Hbr-mir408b gene of rubber tree and application thereof

By overexpressing the rubber tree hbr-miR408b gene in wild lettuce, the plant's vegetative growth and latex quality were regulated, solving the genetic transformation problem of rubber trees, realizing the regulation of rubber biosynthesis and the assessment of latex quality, and improving the plant's vegetative growth and rubber yield.

CN122189012BActive Publication Date: 2026-07-24SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
Filing Date
2026-05-14
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Genetic transformation of rubber trees is difficult, which affects the functional research of genes related to rubber synthesis regulation. Furthermore, existing technologies are insufficient to effectively regulate plant vegetative growth and assess latex quality.

Method used

By utilizing the hbr-miR408b gene of rubber tree, we can regulate plant vegetative growth and assess latex quality by increasing its expression level. This includes reducing the sucrose content of latex, increasing inorganic phosphorus, molecular weight and total solids content, promoting plant vegetative growth and improving latex quality.

Benefits of technology

By regulating the expression of the hbr-miR408b gene in rubber trees, the vegetative growth and latex quality of wild lettuce were significantly improved, the inorganic phosphorus content was increased, the sucrose content was reduced, the molecular weight and total solids content were increased, and the biosynthesis and yield of rubber were promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189012B_ABST
    Figure CN122189012B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic biology, and particularly relates to a rubber tree hbr-miR408b gene and application thereof. The application provides a rubber tree hbr- miR408b gene, which influences physiological indexes such as sucrose and inorganic phosphorus of wild lettuce latex, and quality indexes such as molecular weight, total solid content and ash content, and regulates plant vegetative growth. Further, the application also provides a biological material containing the rubber tree hbr-miR408b gene, a primer pair for amplifying the gene, and a method for promoting plant vegetative growth. By introducing the rubber tree hbr-miR408b hbr-miR408b gene into a target plant, the vegetative growth of the target plant can be promoted. Therefore, the technical scheme of the application has great economic value and application prospect in the fields of natural rubber biosynthesis, latex quality identification and evaluation, wild lettuce variety improvement and genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic biology technology, specifically relating to rubber trees. hbr-miR408b Genes and their applications. Background Technology

[0002] MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules, approximately 21–25 nt in length, encoded by endogenous genes, and widely involved in post-transcriptional gene expression regulation in plants and animals. Their biosynthesis begins in the cell nucleus, where MIR genes are transcribed by RNA polymerase II to generate primary miRNA transcripts with a typical stem-loop structure. These transcripts are then progressively cleaved by the RNase III-like restriction enzyme DCL1 (Dicer-like 1), forming miRNA / miRNA* double-stranded intermediates. With the synergistic action of proteins such as the methyltransferase HEN1 and the chromosome region maintenance factor CRM1, they are finally processed into mature miRNAs. Mature miRNAs primarily mediate the degradation of target gene mRNAs or inhibit their translation, thereby achieving post-transcriptional silencing of target genes. Numerous studies have shown that miRNAs and their target genes can serve as important molecular targets for crop genetic improvement. Precise regulation and modification of these miRNAs may provide new pathways for breeding new varieties with superior agronomic traits.

[0003] miR408 The miRNA family is a class of conserved miRNAs approximately 21 nucleotides in length, reported in various plants including Arabidopsis thaliana, rice, cassava, and wheat. Members of this family are widely distributed in the plant kingdom and participate in the regulation of multiple biological processes, covering key pathways such as plant growth and development, biotic and abiotic stress responses, and hormone signal transduction. UCL ( Uclacyanin It belongs to a subfamily of the copper protein family and is located in the cytoplasm. In rice, UCL It participates in the regulation of photosynthesis and is closely related to grain yield. Studies have shown that... Os-miR408 By inhibiting target genes Os-UCL8 The expression of laccase affects intracellular copper homeostasis, thereby regulating photosynthetic efficiency and ultimately controlling yield. Laccase , LAC )yes miR408 Another widely studied conserved target, first discovered in 1883, belongs to the polycopper oxidase family. This gene family is distributed in various plants, including poplar, salvia miltiorrhiza, and Arabidopsis thaliana, and its expression is influenced by… miR408 Precise regulation. Among the poplar trees, miR408 Overexpression can significantly reduce LAC19 , LAC25 and LAC32The accumulation level of mRNA in *Salvia miltiorrhiza* promotes plant growth, increases net photosynthetic rate and saccharification efficiency, while also increasing cell wall permeability and delaying lignification. In *Salvia miltiorrhiza*, whether it inhibits... Sm-miR408 Is it an expression or an overexpression? SmLAC3 Both can increase the content of salvianolic acid B and rosmarinic acid, while reducing lignin accumulation. In Arabidopsis thaliana, AtLAC15 Its expression has been shown to induce seed coat browning and delay plant development, while also participating in the regulation of flavonoid synthesis.

[0004] miR408 These genes and their target genes not only play important roles in plant growth and development, but also in responding to abiotic stress. Studies have shown that overexpression of these genes in tobacco... miR408 It can significantly enhance antioxidant enzyme genes NbSOD , NbPOD and NbCAT The transcriptional level and enzyme activity of [the organism] promote seed germination under salt stress and effectively reduce the accumulation of reactive oxygen species. In rice, miR408 Through regulation TaTOC1s Transcription is involved in controlling heading time. In chickpeas, after 17 days of drought treatment... miR408 The expression level was significantly upregulated, and overexpression miR408 lead to bHLH23 The expression of [a specific substance] is suppressed, thereby reducing the level of reactive oxygen species in plants and enhancing osmotic regulation and drought resistance. In Arabidopsis thaliana, overexpression [of this substance]... miR408 The leaves of the plant under cold injury conditions showed significantly less damage than those of the wild type, while the inhibition miR408 The plants that exhibited these characteristics were more sensitive to chilling injury, resulting in a significantly increased mortality rate. Furthermore, miR408 The expression of this substance has also been shown to participate in the regulation of the biological clock in dicotyledonous plants such as Arabidopsis thaliana. The above studies fully demonstrate that... miR408 By regulating multiple target genes, it exerts multi-dimensional and multi-level regulatory functions in plant stress response and growth and development.

[0005] Natural rubber (cis-1,4-polyisoprene), an important industrial raw material, is primarily biosynthesized and stored in specialized latex cells within the phloem of the Brazilian rubber tree (Hevea brasiliensis). Rubber biosynthesis is not only a core metabolic activity of latex cells but also a unique physiological response to stress in rubber-producing plants. However, genetic transformation of rubber trees is challenging and time-consuming, hindering functional studies of genes regulating rubber synthesis. Wild lettuce, an ancestor of cultivated lettuce, has a lifespan of only 3–5 months, possesses rubber-synthesizing organs similar to those of the Brazilian rubber tree, and synthesizes cis-1,4-polyisoprene with a similar molecular weight. Furthermore, wild lettuce has a relatively mature and stable genetic transformation technology, making it an ideal model plant for elucidating the functions of genes related to rubber synthesis. This study utilizes wild lettuce to investigate the biological function of the rubber tree miR408 and its regulatory role in rubber synthesis. Summary of the Invention

[0006] The purpose of this invention is to provide rubber trees hbr-miR408b Genes and their applications, which can be used to regulate plant vegetative growth and assess latex quality.

[0007] This invention provides rubber trees hbr-miR408b Genes, or those containing rubber tree genes. hbr-miR408b The application of gene-based biomaterials in latex-producing plants, including one or more of the following: regulating plant vegetative growth, evaluating latex quality, or cultivating high-yielding latex plants; The plant is lettuce. Lactuca serriola ; The rubber tree hbr-miR408b The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0008] Preferably, the regulation of plant vegetative growth includes: increasing the amount of rubber tree resin in the plant. hbr-miR408b Gene expression levels promote plant vegetative growth.

[0009] Preferably, the evaluation of latex quality includes one or more of the following (1)-(5): (1) By enhancing the rubber tree in plants hbr-miR408b The expression level of genes reduces the sucrose content of latex; (2) By enhancing the rubber tree in the plant hbr-miR408b Increase gene expression levels and increase the inorganic phosphorus content of latex; (3) By enhancing the rubber tree in the plant hbr-miR408b Gene expression levels increase the molecular weight of latex; (4) By enhancing the rubber tree in the plant hbr-miR408b Increase gene expression levels, thereby increasing the total solids content of latex; (5) By enhancing the rubber tree in the plant hbr-miR408bIncreased gene expression levels lead to higher ash content in latex.

[0010] Preferably, the biological material includes: a recombinant expression vector or a recombinant microorganism.

[0011] Preferably, the biomaterial is PRI101-Ubi::hbr-miR408b.

[0012] Preferably, it is used to expand the rubber tree. hbr-miR408b The primer pairs for the gene include: hbr-miR408b-F and hbr-miR408b-R; The nucleotide sequence of hbr-miR408b-F is shown in SEQ ID NO:2; The nucleotide sequence of hbr-miR408b-R is shown in SEQ ID NO:3.

[0013] This invention provides a method for promoting plant vegetative growth, comprising the following steps: The rubber tree described in the above technical solution hbr-miR408b Genes are introduced into target plants to promote their vegetative growth. The plant in question is lettuce.

[0014] Beneficial effects: This invention provides rubber trees hbr-miR408b Genes, or those containing rubber tree genes. hbr-miR408b The application of genetically modified biomaterials in latex-producing plants, wherein the application includes one or more of the following: regulating plant vegetative growth, evaluating latex quality, or cultivating high-yielding latex plants; wherein the plant is lettuce; and wherein the rubber tree is... hbr-miR408b The nucleotide sequence of the gene is shown in SEQ ID NO: 1. This gene affects physiological indicators such as sucrose and inorganic phosphorus in wild lettuce latex, as well as quality indicators such as molecular weight, total solids content, and ash content, and regulates plant vegetative growth. Therefore, hbr-miR408b Gene expression is related to plant vegetative growth, rubber biosynthesis (since sucrose in latex provides the carbon skeleton for rubber synthesis, and inorganic phosphorus participates in energy metabolism and the generation of ATP / NADPH, the content of these two factors will indirectly affect rubber biosynthesis and yield), and latex quality.

[0015] Based on the above-mentioned technical advantages, the present invention also provides a rubber tree containing the above-described technical solution. hbr-miR408b Biological materials for gene amplification, primer pairs for amplifying the aforementioned genes, and methods for promoting plant vegetative growth. This is achieved by using the rubber tree described in the above technical solution. hbr-miR408b Genes introduced into target plants can promote the vegetative growth of the target plants.

[0016] Therefore, the technical solution of this invention has significant economic value and application prospects in the fields of natural rubber biosynthesis, latex quality identification and evaluation, wild lettuce variety improvement, and genetic engineering. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Provided by the present invention hbr-miR408b The resistance gene kana in transgenic wild lettuce (OE-miR408b) and miR408b PCR testing; Figure 2 Wild-type lettuce (WT) and overexpression provided for this invention miR408b wild lettuce (OE-miR408b) miR408b Results of quantitative fluorescence expression detection; Figure 3 Wild-type lettuce (WT) and overexpression provided for this invention miR408b The growth of wild lettuce (OE-miR408b) at different stages; Figure 4 Wild-type lettuce (WT) and overexpression provided for this invention miR408b Statistical analysis of physiological parameters of wild lettuce (OE-miR408b) latex.

[0019] Figure 5 Wild-type lettuce (WT) and overexpression provided for this invention miR408b Statistics on the quality indicators of wild lettuce (OE-miR408b) latex. Detailed Implementation

[0020] The present invention described hbr-miR408b The nucleotide sequence of the gene is shown in SEQ ID NO:1, specifically: 5'-GGUAAAGAAAGAGACAGACUAAGACUGGGAACAGGCAGAGCAUGGAUGGAGCUAUUAACGGAAAUAUCUGUUUUGGCUCCACCCAUGCACUGCCUCUUCCCUGGCUUGUGGCUCUUCUUUUUCUGCCC -3' (in the sequence listing, T replaces U).

[0021] The Latin name for wild lettuce described in this application is: Lactuca serriola .

[0022] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0023] Example 1 rubber trees hbr-miR408b Cloning of genes according to hbr-miR408b Primers were designed based on the gene sequence to clone rubber tree genomic DNA. hbr- miR408b The full-length sequence was obtained, and the clone was sequenced for verification, ultimately leading to the acquisition of the rubber tree latex expression gene. hbr-miR408b The precursor sequence (i.e., the nucleotide sequence as shown in SEQ ID NO:1) hbr-miR408b (Genes). Cloning hbr-miR408b The primers and RT-PCR amplification process used for the precursor sequence are shown below: (1) Cloning primer sequences Used for cloning hbr-miR408b The primers are as follows: Forward primer: 5'- GGTAAAGAAAGAGACAGACTAAG-3' (SEQ ID NO.2); Reverse primer: 5'- GGGCAGAAAAAGAAGAGC-3' (SEQ ID NO.3).

[0024] (2) hbr-miR408b Cloning and sequence analysis of gene precursor sequences Extracting DNA from rubber tree latex and using it as a template for amplification, as described above... hbr-miR408b Pre-primer (SEQ ID NO.2-SEQ ID NO.3) was used for RT-PCR amplification. The RT-PCR amplification system was 30 μL: 15 μL PrimeSTAR Max Ver.2 Premix (2×), 1 μL each of forward and reverse primers (10 μM), 2 μL DNA template, and 13 μL ddH2O. The RT-PCR amplification program was: 98°C pre-denaturation for 10 min; 98°C denaturation for 15 s, 55°C annealing for 10 s, 72°C extension for 10 s, for a total of 30 cycles; 72°C extension for 10 min.

[0025] PCR amplification products were separated and the target band was recovered by 1.5% agarose gel electrophoresis. The target band was then ligated into the plant overexpression vector PRI101 using homologous recombination and transformed into *E. coli*. Positive clones were selected for sequencing (Shanghai Bioengineering Co., Ltd.) to obtain the gene. hbr-miR408b The sequence is shown in SEQ ID No:1.

[0026] Example 2 PRI101-Ubi:: hbr-miR408b Identification and expression level detection of genetically modified wild lettuce (1) Genetically modified wild lettuce ( Lactuca serriola Positive test The correctly sequenced strain obtained in Example 1 was cultured and expanded. Plasmid extraction was performed according to the instructions of the plasmid kit (Tiangen Biotech (Beijing) Co., Ltd.). The plasmid was then extracted using the heat shock method. hbr-miR408b The PRI101 plasmid of the gene was transformed into Agrobacterium C58C1 strain, yielding a strain containing PRI101-Ubi:: hbr-miR408b Agrobacterium rhizogenes C58C1.

[0027] Will contain PRI101-Ubi:: hbr-miR408b Genetic transformation was performed by infecting wild lettuce cotyledons with Agrobacterium rhizogenes C58C1, followed by kanamycin resistance screening to obtain resistant seedlings. The kanamycin resistance gene Kana and the genotype were identified by PCR. hbr-miR408b Transgenic positive plants were screened from resistant seedlings. Specific methods included: extracting genomic DNA from wild lettuce leaves and using Kana and... hbr-miR408b The gene was amplified by PCR using primers, followed by 1.5% agarose gel electrophoresis. The Kana gene and... hbr-miR408b The PCR product fragments of the Kana gene were 269 bp and 130 bp in length, respectively; if the Kana gene and hbr- miR408b If the PCR products of the gene all exhibit specific bands, then the plant is a transgenic plant (also known as an overexpression plant). The recombinant plasmid PRI101-Ubi:: hbr-miR408b As a positive control, genomic DNA from water and wild-type wild lettuce served as a negative control; electrophoresis images of some plants are shown below. Figure 1 .

[0028] The primer sequences used in the above experiments were Kana-F: 5'- GGCTATGACTGGGCACAACA -3' (SEQ ID NO.4), Kana-R: 5'- GCAGGAGCAAGGTGAGATGAC -3' (SEQ ID NO.5); hbr-miR408b-F: 5'- GGTAAAGAAAGAGACAGACTAAG -3' (SEQ ID NO.2), hbr-miR408b-R: 5'- GGGCAGAAAAAGAAGAGC -3' (SEQ ID NO.3).

[0029] (1) Detection of expression levels in transgenic wild lettuce Wild-type and transgenic positive plant latex were collected, and total RNA was extracted according to the instructions of the QIAGEN RNeasey Lipid TissueMini Kit (No. 74804). Subsequently, the expression level of the gene in each sample was detected by real-time PCR.

[0030] Quantitative real-time PCR detection of latex hbr-miR408b The experimental description of gene expression is as follows: The reagent used was NovoStart. ® The SYBR qPCR SuperMix Plus kit (NovoProtein) was used, and the PCR instrument used was a CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA).

[0031] PCR amplification volume was 20 μL. The reaction conditions were: 95℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s, and 60℃ annealing for 34 s, for 45 cycles. Melting curve analysis was performed. Primer sequences were: hbr-miR408b-qF: 5'-GGTAAAGAAAGAGACAGACTAA-3' (SEQ ID NO.8), hbr-miR408b-qR: 5'-GGGCAGAAAAAGAAGAGC-3' (SEQ ID NO.3), Ubiquitin-qF: 5'-GCGCAAGAAGAAGACCTACAC-3' (SEQ ID NO.6), and Ubiquitin-qR: 5'-GCATTAGGGCATTCTTTCCTCAAC-3' (SEQ ID NO.7). 2 -ΔΔCt calculate hbr-miR408b The expression level, the results are shown in Figure 2 .

[0032] Combination Figure 2 The results show that, compared with wild-type plants, hbr-miR408b In the overexpression lines OE-miR408b_1, OE-miR408b_2, and OE-miR408b_3, hbr-miR408b The expression level was significantly upregulated ( Figure 2 ).

[0033] Example 3 PRI101-Ubi:: hbr-miR408b Analysis of vegetative growth of positive plants Transgenic OE-miR408b seeds (OE-miR408b_1, OE-miR408b_2, and OE-miR408b_3) and wild-type lettuce T1 generation seeds were germinated in water and then planted in nutrient soil at the same time. The growth of the lettuce was observed and recorded at 15, 30, and 60 days of age. The results are shown below. Figure 3 (exist Figure 3 In the diagram, A represents the growth of wild lettuce at 15 days old, B represents the growth of wild lettuce at 30 days old, and C represents the growth of wild lettuce at 60 days old.

[0034] Combination Figure 3 As a result, at 15 days of age, no significant morphological differences were observed between the transgenic lines and the wild-type lines. Figure 3 (A), while at 30 days old, the OE-miR408b line showed premature bolting ( Figure 3 B), and its subsequent vegetative growth process is significantly accelerated ( Figure 3 (C).

[0035] Example 4 PRI101-Ubi:: hbr-miR408b Determination of physiological indicators of positive plant latex The experimental procedure for determining the physiological parameters of wild lettuce latex is as follows: Trichloroacetic acid (TCA) with a w / v concentration of 2.5% was used as a coagulant, and fresh latex was added at a volume ratio of 9:1 (TCA:latex) to achieve phase separation. After the mixture was vortexed to allow it to react fully, it was centrifuged at 3000 r / min for 10 minutes, and the supernatant was collected as the sample to be tested. Sample analysis included the detection of two key parameters: (1) Determination of sucrose content Based on the anthrone-sulfuric acid colorimetric principle, sugars are dehydrated by concentrated sulfuric acid to generate furfural derivatives, which then form a blue-green complex with anthrone. Quantification is performed by spectrophotometry at a wavelength of 620 nm.

[0036] (2) Determination of inorganic phosphorus content The phosphomolybdic blue spectrophotometric method was used to generate phosphomolybdic heteropoly acid by reacting orthophosphate with ammonium molybdate under acidic conditions. The phosphomolybdic heteropoly acid was then reduced by ascorbic acid to form a characteristic blue complex, and the absorbance was measured at a wavelength of 600 nm.

[0037] All experiments were performed in triplicate, and the results are shown below. Figure 4 (exist Figure 4 In the diagram, A represents the relationship between different strains and sucrose content; B represents the relationship between different strains and inorganic phosphorus content.

[0038] Combination Figure 4The results showed that the inorganic phosphorus content in the latex of transgenic plants (OE-miR408b_1, OE-miR408b_2, OE-miR408b_3) was significantly increased, while the sucrose content was significantly decreased.

[0039] Example 5 PRI101-Ubi:: hbr-miR408b Positive plant quality index detection The main stem of the wild lettuce was gently cut with a blade, and the latex was collected in centrifuge tubes as a sample for testing. Sample analysis included the detection of two key indicators.

[0040] (1) Determination of molecular weight Add 1 ml of ddH2O to a centrifuge tube containing latex, shake at 30°C and 750 rpm for 40 min, centrifuge at 10000 rpm for 5 min, gently aspirate the supernatant with a pipette tip and discard it, repeat 3 times, and then determine the molecular weight using a Waters 1515GPC gel permeation chromatography system.

[0041] (2) Ash content determination Referring to GB / T 4498.1-2013, take about 5g of raw rubber and place it in a pre-weighed crucible, weigh it m2, carefully carbonize it on an adjustable electric furnace until there is no smoke, then place it in a muffle furnace and ignite it at 600℃ until the carbon black is completely oxidized, leaving white or light gray ash. Cool it to room temperature in a desiccator and weigh it m1 using a precision balance. Ash content = m1 / m2 × 100%.

[0042] (2) Determination of total solids content Take 1-1.2g of fresh latex and place it in a glass dish. Measure the weight as m1. Place the latex in a 60℃ oven and dry for 2-3 days. Measure the weight as m2. The total solids content = m1 / m2 × 100%.

[0043] All experiments were performed in triplicate, and the results are shown below. Figure 5 (exist Figure 5 In the diagram, A represents the relationship between different strains and the number-average molecular weight of latex; B represents the relationship between different strains and the weight-average molecular weight of latex; C represents the relationship between different strains and the ash content of latex; and D represents the relationship between different strains and the total solids content of latex.

[0044] Combination Figure 5 The results showed that the molecular weight, ash content, and total solids content of the latex from transgenic plants (OE-miR408b_1, OE-miR408b_2, OE-miR408b_3) increased. Figure 5 ).

[0045] The foregoing description illustrates and describes several preferred embodiments of the invention. However, as previously stated, it should be understood that the invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the inventive concept described herein through the foregoing teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the invention should be within the protection scope of the appended claims.

Claims

1. Rubber tree hbr-miR408b Genes, or those containing rubber tree genes. hbr-miR408b The application of gene-based biomaterials in gum-producing plants is characterized by, The application includes one or more of the following (1)-(6): (1) By enhancing the rubber tree in the plant hbr-miR408b The expression level of genes reduces the sucrose content of latex; (2) By enhancing the rubber tree in the plant hbr-miR408b Increase gene expression levels and increase the inorganic phosphorus content of latex; (3) By enhancing the rubber tree in the plant hbr-miR408b Gene expression levels increase the molecular weight of latex; (4) By enhancing the rubber tree in the plant hbr-miR408b Increase gene expression levels, thereby increasing the total solids content of latex; (5) By enhancing the rubber tree in the plant hbr-miR408b Increased gene expression levels lead to higher latex ash content. (6) By enhancing the rubber tree in the plant hbr-miR408b Increase gene expression levels to improve plant height; The plant in question is wild lettuce ( Lactuca serriola ); The rubber tree hbr-miR408b The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The biomaterials include: recombinant expression vectors or recombinant microorganisms.

3. The application according to claim 1, characterized in that, The biomaterial is PRI101-Ubi::hbr-miR408b.

4. The application according to claim 1, characterized in that, Used to expand the rubber tree hbr-miR408b The primer pairs for the gene include: hbr-miR408b-F and hbr-miR408b-R; The nucleotide sequence of hbr-miR408b-F is shown in SEQ ID NO:2; The nucleotide sequence of hbr-miR408b-R is shown in SEQ ID NO:

3.

5. A method for promoting plant vegetative growth, characterized in that, Includes the following steps: The rubber tree as described in claim 1 hbr-miR408b Genes are introduced into target plants to promote their vegetative growth. The plant in question is wild lettuce ( Lactuca serriola ).