Molecular marker of a negative regulatory gene of rice seed dormancy and storage tolerance SAG9 and application thereof

By developing a molecular marker for SAG9, a gene that negatively regulates rice seed dormancy and storage tolerance, and using primers for PCR amplification, the problem of simultaneously regulating seed dormancy and storage tolerance was solved, enabling rapid identification and efficient breeding, and reducing breeding costs and difficulties.

CN122168791APending Publication Date: 2026-06-09NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610534952.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-22
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In existing technologies, there are few genes related to rice seed dormancy and storage tolerance, and they are difficult to regulate synchronously. This limits the application of these genes, makes seed storage tolerance identification cumbersome, and makes it difficult to develop molecular markers for key natural variations in the SAG9 coding region, resulting in high breeding difficulty and cost.

Method used

Molecular markers for SAG9, a gene negatively regulating rice seed dormancy and storage tolerance, were developed. PCR amplification was performed using primers SAG9-CTC-F and SAG9-CTC-R. By detecting the difference between 687 bp and 493 bp amplified fragments, SAG9 haplotype typing was achieved, enabling rapid identification of seed dormancy and storage tolerance.

Benefits of technology

It enables rapid and accurate identification of seed dormancy and storage tolerance, reduces breeding cycle and cost, improves breeding efficiency, and simplifies the seed trait identification process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168791A_ABST
    Figure CN122168791A_ABST
Patent Text Reader

Abstract

This invention discloses a gene for identifying rice seed dormancy and storage tolerance regulatory genes. SAG9 This invention provides tightly linked molecular markers and their applications. The primer sequences and amplification product sequences provided by this invention are as follows: the primers are SAG9-CTC-F (SEQ ID NO.1), SAG9-CTC-R (SEQ ID NO.2), and SAG9-CTC-2F (SEQ ID NO.3); the amplification product sequence is the nucleotide sequence shown in SEQ ID NO.6 or SEQ ID NO.7. The molecular markers of this invention can efficiently and rapidly screen genes regulating rice seed dormancy and storage tolerance, thereby accelerating the breeding of new rice varieties with enhanced seed dormancy and storage tolerance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to a gene that negatively regulates rice seed dormancy and storage tolerance. SAG9 Molecular markers and their applications. Background Technology

[0003] With global warming, high temperature and humidity not only increase the risk of seed germination but also accelerate seed aging, seriously threatening food security. In production, methods such as controlled atmosphere storage, temperature control, and the use of chemical agents are often used to control storage conditions and slow down the rate of seed vigor decline, thus solving the problem of seed quality degradation to some extent. However, these methods also introduce other problems, such as high storage costs and chemical residues. In contrast, enhancing seed dormancy and storage tolerance through genetic improvement is a more economical, convenient, and sustainable approach. Therefore, breeding varieties with both strong dormancy and storage tolerance has become one of the important goals of rice breeding. Discovering, cloning, and utilizing new genes that can simultaneously regulate seed dormancy and storage tolerance, and developing reliable molecular markers for marker-assisted selection, lays a solid foundation for the breeding of new varieties.

[0004] To date, scholars both domestically and internationally have identified several rice seed dormancy-related factors (including...). SAG9 , GF14h , SD1 , SDR3.1 , Sdr4 , SD6 , Rc and QSOXL1 (etc.) or seed storage resistance related genes (including GH3-2 , SAG9 Studies have shown that weak dormancy alleles in most genes were selected during rice domestication, leading to a significant reduction in dormancy and storage tolerance in modern varieties. Multigene aggregation breeding is the most economical and effective method to improve seed dormancy and storage tolerance, ensuring stable grain yields and safe storage; however, the following problems still exist: First, there are few reports of cloning genes that simultaneously regulate seed dormancy and storage tolerance. Although several genes related to seed dormancy or storage tolerance have been reported, few have been reported to simultaneously regulate these two seed traits. This means that simultaneously improving seed dormancy and storage tolerance requires the joint selection and breeding of multiple genes, increasing the difficulty of breeding.

[0005] Second, it has been reported that genes are difficult to fully utilize. Among these, SD1 and Rc These genes not only regulate seed dormancy but are also related to plant height and seed coat color, respectively. The demand for semi-dwarf breeding and white seed coat selection is significantly stronger than their influence on seed dormancy, indicating weaker breeding potential in seed traits. Similarly, recently cloned dormancy-related genes... SD6 , SDR3.1 and QSOXL1 and storage tolerance-related genes GH3-2 Although natural variations exist, they only partially affect gene function. Their full application requires the use of gene editing or transgenic methods, thus limiting their application.

[0006] Third, the phenotypic identification of seed storage tolerance is cumbersome. The current identification of rice seed storage tolerance is mainly divided into germination identification after natural storage or artificial aging. Natural storage takes a long time, requiring at least two years of natural storage to show obvious differences. Although artificial aging can significantly reduce the aging time, it still takes about one month under the conditions of 40℃ and 80% relative humidity, making phenotypic identification quite cumbersome.

[0007] fourth, SAG9 Molecular markers for key natural variations in coding regions are difficult to develop. Although we have cloned and confirmed... SAG9 It can simultaneously negatively regulate seed dormancy and storage tolerance. Its loss-of-function haplotype (i.e., the deletion of the three bases "CTC" at CDS+663 in the coding region) is an excellent allele that can simultaneously enhance seed dormancy and storage tolerance. However, the "GC" content near its key natural variation site is high (the "GC" content accounts for 76.64% in a 685 bp region before and after the "CTC" site), making it difficult to design specific primers and develop molecular markers.

[0008] Therefore, continuously discovering new genes and developing high-precision molecular markers is the core strategy for breeding varieties with strong dormancy and strong storage resistance. Summary of the Invention

[0009] To address the aforementioned technical problems in the existing technology, the present invention aims to provide a gene that negatively regulates rice seed dormancy and storage tolerance. SAG9 Molecular markers and their applications.

[0010] The technical solution of this invention is as follows: The first objective of this invention is to provide a gene that negatively regulates rice seed dormancy and storage tolerance. SAG9 Detection primers for molecular markers, wherein the primers are: SAG9-CTC-F: 5'-GCGGCGATATGAACCAACAC-3' (SEQ ID NO. 1); SAG9-CTC-R: 5'- CACAAAGCCTCAGATCAGGAG-3' (SEQ ID NO. 2); SAG9-CTC-2F: 5'-CTGCTCAGCCCGCTCCCTCCTC-3' (SEQ ID NO. 3).

[0011] The second objective of this invention is to provide a method for detecting genes regulating dormancy and storage tolerance in rice seeds. SAG9 A molecularly labeled reagent, wherein the reagent includes the aforementioned primers.

[0012] A third objective of this invention is to provide the application of the aforementioned detection primers or reagents in identifying rice varieties with strong seed dormancy and storage tolerance.

[0013] Furthermore, the primers are used to amplify the rice material to be tested. If the primer pair can simultaneously amplify a 690 bp fragment and a 493 bp fragment, or only amplify the 493 bp fragment, then the rice material to be tested carries a normal functional carrier. SAG9 At this site, the rice variety exhibits dormancy and weak storage tolerance; when the primer pair can only amplify a 687 bp fragment, the rice material being tested carries a loss-of-function gene. SAG9 At this site, rice varieties exhibit strong dormancy and storage tolerance.

[0014] Furthermore, the nucleotide sequence of the 493 bp amplified fragment is shown in SEQ ID NO. 6; the nucleotide sequence of the 690 bp amplified fragment is shown in SEQ ID NO. 7; and the 687 bp amplified fragment is formed by deleting CTC at position 215 bp of the sequence shown in SEQ ID NO. 7, and its nucleotide sequence is shown in SEQ ID NO. 8. The beneficial effects of the technical solution of this invention are as follows: (1) This invention is the first to use Indel markers to identify genes that negatively regulate rice seed dormancy and storage tolerance. SAG9 Haplotype typing was performed.

[0015] (2) Molecular markers of the present invention SAG9 Haplotype typing is clear and easy to identify. By detecting this molecular marker, the dormancy and storage tolerance of rice seeds can be predicted. It can be used for genotyping of rice varieties or lines to determine whether the variety or line has stronger seed dormancy and storage tolerance, thereby quickly screening superior varieties or lines for rice breeding. The detection of major gene loci is convenient and rapid, and is not affected by the environment. (3) Assisted breeding has a clear selection objective and saves costs. In traditional breeding methods, it is necessary to first collect parents with strong dormancy and strong storage tolerance and conduct a series of hybridizations with cultivated varieties, and then select individual plants based on seed dormancy and storage tolerance. Identifying the phenotypic tolerance of rice seeds is complex, time-consuming, and affected by the plant's growth environment. By detecting major gene loci related to dormancy and storage tolerance, superior individual plants can be identified at the seedling stage, eliminating other plants, which not only saves production costs but also greatly improves selection efficiency.

[0016] (4) Using the markers provided by this invention to screen backcross populations can avoid tedious artificial aging and germination tests, shorten the breeding cycle by 3-4 generations, and significantly improve the aggregation efficiency of superior seed traits and high-yield and high-quality traits. This makes marker-assisted selection more convenient in the application of seed dormancy and storage tolerance breeding, and greatly improves the selection efficiency of new varieties. Attached Figure Description

[0017] Figure 1 Design the positions corresponding to primers SEQ IND NO.1-5.

[0018] Figure 2 SAG9 The genotyping performance of the molecular marker (primer set SAG9-1) in agarose gel electrophoresis was as follows: Marker: Trans2K® Plus II DNA Marker (8000), the closest amplified fragment was 250 bp; the theoretical size of the amplified fragments of Ningjing 7, Ningjing 6, Nipponbare, Ningjing 4, Ningjing 8 and Asominori was 493 bp, and the theoretical size of the amplified fragments of N22 and Kasalath was 687 bp.

[0019] Figure 3 Different genetic backgrounds SAG9 Construction and identification of knockout families. a, sgRNA target and sequencing results, red text indicates mutated bases; b, SAG9 amino acid sequence alignment results between wild-type and knockout families; Knockout represents knockout families in all backgrounds, whose amino acid sequences are similar; black shading indicates highly conserved amino acid sequences.

[0020] Figure 4 Seed storage tolerance phenotype verification of knockout families under a varietal background using the molecular marker SAG9-1 was performed. Nipponbare (a), Ningjing 4 (b), Ningjing 6 (c), Ningjing 7 (d), Ningjing 8 (e), and Asominori (f) were identified using the SAG9-1 marker as carriers of the gene. SAG9 Normal-functioning varieties; N22(g) and Kasalath(h) are detected as carriers. SAG9 Varieties with functional deficiencies. DOD: Days of artificial accelerated aging; MA: Months of natural storage.

[0021] Figure 5 Seed dormancy phenotype validation of knockout families in a varietal background using the molecular marker SAG9-1 was performed. Nipponbare (a), Ningjing 4 (b), Ningjing 6 (c), Ningjing 7 (d), Ningjing 8 (e), and Asominori (f) were identified as carrying the SAG9-1 marker. SAG9 Normal-functioning varieties; N22(g) and Kasalath(h) are detected as carriers. SAG9 Varieties with functional deficiencies. Detailed Implementation

[0022] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores. Example

[0024] (a) Major QTL loci related to seed storage tolerance qSS-9 Target gene SAG9 Cloning In the early stages of this experiment, populations were constructed using Nipponbare (a type of japonica rice that is not resistant to storage) and Kasalath (an Aus rice variety with extremely high storage tolerance), and a major-effect QTL was detected on chromosome 9. qSS-9 Further refinement allowed it to be located within the 147-Kb region. Further confirmation was achieved through gene editing and transgenic complementation experiments. SAG9 That is qSS-9 The target gene. SAG9 It also negatively regulates seed dormancy and storage tolerance, and the absence of CTC in its coding region (CDS+663) directly leads to loss of function.

[0025] (II) Development of Polymorphic Molecular Markers (1) SAG9 The InDel3 (CTCG / - - -G) coding region is key to determining the presence or absence of the encoded protein's function; that is, the protein loses its function when the "CTC" coding region is missing.

[0026] The amplification primers designed for this site are shown in Table 1.

[0027] Table 1. Molecular markers developed for InDel3 (GCTC / G- - -)

[0028] (2) Samples (leaves) of materials requiring genetic identification were taken, ground into powder under liquid nitrogen freezing, followed by cell lysis using CTAB and protein separation using chloroform:isoamyl alcohol (volume ratio 24:1); DNA was then precipitated by isopropanol freezing and washed with 70% ethanol. The concentration of the obtained DNA was determined and diluted with ddH2O to a working solution of 20-30 ng / μl.

[0029] (3) Molecular markers were amplified using PCR.

[0030] The reaction system consisted of 10 μL of the following: 0.2 μL KOD FX (Code No. KFX-101), 5 μL PCR Buffer for KOD FX, 2 μL dNTPs, 0.2 μM primers, and 1 μL DNA template.

[0031] The amplification reaction was performed on a LongGene A300 PCR instrument: 94℃ for 2 min; 98℃ for 10 sec, 68℃ for 30 sec, 68℃ for 40 sec, for 35 cycles; and finally 68℃ for 10 min followed by storage at 4℃.

[0032] (4) Molecular marker typing: PCR amplification products were detected by agarose gel electrophoresis. 1.2% Agar Gel was prepared, and after spotting the samples, the gel was typed at 150V for 15 min. Ethidium bromide was used for color development, and the results were observed using a UV gel spectrometer.

[0033] (5) Parents of each background and SAG9 Knockout family phenotyping Artificial aging treatment and storage tolerance assessment: Freshly harvested seeds were subjected to dry heat treatment in a 45℃ oven for 7 days to break seed dormancy. Subsequently, the seeds were placed in mesh bags and suspended in a constant temperature and humidity incubator (Nanjing Yan'ao Instrument Equipment Co., Ltd.; Model: LH-150), with the temperature set at 40℃ and relative humidity at 80%. After aging treatment for 28-34 days, the seeds were allowed to equilibrate at room temperature for 5 days before germination assessment. The germination rate after 7 days of imbibition represented the seed's storage tolerance level.

[0034] Natural storage treatment and storage tolerance assessment: Six large bags of seeds were collected from each family after removing impurities and sun-dried for 7 days to dry them and break their dormancy. Then, they were naturally stored indoors. Germination tests were conducted every 3 months in the early stage of storage. If the germination rate showed a significant downward trend, germination tests were conducted monthly. The germination rate after 7 days of imbibition represented the strength of the seed's storage tolerance.

[0035] Seed dormancy identification: Harvesting began 35 days after heading. Freshly harvested seeds were immediately subjected to a germination test. Germination rate was recorded 7 days after water absorption and germination. The average germination rate reflected the dormancy level; a higher germination rate indicated weaker dormancy, and vice versa. Molecular marker identification in this experiment showed that Nipponbare, Ningjing 4, Ningjing 6, Ningjing 7, Ningjing 8, and Asominori all amplified a 493 bp fragment, indicating they carried functionally normal markers. SAG9 Alleles ( Figure 2 ), using CRISPR / Cas9 technology to SAG9 After editing, the dormancy of knockout families was significantly enhanced. Figure 4 ).

[0036] (III) Results and Analysis: rice variety Nipponbare SAG9 While functionally normal, its seed dormancy and storage tolerance are relatively weak, particularly in Kasalath. SAG9 It exhibits functional loss, but its seeds have extremely strong dormancy and storage tolerance.

[0037] according to SAG9 The genome shows a differential site InDel3 between the two varieties. Three sets of primers were designed for this experiment (sequences are shown in Table 1; positions are shown in...). Figure 1 (SEQ ID NO.1 and SEQ ID NO.3 are the front primers, starting at -215 bp and -17 bp before InDel3, respectively; SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5 are the back primers, starting at +472 bp, +573 bp and +438 bp after InDel3, respectively) to develop suitable markers.

[0038] SEQ IN NO.1 and SEQ ID NO.3 are two F primers shared by all three primer sets. SEQ IN NO.1 perfectly matches the template regardless of whether "CTC" is missing or not. When "CTC" is missing, primer SEQ ID NO.3 cannot match the template because "CTC" overflows at its 3' end; however, when "CTC" is intact, it perfectly matches the template and completes amplification. SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.5 are the specific R primers for primer sets SAG9-1, SAG9-2, and SAG9-3, respectively.

[0039] After multiple rounds of experimental verification, the combination SAG9-1 (i.e. SEQ IN NO.1, SEQ ID NO.2 and SEQ ID NO.3) was finally determined to be the primer set with the highest amplification efficiency and the most obvious difference.

[0040] When the DNA template "CTC" is intact, primer set SAG9-1 can amplify a 493 bp fragment, while when the DNA template "CTC" is missing, primer set SAG9-1 can only amplify a 687 bp fragment. This SAG9-1 marker is highly distinctive, easily detected, and easily read, and can be directly amplified by lipoglycogel electrophoresis. Figure 2 ( ) is classified.

[0041] Sequencing revealed that the gene shown in SEQ ID NO.6 carries a normal function. SAG9The nucleotide sequence of the 493 bp amplified product is as follows: CTGCTCAGCCGCTCCCTCCTCGCCGGCGCGCTCCAGCCCGCGCGCCACCTGATGATCACCCTCGCCGCCGCCGCCGGCGGCGCTGCCGCAATAATGCCGCCGGGACCAGCGCCGGCGCCGGT GGCTCGGCGGCGGCGCTGCCGAGCAAGTCGGTCGTGTCCGACCTTCTGGAGGCCATCGAGACGAGCCGTACGTCGCCGCGGCGGGAGGCGGCGCGGAGGGCGGGCGGCGGCGCCGGCGGGCCC GGGTGGTGGAGCCTCAACGTGGAGGGCGTAATGCTGCTGCTCAGGGTCGTCCAGGCGGTCAGGGGGCGGAAGCTGCCGGCGCCGGAAGAGGACGCGCGACGGGGCGAGCGACGCCGCCGGC CTGAGAGGCGGCGGCATCATGGGCGGCGGCGGCGGCGGCGCCGCGAGGCGGTGGTGCGGCGGCCGGCCGAAGAAGCTGGGCAACACGGTGGGCGTGTGGAACTCCTGATCTGAGGCTTTGTG The device shown in SEQ ID NO.7 has normal carrying function. SAG9 The nucleotide sequence of the 690 bp amplified product is as follows: GCGGCGATATGAACCAACACTCCAACCCGTGGGTGCGCGCCCACGGCAGGATACAGCGTCTGAAGAAGCCCACCTCGCCGCCCGCCGGCGCCGGCCAGGCCACCGCCGACGCGGCGGCCGAACGCGCCGGCGCCGGCGCCGTTGTCGGACTCGCGAGCCAGCTGGAGCGCGCCGTACGCACGTCGGCGGTCGTCAAGCTGCTCAGCCGCTCCCTCCTCGCCGGCGCGCTCCAGCCCGCGCGCCACCTGATGATCACCCTCGCCGCCGCCGCCGGCGGCGCTGCCGCCAATAATGCCGCCGGGACCAGCGCCGGCGCCGGTGGCTCGGCGGCGGCGCTGCCGAGCAAGTCGGTCGTGTCCGACCTTCTGGAGGCCATCGAGACGAGCCGTACGTCGCCGCGGCGGGAGGCGGCGCGGAGGGCGGGCGGCGGCGCCGGCGGGCCCGGGTGGTGGAGCCTCAACGTGGAGGGCGTAATGCTGCTGCTCAGGGTCGTCCAGGCGGTCAGGGGGCGGAAGCTGCCGGCGCCGGAGAAGAGGACGCGCGACGGGGCGAGCGACGCCGCCGGCCTGAGAGGCGGCGGCATCATGGGCGGCGGCGGCGGCGGCGCCGCGAGGCGGTGGTGCGGCGGCCGGCCGAAGAAGCTGGGCAACACGGTGGGCGCGTGTGGAACTCCTGATCTGAGGCTTTGTG The nucleotide sequence of the 687 bp amplified product of the strongly dormant and strongly storage-resistant haplotype material with the deletion of "CTC" shown in SEQ ID NO.8 is: GCGGCGATATGAACCAACACTCCAACCCGTGGGTGCGCGCCCACGGCAGGATACAGCGTCTGAAGAAGCCCACCTCGCCGCCCGCCGGCGCCGGCCAGGCCACCGCCGACGCGGCGGCCGAACGCGCCGGCGCCGGCGCCGTTGTCGGACTCGCGAGCCAGCTGGAGCGCG CCGTACGCACGTCGGCGGTCGTCAAGCTGCTCAGCCGCTCCCTCGCCGGCGCGCTCCAGCCCGCGCGCCACCTGATGATCACCCTCGCCGCCGCCGCCGGCCGCCGCCAATAATGCCGCCGGGACCAGCGCCGGCGCCGGTGGCTCGGCGGCGGCGCTGCCGAGCAA GTCGGTCGTGTCCGACCTTCTGGAGGCCATCGAGACGAGCCGTACGTCGCCGCGGCGGGAGGCGGCGCGGAGGGCGGGCGGCGGCGCCGGCGGGCCCGGGTGGTGGAGCCTCAACGTGGAGGGCGTAATGCTGCTGCTCAGGGTCGTCCAGGCGGTCAGGGGGCGGAAGCTG CCGGCGCCGGAGAAGAGGACGCGCGACGGGGCGAGCGACGCCGCCGGCCTGAGAGGCGGCGGCATCATGGGCGGCGGCGGCGGCGGCGCCGCGAGGCGGTGGTGCGGCGGCCGGCCGAAGAAGCTGGGCAACACGGTGGGCGCGTGTGGAACTCCTGATCTGAGGCTTTGTG The SAG9-1 primer set was used to identify Ningjing No. 7, N22, Ningjing No. 6, Nipponbare, Ningjing No. 4, Ningjing No. 8, Asominori, and Kasalath.

[0042] The detection steps are the same as in Examples 1, (2), (2)-(4).

[0043] The results showed that Ningjing 6, Ningjing 4, Ningjing 8, and Asominori all amplified a 493 bp fragment ( Figure 2 Ningjing 7 and Nipponbare simultaneously amplified fragments of 690 bp (relatively light) and 493 bp, respectively. Figure 2 This indicates that these varieties carry normal functions. SAG9This is a rice variety with relatively weak dormancy and storage tolerance. To verify... SAG9 The functions within these contexts utilize CRISPR / Cas9 technology. SAG9 Edited ( Figure 3 Compared to the wild type, the knockout family showed significantly higher germination rates after both artificial aging and long-term natural storage, indicating significantly enhanced storage tolerance. Figure 4 af); compared with the wild type, freshly harvested knockout family seeds had significantly lower germination rates, i.e., significantly enhanced dormancy ( Figure 5 These results confirm that Ningjing 7, Ningjing 6, Nipponbare, Ningjing 4, Ningjing 8, and Asominori do indeed carry functional [carriers / symbols]. SAG9 Alleles, consistent with the results of SAG9-1 marker identification.

[0044] The dormancy and storage tolerance varieties N22 and Kasalath only amplified a 687 bp fragment and lacked a 493 bp fragment, indicating that these varieties carry a loss-of-function carrier. SAG9 It is a rice variety with strong dormancy and storage tolerance. To verify... SAG9 The functions within these contexts utilize CRISPR / Cas9 technology. SAG9 Edited ( Figure 3 Compared to the wild type, the germination rate of the knockout family showed no significant change after artificial aging or long-term natural storage, indicating no significant change in storage tolerance. Figure 4 g, h); compared with the wild type, the germination rate of freshly harvested knockout family seeds showed no significant change, i.e., dormancy showed no significant change ( Figure 5 These results confirm that N22 and Kasalath do indeed carry loss-of-function variants. SAG9 The results were consistent with those of the SAG9-1 marker.

[0045] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Genes that negatively regulate rice seed dormancy and storage tolerance SAG9 Detection primers for molecular markers, characterized in that, The primers are: SAG9-CTC-F: 5'-GCGGCGATATGAACCAACAC-3' (SEQ ID NO. 1); SAG9-CTC-R: 5'- CACAAAGCCTCAGATCAGGAG-3' (SEQ ID NO. 2); SAG9-CTC-2F: 5'-CTGCTCAGCCCGCTCCCTCCTC-3' (SEQ ID NO. 3).

2. Detection of genes regulating rice seed dormancy and storage tolerance SAG9 Molecularly labeled reagents, characterized in that, The reagent includes the primers described in claim 1.

3. The application of the detection primers of claim 1 or the reagents of claim 2 in the identification of rice varieties with strong seed dormancy and storage tolerance.

4. The application according to claim 3, characterized in that, When the primers are used to amplify the rice material to be tested, if the primer pair can simultaneously amplify a 690 bp fragment and a 493 bp fragment, or only amplify a 493 bp fragment, then the rice material to be tested carries a normal functional carrier. SAG9 At this site, the rice variety exhibits dormancy and weak storage tolerance; when the primer pair can only amplify a 687 bp fragment, the rice material being tested carries a loss-of-function gene. SAG9 At this site, rice varieties exhibit strong dormancy and storage tolerance.

5. The application according to claim 3, characterized in that, The nucleotide sequence of the 493 bp amplified fragment is shown in SEQ ID NO.6; the nucleotide sequence of the 690 bp amplified fragment is shown in SEQ ID NO.7; the 687 bp amplified fragment is formed by deleting CTC at 215 bp of the sequence shown in SEQ ID NO.7, and its nucleotide sequence is shown in SEQ ID NO.8.