A soybean seed coat cracking trait-associated molecular marker, detection primer and application

By developing SNP nonsense mutation sites and KASP primers for the soybean GmLYK4 gene, efficient and precise molecular-assisted selection of soybean seed coat cracking traits was achieved, solving the problem of low breeding selection accuracy in existing technologies and making it suitable for large-scale and high-throughput genotyping.

CN122168794APending Publication Date: 2026-06-09JILIN UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JILIN UNIVERSITY
Filing Date
2026-05-07
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In existing technologies, most molecular markers related to soybean seed coat cracking are SSR or Indel markers linked to the trait. These markers have large genetic distances, low breeding selection accuracy, and are not suitable for high-throughput automated typing, making it difficult to achieve rapid identification and molecular-assisted selection of soybean seed coat cracking traits.

Method used

We developed a molecular marker based on the nonsense mutation site Glyma.02G059700 in the soybean GmLYK4 gene (SNP site). We designed allele-specific detection primers and used KASP technology for high-throughput genotyping. We determined the genotype by detecting the fluorescence signal to achieve rapid identification of seed coat cracking traits.

Benefits of technology

It provides a key functional site closely related to the seed coat cracking trait of soybean. The detection system is well-defined and easy to operate, suitable for large-scale and high-throughput genotyping. Genotyping verification shows a concordance rate of up to 91.8%, providing a precise and efficient detection tool for soybean breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168794A_ABST
    Figure CN122168794A_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant molecular breeding technology and provides a molecular marker associated with soybean seed coat cracking traits, detection primers, and their applications. The molecular marker is an SNP site in the soybean GmLYK4 gene, where GmLYK4 is Glyma.02G059700. The SNP site is located at position 1957 of the nucleotide sequence shown in SEQ ID NO.8, and the nucleotide polymorphism of the site is A / T. This invention provides a key functional site closely related to soybean seed coat cracking traits, with clear genetic location and evidence of cosegregation. Based on this key site, a KASP primer set was developed. The detection system is well-defined and easy to operate, suitable for large-scale and high-throughput genotyping. It provides a precise and efficient detection tool for molecular-assisted selection of normal and crack-prone seed coat traits in soybeans, and has extremely high breeding application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, and in particular relates to a molecular marker, detection primer and application of soybean seed coat cracking trait. Background Technology

[0002] Cracking of the soybean seed coat affects the appearance of the grains and processing efficiency, and increases losses during storage and transportation, making it one of the important traits affecting the marketability and quality of soybeans. Existing research shows that this trait is closely related to seed coat tissue structure, cell wall composition, and environmental factors.

[0003] Regarding the soybean seed coat cracking trait, previous studies have progressed from phenotypic evaluation, genetic analysis, and QTL mapping to the stage of candidate gene analysis and functional verification. However, stable molecular markers that can be directly used for assisted selection of the soybean seed coat cracking trait are still relatively insufficient. Therefore, developing key functional sites closely related to this trait and their detection systems is of great significance for the rapid identification and molecular-assisted selection of the soybean seed coat cracking trait.

[0004] Currently reported molecular markers related to soybean seed coat cracking are mostly SSR or Indel markers linked to the trait. They are genetically distant from the target regulatory genes, and the accuracy of breeding selection is generally less than 80%. Moreover, they are not suitable for high-throughput automated typing. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker, detection primer, and application for the soybean seed coat cracking trait, aiming to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] On the one hand, the present invention provides a molecular marker associated with the trait of soybean seed coat cracking, wherein the molecular marker is an SNP site in the soybean GmLYK4 gene, the GmLYK4 gene is Glyma.02G059700, the SNP site is located at position 1957 of the nucleotide sequence shown in SEQ ID NO.8, and the nucleotide polymorphism of the site is A / T;

[0008] The SNP site is a nonsense mutation site that causes premature termination of GmLYK4 protein translation. Specifically, the nonsense mutation is a mutation of wild-type base A to T at position 1957 of the nucleotide sequence shown in SEQ ID NO.8, which changes the codon containing the SNP site from AGA to the stop codon TGA, resulting in premature termination of GmLYK4 protein translation.

[0009] On the other hand, the present invention provides a detection primer for a molecular marker associated with the soybean seed coat cracking trait, the detection primer comprising:

[0010] The allele-specific forward primer F1 has the nucleotide sequence shown in SEQ ID NO.1;

[0011] The allele-specific forward primer F2 has the nucleotide sequence shown in SEQ ID NO.2;

[0012] The universal reverse primer R has the nucleotide sequence shown in SEQ ID NO.3.

[0013] On the other hand, the present invention provides an application of a molecular marker associated with soybean seed coat cracking or the above-mentioned detection primers in identifying soybean seed coat cracking-related genotypes.

[0014] On the other hand, the present invention provides an application of a molecular marker associated with soybean seed coat cracking trait or the above-mentioned detection primers in screening soybean materials with normal seed coat phenotype.

[0015] On the other hand, the present invention provides a method for auxiliary selection of soybean seed coat cracking trait, comprising the following steps:

[0016] (1) Extract genomic DNA from the soybean sample to be tested;

[0017] (2) Using the genomic DNA as a template, an amplification reaction was performed using the above-mentioned detection primers;

[0018] (3) Detect the fluorescence signals of the FAM and HEX channels of the amplified products and perform genotyping based on the fluorescence clustering results;

[0019] (4) Screening materials based on genotyping results: If FAM fluorescence signal is detected and the genotype is GmLYK4-A, it is determined to be a soybean material with a normal seed coat phenotype; if HEX fluorescence signal is detected and the genotype is GmLYK4-T, it is determined to be a soybean material with a cracked seed coat phenotype.

[0020] Compared with the prior art, the specific beneficial effects of the present invention are as follows:

[0021] This invention provides a key functional site that is closely related to the seed coat cracking trait of soybean, namely the nonsense mutation site at position 1957 of the GmLYK4 coding sequence, which has clear genetic location and evidence of cosegregation.

[0022] Based on the above key sites, this invention develops a KASP primer set with a well-defined detection system and simple operation, suitable for large-scale and high-throughput genotyping.

[0023] The KASP marker provided by this invention showed a very high correlation with the seed coat cracking phenotype in the parents and 73 natural populations. Genotyping verification showed that the overall identification accuracy of the marker for the normal and crack-prone phenotypes was as high as 91.8%. The marker detection system is clear and easy to operate, providing a precise and efficient detection tool for molecular-assisted selection of normal and crack-prone seed coat traits in soybeans, and has extremely high breeding application value. Attached Figure Description

[0024] Figure 1 This is a fine mapping of the GmLYK4 gene for the soybean seed coat cracking trait provided in an embodiment of the present invention;

[0025] Figure 2 The diagram shows the GmLYK4 protein domain analysis and multiple sequence alignment of key SNP sites provided in the embodiments of the present invention; where (A) is the predicted result of the conserved domains of the GmLYK4 protein, and (B) is the multiple sequence alignment result of key SNP sites in wild-type Williams82, normal seed coat near-isogenic line CR-2t, and crack-prone seed coat near-isogenic line CR-18s.

[0026] Figure 3 Seed coat cracking phenotype identification results of the GmLYK4 transgenic lines provided in the embodiments of the present invention; (A) Seed coat cracking phenotype diagrams of each transgenic line and the wild type; (B) Statistical results of seed coat cracking rate of each transgenic line and the wild type.

[0027] Figure 4 The results of the genotyping verification of the KASP marker developed based on the key SNP site GmLYK4 in 73 natural soybean populations provided in this embodiment of the invention are shown in (A), which is the statistical result of seed coat cracking rate of soybean materials with different genotypes, and (B) is the two-dimensional scatter plot of KASP fluorescence genotyping of 73 natural soybean populations. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0029] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0030] Example 1: Determination of GmLYK4 candidate gene and key SNP sites:

[0031] like Figure 1As shown, the target region for soybean seed coat cracking was further finely mapped, and more than 200 SNPs were detected within the mapped region. Among them, 10 genes had functional variations in their coding regions. Further analysis showed that only Glyma.02G059700 had a nonsense mutation at position 1957 of the coding sequence, and this variation co-segregated with the cracking index phenotype in the parent and near-isogenic lines. Therefore, Glyma.02G059700 was identified as a candidate gene and named GmLYK4.

[0032] Combination Figure 2 Domain and sequence analysis revealed that this key mutation caused the original codon to change from AGA to the stop codon TGA, which is a nonsense mutation that can cause premature termination of protein translation and the formation of truncated proteins. This mutation exists in the easily cleavable near-isogenic line CR-18s, but not in the normal near-isogenic lines CR-2t and Williams 82 (a mid-maturing spring soybean variety bred in the United States, which is genetically stable, easily transformed, and has become the standard material for the global soybean reference genome, widely used in functional gene research and molecular breeding).

[0033] The above results indicate that the key SNP at position 1957 of the GmLYK4 coding sequence can serve as the basis for the development of molecular markers related to soybean seed coat cracking.

[0034] Example 2: Functional verification of GmLYK4:

[0035] To verify the functional relationship between GmLYK4 and seed coat cracking, two strategies, overexpression and gene editing, were used for bidirectional verification: Dongnong 50 (a commercially available variety) was transformed into an overexpression vector carrying the full-length CDS of the normal GmLYK4 allele as the recipient; Williams 82, which has a normal phenotype and does not carry the key SNP site, was used as the recipient to construct a gmlyk4 gene-edited mutant using CRISPR / Cas9 technology.

[0036] The sgRNA target sequences used for gene editing are shown in SEQ ID NO.4-7:

[0037] SEQ ID NO.4: GTTGTGGCCAAACCAACGTA;

[0038] SEQ ID NO.5: GGAAATTCAAACTCTATGCG;

[0039] SEQ ID NO.6: CCCTGAAGGTGAGGTAAGCT;

[0040] SEQ ID NO.7:ACCCAACAAAGCAGATATTG;

[0041] like Figure 3 As shown, compared with Williams 82, the seed coat cracking rate of gmlyk4-23 and gmlyk4-60 was significantly increased; compared with Dongnong 50, the seed coat cracking rate of GmLYK4-OE-1 and GmLYK4-OE-2 was significantly decreased. All the above comparisons were conducted within their respective genetic backgrounds. These results indicate that introducing normal GmLYK4 into a crack-prone background can reduce the seed coat cracking rate, while knocking out GmLYK4 in a normal background can increase the seed coat cracking rate, suggesting that GmLYK4 is closely related to the seed coat cracking trait of soybean.

[0042] Example 3, KASP primer set design:

[0043] Based on the key SNP site of GmLYK4, and following the KASP primer design principle, specific sequences were selected flanking the target SNP to design the following primer set:

[0044] F1: 5'-GAAGGTGACCAAGTTCATGCTGAAACGTCTATGGAAAGGAAGTTTA-3' (as shown in SEQ ID NO.1);

[0045] F2: 5'-GAAGGTCGGAGTCAACGGATTGAAACGTCTATGGAAAGGAAGTTTT-3' (as shown in SEQ ID NO. 2);

[0046] R: 5'-CTTCAGGAAGACAAGTTCGG-3' (as shown in SEQ ID NO.3).

[0047] Example 4: KASP detection system and amplification conditions:

[0048] Soybean leaf genomic DNA was extracted using the CTAB method as a template; the KASP reaction system was 10 μL, including: 5 μL 2×Master Mix, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, 1 μL DNA template and 3.5 μL ultrapure water;

[0049] The PCR reaction conditions were as follows: 95℃ for 10 min; 95℃ for 20 s, 61℃-55℃ for 40 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 40 s, for a total of 35 cycles; 30℃ for 30 s. After the reaction, the fluorescence signals of the FAM and HEX channels were read, and the genotype was determined based on the clustering results of the two-dimensional scatter plot.

[0050] Example 5: Method for investigating seed coat cracking phenotype:

[0051] After harvesting the seeds of each material at maturity, a seed coat cracking phenotype survey was conducted. At least three independent biological replicates were set up for each material. For each replicate, 200 mature, plump, and disease-free seeds were randomly selected as the statistical subjects. The number of cracked seeds was counted based on whether visible cracks appeared on the seed surface, and the seed coat cracking rate was calculated using the following formula:

[0052] Seed coat cracking rate (%) = Number of cracked seeds / Total number of seeds × 100%.

[0053] Example 6: Association analysis between KASP markers and seed coat cracking phenotype:

[0054] Genotyping was performed on parental materials and 73 phenotypically stable natural soybean populations (10 normal materials and 63 easily cleaved materials) using the KASP primer set from Example 3. The results are as follows: Figure 4 As shown, genotypes were determined based on two-dimensional clustering of FAM and HEX channel fluorescence signals, and association analysis was performed using the seed coat cracking phenotype. The results showed that the HEX signal corresponds to the crack-prone seed coat allele GmLYK4-T, and the FAM signal corresponds to the normal seed coat allele GmLYK4-A. In 73 natural population validation materials, all normal materials carried GmLYK4-A (10 / 10); in the crack-prone materials, 57 / 63 carried GmLYK4-T; the overall phenotype-genotype concordance rate reached 91.8% (67 / 73). These results demonstrate that the KASP marker developed based on the key SNP site of GmLYK4 can be accurately used for population validation and molecular-assisted selection of soybean seed coat cracking traits.

[0055] Example 7: An auxiliary selection method for soybean seed coat cracking traits:

[0056] Genomic DNA was extracted from the leaves of the soybean materials to be tested. The KASP primer set from Example 3 and the reaction system and amplification conditions from Example 4 were used for detection. Based on the fluorescence clustering results after amplification, the genotype determination criteria for the materials at the key SNP site GmLYK4 were as follows: if a FAM fluorescence signal was detected (genotype GmLYK4-A), the soybean material was determined to be a normal seed coat material; if a HEX fluorescence signal was detected (genotype GmLYK4-T), the soybean material was determined to be a crack-prone seed coat material. Based on this determination criterion, materials with normal seed coat phenotypes were screened and directly used for early generation selection in breeding, germplasm resource evaluation, or parental material identification. This effectively avoids the cost of large-scale field identification, significantly shortens the breeding cycle, and improves selection accuracy.

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker associated with soybean seed coat cracking trait, characterized in that, The molecular marker is a SNP site in the soybean GmLYK4 gene, the GmLYK4 gene being Glyma.02G059700. The SNP site is located at position 1957 of the nucleotide sequence shown in SEQ ID NO.8, and the nucleotide polymorphism of the site is A / T. The SNP site is a nonsense mutation site that causes premature termination of GmLYK4 protein translation. Specifically, the nonsense mutation is a mutation of wild-type base A to T at position 1957 of the nucleotide sequence shown in SEQ ID NO.8, which changes the codon containing the SNP site from AGA to the stop codon TGA, resulting in premature termination of GmLYK4 protein translation.

2. A detection primer for a molecular marker associated with soybean seed coat cracking trait as described in claim 1, characterized in that, The detection primers include: The allele-specific forward primer F1 has the nucleotide sequence shown in SEQ ID NO.1; The allele-specific forward primer F2 has the nucleotide sequence shown in SEQ ID NO.2; The universal reverse primer R has the nucleotide sequence shown in SEQ ID NO.

3.

3. The application of a molecular marker associated with soybean seed coat cracking as described in claim 1 or a detection primer as described in claim 2 in identifying soybean seed coat cracking-related genotypes.

4. The application of a molecular marker associated with soybean seed coat cracking trait as described in claim 1 or a detection primer as described in claim 2 in screening soybean materials with normal seed coat phenotype.

5. A method for selection aided by the trait of soybean seed coat cracking, characterized in that, Includes the following steps: (1) Extract genomic DNA from the soybean sample to be tested; (2) Using the genomic DNA as a template, an amplification reaction is performed using the detection primers as described in claim 2; (3) Detect the fluorescence signals of the FAM and HEX channels of the amplified products and perform genotyping based on the fluorescence clustering results; (4) Screening materials based on genotyping results: If FAM fluorescence signal is detected and the genotype is GmLYK4-A, it is determined to be a soybean material with a normal seed coat phenotype; if HEX fluorescence signal is detected and the genotype is GmLYK4-T, it is determined to be a soybean material with a cracked seed coat phenotype.

6. The method according to claim 5, characterized in that, The amplification reaction system is 10 μL, including: 5 μL of 2×Master Mix, 0.1 μL of upstream primer F1, 0.1 μL of upstream primer F2, 0.3 μL of downstream primer R, 1 μL of DNA template and 3.5 μL of ultrapure water.

7. The method according to claim 5, characterized in that, The amplification reaction conditions were as follows: 95℃ for 10 min; 95℃ for 20 s, annealing at 61℃ to 55℃ for 40 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 95℃ for 20 s, 55℃ for 40 s, for a total of 35 cycles; 30℃ for 30 s.