A primer probe set, kit, detection method and disease risk assessment method for detecting fusarium solani f. sp. glycines
By using specific primer and probe sets and risk assessment methods, the sensitivity and specificity issues in the detection of Fusarium wilt in tomatoes were resolved, enabling rapid and accurate disease early warning, reducing yield loss, and promoting early control of Fusarium wilt in tomatoes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2026-04-16
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies for detecting Fusarium wilt in tomatoes suffer from low sensitivity, insufficient specificity, cumbersome operation, and inability to provide early warnings, resulting in low detection efficiency and difficulty in timely disease control.
A rapid and accurate detection system was established by using a specific primer and probe set for qPCR amplification, combined with risk assessment methods. This system includes primer pair unif1/unir1 and probe Probe-fol-uni1, along with a matching kit and detection method, to achieve high sensitivity and specificity in identification. The disease risk was then assessed based on the number of Fusarium wilt bacteria.
It achieves highly sensitive and specific detection of Fusarium wilt in tomatoes, enabling early warning of diseases, reducing yield losses, and promoting the healthy and sustainable development of the tomato industry.
Smart Images
Figure CN122168790A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer and probe set, reagent kit, detection method, and disease risk early warning method for detecting Fusarium wilt of tomato. Background Technology
[0002] Fusarium wilt of tomatoes is mainly caused by infection with Fusarium wilt fungus. This pathogen overwinters in the soil and diseased plant debris in the form of mycelium and chlamydospores, and can survive for several years. It has a wide range of transmission routes and can cause tomato yield losses of more than 60% in severe cases, resulting in huge economic losses for growers.
[0003] Precise disease control begins with rapid and accurate pathogen detection. Currently, the detection methods for Fusarium wilt of tomato are mainly divided into two categories: traditional detection methods and molecular biological detection methods. Traditional detection methods mainly rely on Koch's postulates and morphological identification. Koch's postulates require steps such as pathogen isolation and purification, manual re-inoculation, and re-isolation and identification, which are cumbersome and time-consuming, usually taking several days or even weeks to complete, and cannot meet the needs of rapid field detection. Morphological identification relies on the professional experience of the operator to observe and distinguish the morphological characteristics of the pathogen, which is not only inefficient but also easily affected by environmental factors, resulting in large identification errors and the inability to distinguish closely related species and physiological races.
[0004] With the development of molecular biology techniques, PCR-related technologies have been widely used in the detection of Fusarium wilt of tomato. However, these methods still have many shortcomings: First, they lack specificity. Some primer designs do not target the specific conserved sequences of Fusarium wilt, making them prone to cross-reactions with other Fusarium species, leading to false positive results. Especially in complex matrices such as soil, inhibitor interference can further affect the accuracy of detection. Second, they have limited sensitivity. Conventional PCR has low sensitivity and cannot detect low concentrations of pathogens, making it difficult to detect diseases in their early stages. The sensitivity of existing real-time quantitative PCR still has room for improvement and cannot meet the need for trace detection of pathogens in the incubation period. Third, they are cumbersome to operate. Conventional PCR requires subsequent analysis such as gel electrophoresis after amplification, which is time-consuming and prone to errors. Some detection methods have high requirements for DNA extraction. For example, the traditional CTAB method is cumbersome and requires the use of toxic organic solvents, which is not conducive to rapid operation. Fourth, they are limited in function. Existing detection methods can only achieve qualitative or quantitative detection of Fusarium wilt of tomato. They cannot combine the detection results to scientifically assess the risk of Fusarium wilt in tomato, making it difficult to guide growers to take preventive measures in advance, resulting in the inability to contain the spread of the disease in a timely manner after it occurs. Summary of the Invention
[0005] The purpose of this invention is to provide a primer and probe set for Fusarium wilt of tomato, which can rapidly detect Fusarium wilt of tomato with high sensitivity and strong specificity.
[0006] The second objective of this invention is to provide a kit for detecting Fusarium wilt of tomatoes, which has good compatibility and is easy to operate.
[0007] The third objective of this invention is to provide a method for detecting Fusarium wilt in tomatoes, with a standardized and regulated testing process that ensures the accuracy of the test results.
[0008] The fourth objective of this invention is to provide a method for risk assessment of tomato wilt disease, enabling early warning and precise control of tomato wilt disease, thereby reducing yield loss.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] This invention provides a primer-probe set for detecting Fusarium wilt of tomato, including the specific primer pair unif1 / unir1 and the probe Probe-fol-uni1, the nucleotide sequences of which are as follows:
[0011] unif1: ATCATCTTGTGCCAACTTCAG (SEQ ID No.1);
[0012] unir1: GAGTAGTCAGTGACGCTGCAA (SEQ ID No. 2);
[0013] Probe-fol-uni1:FAM-GAGTCTGAATTGATTCATCGCCAAGC-MGB (SEQ ID No. 3).
[0014] The present invention provides a kit for detecting Fusarium wilt of tomato, the kit comprising the above-mentioned primer and probe set and PCR amplification reagent.
[0015] As one implementation method, the PCR amplification reagent is a 25 µL system, with the following composition: rTaq enzyme 0.5 µL, Mg 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primer pairs and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.
[0016] As one embodiment, the kit for detecting Fusarium wilt of tomato of the present invention further includes a positive control and a negative control. The positive control includes Fusarium wilt genomic DNA or plasmid DNA containing the target gene of Fusarium wilt corresponding to the above primer pair. The negative control does not contain Fusarium wilt genomic DNA or the target gene of Fusarium wilt corresponding to the above primer pair.
[0017] The present invention provides the application of the above-mentioned primer and probe set or the above-mentioned kit in the detection of Fusarium wilt of tomato.
[0018] The present invention also provides a method for detecting Fusarium wilt of tomato, wherein total DNA is extracted from the sample to be tested, and qPCR amplification is performed using the primer and probe set or kit described above. The sample that produces an amplified value is Fusarium wilt of tomato.
[0019] As one implementation method, the qPCR amplification conditions are: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.
[0020] This invention also provides a method for risk assessment of tomato wilt disease. Using the above method to detect *Fusarium oxysporum* in the soil, a low risk is indicated when the number of *Fusarium oxysporum* spores in the soil is below 1×10³ spores / gram of soil; a low risk is indicated when the number of *Fusarium oxysporum* spores is between 1×10³ and 1×10³ spores / gram of soil. 4 When the number of spores / grams of soil is between 100 and 100, it is considered medium risk; when the number of Fusarium wilt pathogens exceeds 1000, it is considered medium risk. 4 When the spore count is equal to the soil level, it indicates a high risk.
[0021] As one implementation method, when the number of Fusarium wilt bacteria in the soil is less than 1×10³ spores / gram of soil, the disease index of tomato wilt is less than 10; when the number of Fusarium wilt bacteria is between 1×10³ and 1×10³, the disease index of tomato wilt is less than 10. 4 When the number of spores / soil is between 10-25, the disease index of tomato wilt is 10-25; when the number of wilt fungi exceeds 1×10⁻⁶. 4 When the spore count is equal to the soil density, the disease index of tomato wilt is greater than 25.
[0022] Compared with the prior art, the present invention has the following advantages and effects:
[0023] (1) High sensitivity: qPCR amplification of *Fusarium oxysporum* using the primer and probe set of this invention achieved a detection sensitivity of 1 copy / μL. The detection sensitivity for *Fusarium oxysporum* in soil was 10. 3 copies / g soil.
[0024] (2) High specificity: The primer and probe set designed by this invention for Fusarium wilt of tomato can specifically identify Fusarium wilt of tomato. It has high specificity and can quickly and accurately complete the detection of Fusarium wilt of tomato.
[0025] (3) Based on the correlation analysis between the number of Fusarium wilt bacteria and the occurrence of tomato wilt, this invention establishes a risk assessment and early warning system for tomato wilt. This system has significant practical significance and application value for achieving early warning and precise control of tomato wilt, reducing yield losses, and promoting the healthy and sustainable development of the tomato industry. Attached Figure Description
[0026] Figure 1The amplification curves for the specific detection of *Fusarium oxysporum* tomato-specific strains in this invention are shown. The red curve at the peak represents the genome of *Fusarium oxysporum* (tomato-specific strain), while the remaining green curves represent *Fusarium oxysporum* wilt-specific strain, *Fusarium oxysporum* cucumber-specific strain, *Fusarium oxysporum* winter melon-specific strain, *Fusarium oxysporum* watermelon-specific strain, *Fusarium oxysporum* tobacco-specific strain, *Fusarium oxysporum* pepper-specific strain, *Fusarium oxysporum* sunflower-specific strain, *Fusarium graminearum*, and *Fusarium pseudograminearum*.
[0027] Figure 2 This is the standard curve for the tomato wilt bacterium of the present invention.
[0028] Figure 3 The correlation between the amount of Fusarium wilt bacteria in the soil and the occurrence of the disease.
[0029] Figure 4 The relationship between soil inoculation amount and the number of Fusarium wilt bacteria detected (left), Fusarium wilt disease index (middle), and tomato yield (right) is shown. Among them, 1. Soil inoculation amount is 10 kg / row; 2. Soil inoculation amount is 2 kg / row; 3. Soil inoculation amount is 0.4 kg / row; 4. Soil is not artificially inoculated. Detailed Implementation
[0030] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0031] Example 1
[0032] Specificity of Fusarium oxysporum primer and probe set
[0033] In this embodiment, a set of specific primers unif1 / unir1 and probe Probe-fol-uni1 for the specific detection of Fusarium oxysporum (Tomato-specific strain) were screened and optimized, as follows:
[0034] unif1: ATCATCTTGGTGCCAACTTCAG,
[0035] unir1: GAGTAGTCAGTGACGCTGCAA,
[0036] Probe-fol-uni1:FAM-GAGTCTGAATTGATTCATCGCCAAGC-MGB).
[0037] Using DNA from Fusarium wilt of tomato and other common soil-borne pathogens as templates, qPCR was used to amplify the DNA and verify the specificity of Fusarium wilt primers and probes.
[0038] The PCR amplification system was a 25 µL system, and the contents were as follows: rTaq enzyme 0.5 µL, Mg 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primers and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.
[0039] The qPCR amplification conditions were: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.
[0040] The results showed that qPCR amplification using only *Fusarium oxysporum* DNA as a template produced amplification values, while amplification using DNA from other pathogens as templates did not produce detection values. Figure 1 This indicates that the specific primers and probes used to detect Fusarium wilt of tomato have high specificity.
[0041] Example 2
[0042] Sensitivity determination of the detection system
[0043] Using the genome of *Fusarium oxysporum* as a template, amplification was performed using the specific primer and probe set from Example 1. The amplified product was purified and cloned into the vector pMD18-T. The vector was then transformed into *Escherichia coli* DH5α competent cells by heat shock transformation for propagation. The cells were plated on LB medium containing ampicillin for recombinant screening. PCR verification yielded a recombinant plasmid containing a *Fusarium oxysporum*-specific sequence.
[0044] The recombinant plasmid DNA was extracted and linearized by digestion with the restriction enzyme EcoRI. The digestion products were subjected to agarose gel electrophoresis, and the corresponding fragments were recovered by gel extraction. The fragments were recovered using the Promega Gel Extraction Kit. The DNA concentration of the recombinant plasmid was determined using a Thermo Fisher Nanodrop 2000 spectrophotometer, and the copy number of the recombinant plasmid DNA was calculated according to the formula.
[0045] The above plasmid vector was diluted to 1×10⁻⁶ using ddH₂O. 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1 copy / μL dilution buffer. Using the serially diluted DNA as templates, real-time quantitative PCR was performed using TaqMan fluorescent probes to establish a standard curve of plasmid copy number versus Ct value. Figure 2 ).
[0046] By quantitatively adding Fusarium wilt spores of tomato to the soil and mixing thoroughly, concentrations of 0 and 10 were prepared. 1 10 2 10 3 10 4 10 5 10 6 10 7 Soil DNA was extracted from spores / gram of inoculum, and the soil DNA was detected using an established qPCR detection system to determine the sensitivity of the primers for detecting soil DNA.
[0047] The results showed that within the measured range, when the content of Fusarium wilt in the soil was less than 10... 3 Spores / gram of soil, no signal detected; when the inoculum reaches 10... 3 Stable amplification signals can be obtained when the spore count / gram soil concentration is 10 or higher. The results indicate that the established quantitative detection system for *Fusarium oxysporum* in tomato soil has a detection sensitivity of 10-1. 3 copies / g soil.
[0048] Table 1. Soil DNA qPCR detection at different inoculum amounts
[0049]
[0050] Example 3
[0051] Correlation between the amount of Fusarium wilt in soil and disease occurrence
[0052] 1. Pot Experiment. Under greenhouse conditions, a suspension of Fusarium wilt spores was prepared and evenly mixed into sterilized dry soil (soil: substrate: vermiculite = 1:1:1) to create a culture with a bacterial load of 10. 6 Spores / gram of soil, 10 5 Spores / gram of soil, 10 4 Spores / gram of soil, 10 3 Diseased soil containing spores / gram of soil was used, with soil without added *Fusarium wilt* serving as a blank control. Well-cultivated plug seedlings were transplanted into pots containing soils with different pathogen loads. At transplanting, 100 grams of soil from each gradient was retained to determine the initial pathogen content in the soil. Disease occurrence was investigated after 20 days of greenhouse cultivation to clarify the relationship between initial soil pathogen load and the occurrence of tomato *Fusarium wilt*.
[0053] Disease investigation grading standards: Grade 0: No symptoms; Grade 1: 1 or 2 cotyledons are obviously yellowed and fall off; Grade 2: 3 or 4 true leaves turn yellow and wilt and droop; Grade 3: 5 or 6 true leaves turn yellow or wilt and droop; Grade 4: The whole plant is severely wilted and dies.
[0054] Disease index = ∑ (number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest representative value) × 100.
[0055] The results showed that the incidence threshold for tomato wilt was 10. 4 Spores / gram of soil, and as the number of pathogens in the soil increases, the incidence index of Fusarium wilt increases ( Figure 3 ).
[0056] 2. Plot Experiment. Before transplanting tomatoes, different amounts of wheat grains carrying Fusarium wilt (10 kg / row, 2 kg / row, 0.4 kg / row) were inoculated into the soil. After mixing, the initial inoculum level in the soil was measured, with soil not inoculated with Fusarium wilt serving as a control. After transplanting, tomatoes were managed with normal water and fertilizer. After the plants developed symptoms, the disease index and yield were investigated.
[0057] The results showed that the number of pathogens in the soil was directly proportional to the initial inoculum size; the larger the inoculum size, the higher the number of pathogens and the disease index in the soil. Figure 4 (Left and middle images), while tomato yield decreases with increasing inoculation amount ( Figure 4 (The right image in the image).
[0058] In summary, the content of Fusarium wilt bacteria in the soil is 10. 4 The spore / gram soil concentration is the threshold for the development of tomato wilt disease. Within a certain range, the number of pathogens in the soil is directly proportional to the disease index of tomato wilt and inversely proportional to tomato yield. An early warning system for tomato wilt disease has been preliminarily established.
[0059] Example 4
[0060] Tomato Fusarium wilt disease risk assessment and early warning system
[0061] Based on the correlation analysis between the abundance of *Fusarium oxysporum* in the soil and the occurrence of *Fusarium oxysporum* disease, a risk assessment and early warning system for *Fusarium oxysporum* disease was established. Specifically, when the abundance of *Fusarium oxysporum* in the soil is below 1×10⁻⁶... 3 When the spore count / gram of soil is less than 10, the risk of occurrence of tomato wilt is defined as low; when the number of wilt fungi is 1×10⁻⁶, the risk of occurrence is defined as low. 3 ~1×10 4 When the number of spores / soil particles is between 10 and 25, the disease index for tomato wilt is 10-25, which is defined as a medium risk; however, when the number of Fusarium wilt pathogens exceeds 1×10⁻⁵... 4 When the spore count is high (e.g., spores per gram of soil), the occurrence of tomato wilt is severe, defined as high risk. The establishment of this early warning system provides an effective disease prediction tool for tomato cultivation, helping farmers to take appropriate control measures in the early stages, thereby reducing the impact of diseases on crop yield and quality.
[0062] Table 2 Risk Assessment of Tomato Fusarium Wilt
[0063]
[0064] The above embodiments are the best implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A primer and probe set for detecting Fusarium wilt of tomato, characterized in that, It includes a specific primer pair unif1 / unir1 and a probe Probe-fol-uni1, the nucleotide sequence of which is shown in SEQ ID No.1, the nucleotide sequence of which is shown in SEQ ID No.2, and the nucleotide sequence of which is shown in SEQ ID No.
3.
2. A kit for detecting Fusarium wilt of tomato, characterized in that, The kit includes the primer and probe set and PCR amplification reagents as described in claim 1.
3. The reagent kit according to claim 2, characterized in that, It also includes a positive control and a negative control. The positive control includes Fusarium wilt genomic DNA or plasmid DNA containing the primer pair of claim 1 corresponding to the target gene of Fusarium wilt genomic DNA. The negative control does not contain Fusarium wilt genomic DNA or the primer pair of claim 1 corresponding to the target gene of Fusarium wilt genomic DNA.
4. The kit according to claim 2 or 3, characterized in that, The PCR amplification reagent was prepared in a 25 µL system, as follows: rTaq enzyme 0.5 µL, Mg... 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primer pairs and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.
5. The application of the primer and probe set according to claim 1 or the kit according to any one of claims 2 to 4 in the detection of Fusarium wilt of tomato.
6. A method for detecting Fusarium wilt of tomato, characterized in that, Total DNA was extracted from the sample to be tested and amplified by qPCR using the primer and probe set described in claim 1 or the kit described in any one of claims 2 to 4. The sample that produced an amplified value was identified as Fusarium oxysporum tomatoense.
7. The method for detecting Fusarium wilt of tomato according to claim 6, characterized in that, The qPCR amplification conditions were: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.
8. A method for risk assessment of tomato wilt disease, characterized in that, The method described in claim 6 is used to detect Fusarium wilt in soil. When the number of Fusarium wilt in soil is less than 1 × 10⁻⁶, 3 When the number of spores / gram of soil is low, the risk is low; when the number of Fusarium wilt pathogens is 1×10⁻⁶, the risk is low. 3 ~1×10 4 When the number of spores / grams of soil is between 100 and 100, it is considered medium risk; when the number of Fusarium wilt pathogens exceeds 1000, it is considered medium risk. 4 When the spore count is equal to the soil level, it indicates a high risk.
9. The method according to claim 8, characterized in that, When the number of Fusarium wilt bacteria in the soil is less than 1×10 3 When the number of spores / gram of soil is less than 10, the disease index of tomato wilt is less than 10; when the number of Fusarium wilt fungi is 1×10⁻⁶. 3 ~1×10 4 When the number of spores / soil is between 10-25, the disease index of tomato wilt is 10-25; when the number of wilt fungi exceeds 1×10⁻⁶. 4 When the spore count is equal to the soil density, the disease index of tomato wilt is greater than 25.