, and are used to amplify the gene fragment with homologous arms. GmC2H2 The primer sequences for the gene fragment are shown in SEQ ID NO.19 and SEQ ID NO.20, and are used to amplify the gene fragment with homologous arms. GmPET6 The primer sequences for the gene fragment are shown in SEQ ID NO.21 and SEQ ID NO.22.

[0011] In one embodiment of the present invention, the nucleotide sequences of P2A-1-F and P2A-1-R in S2 are shown in SEQ ID NO.23 and SEQ ID NO.24, and the nucleotide sequences of P2A-2-F and P2A-2-R are shown in SEQ ID NO.25 and SEQ ID NO.26.

[0012] In one embodiment of the present invention, the annealing reaction system in S2 consists of 5 μL each of upstream and downstream annealing primers, 1 μL of 1 M Tris 8.0, 1 μL of 5 M NaCl, and ddH2O to a final volume of 50 μL; the annealing reaction conditions are: 94°C slowly decreasing to 16°C, ensuring a ramp of 0.1, and a reaction time of 4 min.

[0013] In one embodiment of the present invention, the double digestion in S3 uses XbaI and PstI.

[0014] The third objective of this invention is to provide the application of the above-mentioned multi-gene tandem plant expression vector in improving the alkali resistance of soybeans.

[0015] In one embodiment of the present invention, the application is to use the multi-gene tandem plant expression vector to cultivate soybeans with improved alkali tolerance. Specifically, the multi-gene tandem plant expression vector is transformed into Agrobacterium, and then soybeans are transformed using a soybean hairy root transformation method based on the RUBY reporter gene to obtain hybrid soybean transformed plants with red transgenic hairy roots.

[0016] The fourth objective of this invention is to provide a recombinant bacterium containing the above-mentioned multi-gene tandem plant expression vector.

[0017] The fifth objective of this invention is to provide the application of the above-mentioned recombinant bacteria in improving the alkali resistance of soybeans.

[0018] A sixth objective of this invention is to provide a soybean in which the above-mentioned multi-gene tandem plant expression vector is integrated into the soybean genome.

[0019] The beneficial effects of this invention are: This invention utilizes multiple genes along the same metabolic pathway (such as...) GmNAC133 , GmC2H2 , GmPET6 A multi-gene plant expression vector was constructed via homologous recombination tandem of genes, and a soybean hairy root transformation method based on the RUBY reporter gene was used to successfully enhance the alkali tolerance of soybean. Compared with existing technologies, this invention has the following outstanding advantages: Significantly improves genetic transformation efficiency: Using the method of this invention, the genetic transformation efficiency can reach up to 60%, which is far higher than conventional multi-gene transformation methods, and can efficiently and stably introduce multiple exogenous target genes into soybeans.

[0020] Significantly shortens the breeding cycle: Positive transgenic plants with a single genotype background can be obtained in just 4-5 months, significantly accelerating the creation of new alkali-tolerant soybean germplasm.

[0021] Achieve high-throughput, large-scale transformation: Each person can complete the transformation of 200 gene vectors per year, producing more than 3,000 independent positive transgenic plants, meeting the needs of large-scale, multi-gene aggregation breeding.

[0022] Overcoming the negative effects of multiple gene superposition: By aggregating functional genes in the same regulatory pathway, signal interference and resource competition between different pathways are avoided, metabolic burden is reduced, and problems such as growth retardation, developmental abnormalities and yield decline caused by multiple gene overexpression are effectively prevented, so soybeans exhibit synergistically enhanced alkali tolerance under sodium salt and alkali stress.

[0023] This invention provides a general strategy for the comprehensive improvement of multiple traits in plants: It is not only applicable to the improvement of alkali tolerance in soybeans, but also provides an efficient and reliable technical approach for the breeding of other crops that are difficult to genetically transform and require multi-gene synergistic regulation, and has broad prospects for promotion and application. Attached Figure Description

[0024] Figure 1 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Phenotypic diagram of soybean plants overexpressing a single gene; Figure 2 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Figure showing the results of chlorophyll content determination in soybean plants with single-gene overexpression; Figure 3 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Figure showing the results of plant height measurement in soybean plants with single-gene overexpression. Figure 4 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Figure showing the results of biomass measurement in soybean plants with single-gene overexpression. Figure 5 for GmC2H2 In the root system of soybean plants with overexpressed genes GmNAC133 Graph showing the results of transcription level measurement; Figure 6 This is a diagram showing the results of a yeast one-hybridization. Figure 7 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Phenotypic diagram of a three-gene-integrated transgenic chimeric plant; Figure 8 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6Figure showing the results of chlorophyll content determination in three-gene-polymerized transgenic chimeric plants; Figure 9 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Figure showing the results of plant height measurement of three-gene polymerized transgenic chimeric plants; Figure 10 Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Figure showing the biomass measurement results of three-gene-polymerized transgenic chimeric plants; Figure 11 Phenotypic analysis of three-gene-polymerized transgenic chimeric plants and single-gene-overexpressing chimeric plants under alkaline stress; Figure 12 The figure shows the plant height measurement results of the three-gene-polymerized transgenic chimeric plants and the single-gene-overexpressing chimeric plants under alkaline stress. Figure 13 The figure shows the biomass measurement results of trigene-polymerized transgenic chimeric plants and single-gene-overexpressing chimeric plants under alkaline stress. Figure 14 This is a comparative analysis of the alkali tolerance of transgenic chimeric soybean plants obtained from two multi-gene polymerization schemes. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the objectives of the invention. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of this invention to realize and apply the technology of this invention. In the art, embodiments obtained by other those skilled in the art without creative effort are all protected by this invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials, reagents, culture media and instruments used are conventional materials, reagents, culture media and instruments in the art, which can be obtained by those skilled in the art through commercial channels.

[0027] The synthesis of primers and sequencing of sequences used in this invention were both completed by Sangon Biotech (Shanghai) Co., Ltd.

[0028] The soybean variety used in this invention is Willam82, which was provided by the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences.

[0029] The Agrobacterium rhizogenes K599 used in this invention was purchased from Beijing Coollab Technology Co., Ltd.

[0030] Example 1: GmNAC133 , GmC2H2 , GmPET6 Alkali tolerance analysis of soybeans with single-gene overexpression 1. GmNAC133 , GmC2H2 , GmPET6 Obtaining soybean plants with single-gene overexpression of three genes (1) GmNAC133 , GmC2H2 and GmPET6 Three full-length clones According to soybeans GmNAC133 , GmC2H2 , GmPET6 Primers for amplifying the full-length CDS of three genes were designed based on the nucleotide sequences of their CDS regions (SEQ ID NO.1), (SEQ ID NO.2), and (SEQ ID NO.3). Total RNA was extracted from soybean root tissue and reverse transcribed into cDNA. Using this cDNA as a template, full-length CDS cloning was performed using the specific primers corresponding to the three genes: NAC133-F (SEQ ID NO.4), NAC133-R (SEQ ID NO.5), C2H2-F (SEQ ID NO.6), C2H2-R (SEQ ID NO.7), PET6-F (SEQ ID NO.8), and PET6-R (SEQ ID NO.9). The amplification enzyme used was KOD One from Toyobo (Shanghai) Biotechnology Co., Ltd. TM The PCR Master Mix-Blue high-fidelity enzyme, amplification system, and procedure are shown in Tables 1 and 2. Amplification products were separated by agarose gel electrophoresis. Fragments with expected lengths were purified by gel extraction and sequenced for verification, indicating successful amplification. GmNAC133 , GmC2H2 and GmPET6 Three full-length gene segments.

[0031] SEQ ID NO.4: GTACCCGGGGATCCTCTAGAATGGGAGGGGCAACACTG; SEQ ID NO.5: CCCTTGCTCACCATGTCGACGAAGGGTTCAGGATATGAGATT; SEQ ID NO.6: GTACCCGGGGATCCTCTAGAATGGCCTTAAATTCTCCAAACTC; SEQ ID NO.7: CCCTTGCTCACCATGTCGACGCTAGCTACAGGCTCCAATTTGA; SEQ ID NO.8: GTACCCGGGGATCCTCTAGAATGGAAACCCTTATTGGAAAAACA; SEQ ID NO.9: CCCTTGCTCACCATGTCGACCAGGCCAGAGGTAAATG.

[0032] Table 1 KOD enzyme amplification system

[0033] Table 2 KOD enzyme amplification program

[0034] (2) Overexpression GmNAC133 , GmC2H2 , GmPET6 Construction of single-gene plant expression vectors Using the restriction endonuclease XbaI purchased from NEB to... pRUBY The vector (purchased from Shanghai Newp Biotechnology Co., Ltd., catalog number: V001191) was digested with a single enzyme according to the reaction system shown in Table 3. After incubation at 37℃ for 2 hours, the digested fragments were obtained. The digestion effect was detected by gel electrophoresis, and the linearized vector was recovered from the gel. The full-length CDS sequence of the gene with homologous arms obtained in step (1) was then compared with the linearized vector. pRUBY The vectors were subjected to homologous recombination reactions using the OK Clon DNA ligation kit purchased from Acori Biotech, and the following structures were constructed. pRUBY-p35S::GmNAC133 , pRUBY-p35S::GmC2H2 and pRUBY-p35S::GmPET6 Overexpression vectors. The homologous recombination reaction system and procedure are shown in Tables 4 and 5. The above overexpression vectors were transformed into *E. coli* DH5α competent cells, evenly spread on LB solid medium containing kanamycin, and incubated overnight at 37°C with inverted incubation. After colony PCR identification of positive clones, positive clones were picked and inoculated into LB liquid medium containing kanamycin, incubated overnight at 37°C with shaking, and then subjected to Sanger sequencing. Plasmids were extracted from the correctly sequenced bacterial cultures, indicating successful construction of the plant expression vector.

[0035] Table 3 Enzyme digestion system of the vector

[0036] Table 4. Systems of homologous recombination reactions

[0037] Table 5. Procedure for homologous recombination reactions

[0038] (3) Preparation of recombinant Agrobacterium The plant expression vector constructed in step (2) was transformed into Agrobacterium rhizogenes K599 competent cells, plated onto LB solid medium containing streptomycin and kanamycin resistance, and incubated upside down at 28°C for 2 days. After being identified as a positive clone by colony PCR, the cells were stored in glycerol at a final concentration of 15%.

[0039] (4) Construction of hybrid transgenic soybean plants with single gene overexpression Hybrid transgenic soybean plants were obtained using a soybean hairy root transformation method based on the RUBY reporter gene (see patent application No. 202411446546X, entitled "Method for High-Throughput Visual Screening of Soybean Salt Tolerance Related Genes"). The specific method is as follows: ① Preparation of soybean seedlings: Select plump, healthy soybean seeds and sterilize their surface using chlorine fumigation. Sow the sterilized seeds in a sterilized mixture of soil and vermiculite (1:1 ratio) at a depth of 1.5 cm, and water thoroughly with sterile water. Cultivate for 6 days until true leaves are about to unfold, then select healthy seedlings with uniform growth for later use.

[0040] ② Activation of recombinant Agrobacterium: Take the recombinant Agrobacterium K599 glycerol obtained in step (3), streak it onto solid LB medium (containing 50 mg / L kanamycin and 25 mg / L streptomycin), and incubate it upside down at 28°C for 2 days.

[0041] ③ Amplification of recombinant monoclonal antibodies: Pick a single colony and inoculate it into 5 mL of liquid LB medium (containing the same antibiotic), and culture overnight at 28°C and 200 rpm with shaking.

[0042] ④ Colony preparation: Take 200 μL of overnight culture and spread it evenly on solid LB medium (containing the same antibiotic) with a sterile glass rod. Continue to incubate overnight at 28°C for later use.

[0043] ⑤ Infection: Hold the soybean seedling 0.5 cm below the cotyledon node with your left hand, and with a sterile and sharp scalpel in your right hand, cut off the hypocotyl at a 45° angle. Dip the fresh cut of the hypocotyl into the recombinant Agrobacterium colonies from the plate in step ④, and spread the bacteria evenly on the cut surface.

[0044] ⑥ Co-cultivation and induction: Insert the infected seedlings into pre-drilled vermiculite substrate and gently compact them with surrounding vermiculite. Cover with high-pressure PE high-transmittance plastic wrap to maintain humidity. Use recombinant Agrobacterium liquid culture (OD2000) 600 Water the seedlings with approximately 0.6~1.0 g of water every 2 days, for a total of 2 times. After that, switch to Hogland's nutrient solution for irrigation. Cultivation conditions: light intensity 2000~2500 lx, photoperiod 16 h light / 8 h dark, temperature 25±2℃.

[0045] ⑦ Screening and identification of transgenic roots: Nine hours after infection, the newly formed callus at the hypocotyl incision site was ruby ​​red, indicating successful expression of the RUBY reporter gene. Culture continued for 15 days, and red hairy roots grew from the incision site. At this point, a hybrid soybean plant with non-transgenic aboveground parts and transgenic roots was obtained. The red hairy roots can be directly used for molecular identification (PCR, qRT-PCR) and subsequent analysis of salt and alkali tolerance.

[0046] 2. GmNAC133 , GmC2H2 , GmPET6 Alkali tolerance analysis of soybean plants with single-gene overexpression of three genes (1) Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Phenotypic analysis of soybean plants with single-gene overexpression of three genes Soybean plants with more than 70% red hairy roots were selected and transplanted into nutrient pots containing vermiculite and soil (1 part vermiculite: 1 part soil). The seedlings were irrigated with Hoagland's nutrient solution. Three days later, the mixed transgenic soybean plants were subjected to alkali stress with 75 mmol of alkaline solution (the molar ratio of Na2CO3 to NaHCO3 was 5:1). This alkali stress was repeated every three days until the end of the experiment. The control vector (EV) transgenic plants were subjected to the same alkali stress treatment. Phenotypic observation was performed when the control plants (EV) completely died.

[0047] The results showed that after 10 days of alkali stress treatment, all control plants (EV) wilted or died; while the converted plants... GmNAC133 Genes, transgenic GmC2H2 Genes and transgenics GmPET6 Only 10%, 12%, and 20% of the chimeric plants, respectively, experienced wilting. Figure 1 ), indicating that they are overexpressed separately GmNAC133 , GmC2H2 , GmPET6 Both single genes can significantly improve the plant's tolerance to alkaline stress.

[0048] (2) Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Chlorophyll content determination in soybean plants with single-gene overexpression of three genes According to the phenotypic analysis method in (1), GmNAC133 , GmC2H2 , GmPET6 Soybean plants with single-gene overexpression of the three genes and control plants (EV) were treated with alkali, and the chlorophyll content of the leaves of each plant was measured when the control plants (EV) died completely.

[0049] The chlorophyll content was determined as follows: A chlorophyll meter (Shandong Fangke Instruments, FK-YL04 model) was used to measure the chlorophyll content of different transgenic chimeric plants. First, the instrument was calibrated. After calibration, a soybean leaf was placed in the measurement position, and the measuring pressure head was pressed for 2-3 seconds. The display showed the chlorophyll value of the measured leaf, and a beep sounded simultaneously. The measuring pressure head was then released, and the value was recorded. Pressing the measuring pressure head again would begin the next measurement. Each leaf was measured three times, and the average value was taken as the chlorophyll content of that leaf. Ten leaves were measured for each soybean plant. The data were recorded and statistically analyzed.

[0050] The chlorophyll content determination results showed that under alkaline treatment (75 mmol), the chlorophyll content of the control plant (EV) was approximately 13 μg / mL, while that of the overexpressing plants was significantly higher. GmNAC133 , GmC2H2 , GmPET6 The chlorophyll content of the single-gene plants was 32 μg / mL, 23 μg / mL, and 20 μg / mL, respectively, which was significantly higher than that of the control plants, indicating that the transgenic chimeric plants had a higher chlorophyll content under alkaline treatment conditions. Figure 2 ).

[0051] (3) Under alkaline stress conditions GmNAC133 , GmC2H2 , GmPET6 Determination of plant height and biomass of soybean plants with single-gene overexpression of three genes According to the phenotypic analysis method in (1), GmNAC133 , GmC2H2 , GmPET6 Soybean plants overexpressing three genes and control plants (EVs) were treated with alkali (10 plants per group). Plant height and biomass were measured when the control plants (EVs) died completely. Plant height measurements showed that under alkali treatment (75 mmol), the average plant height of the control plants was approximately 14.5 cm, while the average height of the overexpressing genes was significantly higher. GmNAC133 , GmC2H2 , GmPET6The average plant heights of the transgenic chimeric plants were 19.8 cm, 17.3 cm, and 18.2 cm, respectively, significantly higher than those of the control plants. Figure 3 This indicates that transgenic chimeras overexpressing a single gene exhibited higher plant height under alkaline stress. Biomass measurements showed that under saline-alkali treatment (75 mmol), the average biomass of control plants was approximately 4.7 g, while the biomass of plants overexpressing the single gene was significantly higher. GmNAC133 , GmC2H2 , GmPET6 The average biomass of the transgenic chimeric plants was approximately 8.1 g, an increase of 72% compared to the control, significantly higher than that of the control plants. Figure 4 This indicates that transgenic chimeras overexpressing a single gene have higher biomass under alkaline stress conditions.

[0052] The above results indicate that GmNAC133 , GmC2H2 , GmPET6 Soybean plants overexpressing the three genes showed significantly improved alkali tolerance compared to control plants.

[0053] Example 2: GmC2H2 right GmNAC133 Analysis of expression regulation Construct using the method in Example 1 GmC2H2 Soybean plants overexpressing a single gene were created, and the resulting transgenic plants were divided into two groups. The seedlings were irrigated with 75 mmol alkaline solution (Na₂CO₃ to NaHCO₃ molar ratio of 5:1) and water for 14 days. After 24 hours of treatment, total RNA was extracted from the root tissues of both groups and reverse transcribed into cDNA. Using the cDNA as a template, according to... GmNAC133 Based on the CDS sequence, specific primers NAC133qPCR-F (SEQ ID NO.10) and NAC133qPCR-R (SEQ ID NO.11) were designed for real-time quantitative PCR (RT-qPCR) to analyze overexpression. GmC2H2 In this context, GmNAC133 Gene expression status. RT-qPCR was performed using the AceQ qPCRSYBR Green Master Mix (High ROX Premixed) kit purchased from Nanjing Novizan Biotechnology Co., Ltd. The reaction system is shown in Table 6. The results showed that, in overexpression... GmC2H2 In soybean root tissue, GmNAC133 Gene expression levels were significantly upregulated. Figure 5 ),show GmC2H2 Can be activated GmNAC133 Gene expression.

[0054] SEQ ID NO.10: CTGTCCAAGGGATCGCAAGT; SEQ ID NO. 11: AGGGGCCCTTCCAAGATAGA.

[0055] Table 6 RT-qPCR reaction system

[0056] Example 3: GmNAC133 and GmPET6 Interaction analysis 1. Construction of yeast one-hybrid (Y1H) vector Cloned using Example 1 GmNAC133 Full-length CDS segment and GmPET6 Using the promoter sequence (SEQ ID NO. 12) as a template, specific primers NAC133-pB42AD-F (SEQ ID NO. 13) and NAC133-pB42AD-R (SEQ ID NO. 14), and proPET6-pLaczi-F (SEQ ID NO. 15) and proPET6-pLaczi-R (SEQ ID NO. 16) were used to amplify the sequence containing homologous arms. GmNAC133 Full-length CDS segment and GmPET6 Promoter fragment. The amplification enzyme used was KOD One from Toyobo (Shanghai) Biotechnology Co., Ltd. TM The PCR Master Mix-Blue high-fidelity enzyme, amplification system, and procedure are shown in Tables 1 and 2. Amplification products were separated by agarose gel electrophoresis, and fragments were purified by gel recovery.

[0057] SEQ ID NO.13: CAGAGGAGGACCTGCATATGATGGGAGGGGCAACACTG; SEQ ID NO.14: CGACGGATCCCCGGGAATTCTTAGAAGGGTTCAGGATATGAGATT; SEQ ID NO.15: TACCAGATTACGCTCATATGATGGAAACCCTTATTGGAAAAACA; SEQ ID NO. 16: TGCCCACCCGGGTGGAATTCTCACAGGCCAGAGGTAAATGGCAC.

[0058] The pB42AD and pLaczi vectors were double-digested using restriction endonucleases NdeI and EcoRI (purchased from NEB), according to the reaction system shown in Table 7. After incubation at 37°C for 2 hours, the digested fragments were obtained. The digestion efficiency was assessed by gel electrophoresis, and the linearized vector was recovered from the gel. The amplified vectors with homologous arms were then... GmNAC133 The full-length CDS sequence of the gene was homologously recombinated with the linearized pB42AD vector, resulting in a gene containing homologous arms. GmPET6 The promoter fragment was homologously recombinated with the linearized pLaczi vector to construct yeast one-hybrid vectors pB42AD::GmNAC133 and pLaczi::GmPET6, respectively. Homologous recombination was performed using the OK Clon DNA ligation kit purchased from Acori Biotech. The homologous recombination reaction system and procedure are shown in Tables 4 and 5. The obtained yeast one-hybrid vectors were transformed into *E. coli* DH5α competent cells, evenly spread on LB solid medium containing kanamycin, and incubated overnight at 37°C with inverted incubation. After colony PCR identification of positive clones, positive clones were picked and inoculated into liquid LB medium containing kanamycin, incubated overnight at 37°C with shaking, and then subjected to Sanger sequencing. Plasmids were extracted from the correctly sequenced bacterial cultures, indicating successful construction of the yeast one-hybrid vectors.

[0059] Table 7 Enzyme digestion system of the vector

[0060] 2. Co-transformation and one-hybrid experiments The correctly sequenced yeast one-hybrid vector plasmid was co-transformed into competent yeast cells EGY48 (purchased from Cooler Master CAT#: CC302) according to the transformation combinations shown in Table 8. The transformed system was evenly spread on SD / -Ura-Trp solid medium (purchased from Cooler Master CAT#: PM2221) and incubated upside down at 30℃ for 3-5 days, observing colony growth. Single colonies from the SD / -Ura-Trp solid medium were picked and diluted in sterile water, then spotted onto chromogenic plates (containing X-α-Gal) and incubated at 30℃ for 3-5 days, observing colony growth.

[0061] The results of co-transformation and one-hybrid experiments showed that white colonies grew in the experimental group and the positive control group (pB42AD-PC, pLaczi-PC), while no white colonies grew in the negative control group, indicating that... GmNAC133 and GmPET6 Promoters have interaction relationships ( Figure 6 ).

[0062] Table 8 Co-transformation Combinations

[0063] Example 4: GmNAC133 , GmC2H2 , GmPET6 Alkali tolerance analysis of soybeans with three-gene tandem overexpression 1. GmNAC133 , GmC2H2 , GmPET6 Construction of a three-gene tandem plant expression vector (1) With homologous arms GmNAC133 , GmC2H2 , GmPET6 Preparation of three gene fragments Total RNA was extracted from soybean root tissue and reverse transcribed into cDNA. Using this cDNA as a template, specific primers NAC133-3-F (SEQ ID NO.17) and NAC133-3-R (SEQ ID NO.18), C2H2-3-F (SEQ ID NO.19) and C2H2-3-R (SEQ ID NO.20), and PET6-3-F (SEQ ID NO.21) and PET6-3-R (SEQ ID NO.22) were used to... GmNAC133 , GmC2H2 , GmPET6 The three gene fragments were amplified separately to obtain single gene fragments with homologous arms.

[0064] SEQ ID NO.17: GTACCCGGGGATCCTCTAGAATGGGAGGGGCAACACTGCCA; SEQ ID NO.18: TACAGCTCGTCCATGCATGGGGAAGAAGAAGGATAAAATCG; SEQ ID NO.19: AGAAGAGAACCCCGGGCCTATGGCCTTAAATTCTCCAAACTCC; SEQ ID NO.20: GCGTAATCTGGAACATCGTGCTAGCTACAGGCTCCAATT; SEQ ID NO.21: AGGAAAATCCTGGCCCCATGGAAACCCTTATTGGAA; SEQ ID NO. 22: TACGAACGAAAGCTCTGCAGTCACAGGCCAGAGGTAAATGGCAC.

[0065] (2) P2A annealing Annealing primers were designed using two P2A sequences, P2A-1 (nucleotide sequence shown in SEQ ID NO. 33) and P2A-2 (nucleotide sequence shown in SEQ ID NO. 34), to ligate three single gene fragments. The primers used were P2A-1-F (SEQ ID NO. 23), P2A-1-R (SEQ ID NO. 24), P2A-2-F (SEQ ID NO. 25), and P2A-2-R (SEQ ID NO. 26). The annealing system is shown in Table 9. The homogeneously mixed system was slowly cooled from 94℃ to 16℃, maintaining a ramp of 0.1, for a reaction time of 4 min. The reaction products were the double-stranded P2A-1 and P2A-2 fragments.

[0066] SEQ ID NO.23: GGTAGCGGAGCTACCAATTTTAGCCTCCTTAAGCAGGCAGGTGATGTAGAAGAGAACCCCGGGCCT; SEQ ID NO.24: AGGCCCGGGGTTCTCTTCTACATCACCTGCCTGCTTAAGGAGGCTAAAATTGGTAGCTCCGCTACC; SEQ ID NO.25: GGATCCGGAGCAACCAACTTTAGCCTGCTCAAGCAAGCAGGAGATGTTGAGGAAAATCCTGGCCCC; SEQ ID NO.26: GGGGCCAGGATTTTCCTCAACATCTCCTGCTTGCTTGAGCAGGCTAAAGTTGGTTGCTCCGGATCC; SEQ ID NO.33: GGTAGCGGAGCTACCAATTTTAGCCTCCTTAAGCAGGCAGGTGATGTAGAAGAGAACCCCGGGCCT; SEQ ID NO.34: GGATCCGGAGCAACCAACTTTAGCCTGCTCAAGCAAGCAGGAGATGTTGAGGAAAATCCTGGCCCC.

[0067] Table 9. Annealing reaction system

[0068] (3) Construction of GmNAC133-P2A-1-GmPET6 intermediate vector Will pRUBY The vector was double-digested with XbaI and PstI, the digestion system is shown in Table 7 (the only difference is the restriction enzyme). After incubation at 37℃ for 2 hours, the digested fragments were obtained. Gel electrophoresis was used to detect the digestion efficiency, and the linearized vector was recovered from the gel. Homologous recombination was then used to... GmNAC133 , P2A-1 , GmPET6 Fragments and linearization pRUBY The vector was ligated, and the ligation system is shown in Table 10, while the ligation procedure is shown in Table 5. The ligated system was transformed into *E. coli* DH5α competent cells, evenly spread on LB solid medium containing kanamycin, and incubated overnight at 37°C with the medium inverted. After colony PCR identification of positive clones, positive clones were picked and inoculated into LB liquid medium containing kanamycin, incubated overnight at 37°C with shaking, and then subjected to Sanger sequencing. Plasmid extraction was performed on the correctly sequenced bacterial cultures, resulting in the successful construction of the GmNAC133-P2A-1-GmPET6 intermediate expression vector.

[0069] Table 10 Homologous recombination reaction system

[0070] (4) Construction of the GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2 three-gene polymerase vector The intermediate vector constructed in (3) was amplified by PCR using specific primers NAC-F (SEQ ID NO.27) and PET-R (SEQ ID NO.28) to obtain a double gene polymerase fragment with homologous arms. This fragment was then combined with the P2A-2 fragment. GmC2H2 Fragments, linearization pRUBY The vector was ligated via homologous recombination. The ligation system is shown in Table 10, and the ligation procedure is shown in Table 5. The ligated system was transformed into *E. coli* DH5α competent cells, evenly spread on LB solid medium containing kanamycin, and incubated overnight at 37°C with inverted incubation. After colony PCR identification of positive clones, positive clones were picked and inoculated into LB liquid medium containing kanamycin, incubated overnight at 37°C with shaking, and Sanger sequencing was performed. Plasmid extraction was performed on the correctly sequenced bacterial cultures, resulting in the successful construction of the GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2 three-gene polymer vector.

[0071] SEQ ID NO.27: GTACCCGGGGATCCTCTAGAATGGGAGGGGCAACACTGCCA; SEQ ID NO.28: TACGAACGAAAGCTCTGCAGCAGGTCCTCCTCTGAGATCAGCTTCTGCTC.

[0072] 2. Construction of GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2 three-gene polymerized transgenic chimeric plants (1) Preparation of recombinant Agrobacterium The constructed three-gene polymerase vector was transformed into Agrobacterium rhizogenes K599 competent cells, plated onto LB solid medium containing streptomycin and kanamycin resistance, and incubated upside down at 28°C for 2 days. After colony PCR identification of positive clones, the cells were stored in 15% glycerol.

[0073] (2) Obtaining three-gene-integrated transgenic chimeric plants The constructed three-gene polymerase vector was transformed into soybeans using the soybean hairy root transformation method based on the RUBY reporter gene in Example 1, and three-gene polymerase hybrid soybean transformed plants with red transgenic hairy roots were obtained.

[0074] 3. Alkali tolerance analysis of GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2 three-gene polymerized transgenic chimeric plants (1) Identification of alkali-tolerant phenotypes in three-gene-integrated transgenic chimeric plants Soybean plants with more than 70% red hairy roots were selected and transplanted into seedling pots containing vermiculite and soil (1 part vermiculite: 1 part soil). The seedlings were irrigated with Hoagland's nutrient solution. Three days later, the mixed transgenic soybean plants were subjected to alkali stress with 75 mmol alkali solution (the molar ratio of Na2CO3 to NaHCO3 was 5:1). Each pot was irrigated with 200 mL of 75 mmol alkali solution every three days until the end of the experiment. The blank vector (EV) transgenic plants were subjected to the same alkali stress treatment. When the control plants (EV) died completely, phenotypic observation was performed.

[0075] The results showed that after 10 days of alkali stress treatment, all control plants (EV) wilted or died. However, only 6% of the transgenic chimeric plants expressed using the GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2 three-gene polymeric plant expression vector wilted. Figure 7 ).

[0076] (2) Under alkaline stress conditions GmNAC133-P2A-GmPET6-P2A2-GmC2H2 Chlorophyll content determination in three-gene-polymerized transgenic chimeric plants According to the phenotypic identification method in (1), GmNAC133-P2A-GmPET6-P2A2-GmC2H2Trigene-polymerized chimeric plants (hereinafter collectively referred to as "trigene-polymerized transgenic plants") and control plants (EVs) were treated with alkali, and the chlorophyll content of the leaves of each plant was measured when the control plants (EVs) were completely dead. The method for measuring chlorophyll content is described in Example 1.

[0077] The chlorophyll content determination results showed that under alkaline treatment (75 mmol), the chlorophyll content of the control plant (EV) was approximately 16 μg / mL, while the chlorophyll content of the trigene-polymerized transgenic plant was 36 μg / mL, significantly higher than that of the control plant. This indicates that the trigene-polymerized transgenic plant has a higher chlorophyll content under alkaline stress. Figure 8 ).

[0078] (3) Determination of plant height and biomass of transgenic plants with three-gene aggregation under alkaline stress The three-gene-polymer transgenic plants and control plants (EVs) were treated with alkali (10 plants per group) according to the phenotypic identification method in (1). The plant height and biomass of each plant were measured when the control plants (EVs) were completely dead. The plant height measurements showed that under alkali treatment (75 mmol), the average plant height of the control plants was approximately 15.6 cm, while the average plant height of the three-gene-polymer transgenic plants was 21.8 cm, significantly higher than that of the control plants. Figure 9 This indicates that the trigene-polymerized transgenic plants had higher plant height under alkaline stress. Biomass measurements showed that under alkaline treatment (75 mmol), the average biomass of the control plants was approximately 5.1 g, while the average biomass of the trigene-polymerized transgenic plants was approximately 9.7 g, an increase of 90% compared to the control, significantly higher than the control plants. Figure 10 This indicates that the three-gene-polymerized transgenic plants have higher biomass under alkaline stress conditions.

[0079] The above results indicate that the alkali tolerance of the three-gene-polymerized transgenic plants is significantly improved compared with that of the control plants.

[0080] (4) Comparative analysis of alkali tolerance between three-gene-integrated transgenic chimeric plants and single-gene-overexpressing chimeric plants Based on what has been obtained GmNAC133-P2A-GmPET6-P2A2-GmC2H2 Three-gene-polymerized transgenic chimeric plants and GmNAC133 , GmPET6 , GmC2H2 Alkali tolerance was compared among transgenic chimeric plants overexpressing a single gene. Analysis of phenotype, plant height, and biomass revealed that under alkali stress, both the tri-gene-overexpressing transgenic chimeric plants and the single-gene-overexpressing chimeric plants exhibited significantly higher alkali tolerance than the control plants (EV). Furthermore, the tri-gene-overexpressing transgenic chimeric plants showed greater alkali tolerance than any single-gene-overexpressing transgenic chimeric plant.Figure 11 Further analysis of plant height and biomass showed that the plant height and biomass of the trigene-integrated transgenic chimeric plants and the single-gene overexpression chimeric plants were significantly higher than those of the control plants (EV). Specifically, the plant height of the trigene-integrated transgenic chimeric plants was significantly higher than that of the control plants. GmNAC133 , GmPET6 , GmC2H2 Single-gene overexpression transgenic chimeric plants showed increases of 18%, 25%, and 28%, respectively, while the biomass of triple-gene conjugated transgenic chimeric plants was significantly higher than that of [other transgenic chimeric plants]. GmNAC133 , GmPET6, GmC2H2 Single-gene overexpression transgenic chimeric plants showed increases of 21%, 26%, and 21%, respectively. Figure 12 and Figure 13 These results indicate that combining multiple genes in the same pathway is superior to overexpressing a single alkali-tolerant gene in enhancing the alkali tolerance of transgenic chimeric soybean plants.

[0081] Comparative Analysis: Alkali Tolerance Analysis of Soybeans with Tandem Overexpression of Three Genes in Different Pathways To further clarify the importance of genes along the same pathway in multi-gene aggregation systems, previously identified salt-tolerance genes were used. GmXTH32 Known salt tolerance genes GmSOS1 and GmNAC133 Tandem polymerization was performed to compare the alkali tolerance of the transgenic chimeric soybean plants obtained by the two polymerization schemes in Example 4 and the comparative example.

[0082] 1. GmNAC133 , GmXTH32 , GmSOS1 Construction of a three-gene tandem vector Total RNA was extracted from soybean root tissue and reverse transcribed into cDNA. Using this cDNA as a template, specific primers NAC133-3-F (SEQ ID NO.17) and NAC133-3-R (SEQ ID NO.18), GmXTH32-3-F (SEQ ID NO.29) and GmXTH32-3-R (SEQ ID NO.30), and GmSOS1-3-F (SEQ ID NO.31) and GmSOS1-3-R (SEQ ID NO.32) were used to... GmNAC133 , GmXTH32 , GmSOS1 The three gene fragments were amplified separately to obtain single gene fragments with homologous arms. Using the construction method described in Example 4, which involved constructing the intermediate vector and the three-gene aggregation vector, homologous recombination was employed to... GmNAC133 , P2A-1 , GmXTH32 Fragments and linearization pRUBYThe vector was ligated to construct the intermediate expression vector GmNAC133-P2A-1-GmXTH32; the intermediate expression vector GmNAC133-P2A-1-GmXTH32 was amplified by PCR using specific primers to obtain a double gene polymer fragment with homologous arms, which was then combined with the P2A-2 fragment, GmSOS1 Fragments, linearization pRUBY The vectors were linked by homologous recombination to construct the three-gene aggregation vector GmNAC133-P2A-1-GmXTH32-P2A-2-GmSOS1.

[0083] SEQ ID NO.29: AGAAGAGAACCCCGGGCCTATGAGCACCAACTACCTACCC; SEQ ID NO.30: GCGTAATCTGGAACATCGTGGCATTCTGGAGTAAGTGTATGGTCT; SEQ ID NO.31: AGGAAAATCCTGGCCCCATGGAGGAAGAACAA; SEQ ID NO. 32: TACGAACGAAAGCTCTGCAGCTAGCGAAAAGATAGCGTGC.

[0084] 2. GmNAC133 , GmXTH32 , GmSOS1 Obtaining three-gene tandem transgenic chimeric soybean plants Recombinant Agrobacterium was constructed according to the method described in Example 4. The constructed three-gene polymerase vector GmNAC133-P2A-1-GmXTH32-P2A-2-GmSOS1 was transformed into soybeans using the soybean hairy root transformation method based on the RUBY reporter gene in Example 1, and three-gene polymerase hybrid soybean transformed plants with red transgenic hairy roots were obtained.

[0085] 3. Alkali resistance analysis Soybean plants with more than 70% red hairy roots were selected for alkali stress treatment (method as in Example 4). Comparison GmNAC133 , GmPET6 , GmC2H2 Three-gene tandem and GmNAC133 , GmXTH32 , GmSOS1 The phenotype of three-gene tandem transgenic soybean chimeric plants under alkaline stress was investigated. Results showed that after 10 days of alkaline stress treatment, all control (EV) plants wilted or died. In contrast, GmNAC133 , GmPET6 , GmC2H2Three-gene tandem transgenic soybean chimeric plants exhibited a significant alkali-tolerant phenotype; however, GmNAC133 , GmXTH32 , GmSOS1 Three-gene tandem transgenic soybean chimeric plants only showed a weak alkali tolerance phenotype. Figure 14 This indicates that aggregating multiple alkali-tolerant genes on the same regulatory pathway can effectively increase the alkali tolerance of transgenic chimeric soybean plants on the basis of a single alkali-tolerant gene. However, aggregating multiple genes on different pathways not only fails to superimpose the alkali tolerance effect of the genes, but also weakens the original alkali tolerance of a single alkali-tolerant gene, causing the plants to exhibit a sensitive response to alkali stress.

[0086] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A multi-gene tandem plant expression vector for improving alkali tolerance in soybeans, characterized in that, The multi-gene tandem plant expression vector comprises a pRUBY vector backbone, and sequentially tandemly connected... GmNAC133 Gene, first linker segment, GmPET6 Genes, second linker segments and GmC2H2 Genes; the stated GmNAC133 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.

1. GmPET6 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.

3. GmC2H2 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID NO.2; the nucleotide sequences of the first linker fragment and the second linker fragment are shown in SEQ ID NO.33 and SEQ ID NO.34, respectively.

2. The method for constructing the multi-gene tandem plant expression vector according to claim 1, characterized in that, Includes the following steps: S1. Total RNA was extracted from soybean root tissue and reverse transcribed into cDNA. Using this cDNA as a template, specific primer pairs were used to... GmNAC133 , GmC2H2 , GmPET6 The gene fragments were amplified separately to obtain three single gene fragments with homologous arms; S2. Design primers P2A-1-F and P2A-1-R for amplifying the first ligation fragment, and primers P2A-2-F and P2A-2-R for amplifying the second ligation fragment. After annealing, the two pairs of primers are used to obtain double-stranded P2A-1 and P2A-2 fragments, namely the first ligation fragment and the second ligation fragment. S3. The pRUBY vector is double-digested to obtain a linearized pRUBY vector, and the vector with homologous arms is then introduced via homologous recombination. GmNAC133 Gene fragments, P2A-1 Fragments, with homologous arms GmPET6 Gene fragments and linearization pRUBY The vectors are connected to obtain an intermediate expression vector; S4. Amplify the intermediate expression vector using specific primers to obtain a double-gene polymerized fragment with homologous arms. Combine this fragment with the P2A-2 fragment and a gene containing homologous arms. GmC2H2 Gene fragments and linearized pRUBY vectors were linked by homologous recombination to obtain the multi-gene tandem plant expression vector GmNAC133-P2A-1-GmPET6-P2A-2-GmC2H2.

3. The construction method according to claim 2, characterized in that, S1 is used to amplify cells with homologous arms. GmNAC133 The primer pairs for the gene fragment are shown in SEQ ID NO.17 and SEQ ID NO.18, and are used to amplify the gene fragment with homologous arms. GmC2H2 The primer pairs for the gene fragment are shown in SEQ ID NO.19 and SEQ ID NO.20, and are used to amplify the gene fragment with homologous arms. GmPET6 The primer pair sequences for the gene fragment are shown in SEQ ID NO.21 and SEQ ID NO.

22.

4. The construction method according to claim 2, characterized in that, The nucleotide sequences of P2A-1-F and P2A-1-R in S2 are shown in SEQ ID NO.23 and SEQ ID NO.24, and the nucleotide sequences of P2A-2-F and P2A-2-R are shown in SEQ ID NO.25 and SEQ ID NO.

26.

5. The construction method according to claim 2, characterized in that, The annealing reaction system described in S2 consists of 5 μL each of upstream and downstream annealing primers, 1 μL of 1 M Tris 8.0, 1 μL of 5 M NaCl, and ddH2O to a final volume of 50 μL. The annealing reaction conditions are: 94℃ slowly decreasing to 16℃, ensuring a ramp of 0.1, and a reaction time of 4 min.

6. The application of the multi-gene tandem plant expression vector of claim 1 in improving the alkali resistance of soybean.

7. The application according to claim 6, characterized in that, The multi-gene tandem plant expression vector was used to cultivate soybeans with improved alkali tolerance. Specifically, the multi-gene tandem plant expression vector was transformed into Agrobacterium tumefaciens, and then soybeans were transformed using a soybean hairy root transformation method based on the RUBY reporter gene to obtain hybrid soybean transformed plants with red transgenic hairy roots.

8. A recombinant bacterium containing the multi-gene tandem plant expression vector of claim 1.

9. The application of the recombinant bacteria according to claim 8 in improving the alkali resistance of soybeans.

10. A type of soybean, characterized in that, The soybean genome is integrated with the multi-gene tandem plant expression vector of claim 1.

Images