CAPS molecular marker related to corn storage tolerance based on ZmNF-YB16 gene and application thereof

Abstract

This invention discloses a CAPS molecular marker based on the ZmNF-YB16 gene related to maize storage tolerance and its application. The molecular marker, named DNCAP604, was obtained by PCR amplification using the maize genome as a template via CAPS primer pairs. The marker contains an SNP site located at the 196th base of the PCR-amplified fragment. This SNP site is A in storage-tolerant maize materials and G in non-storage-tolerant maize materials. This invention analyzes the sequence variations in the coding region of the ZmNF-YB16 gene induced by aging stress in different maize inbred lines and performs association analysis with the seed storage tolerance of these inbred lines. By identifying associated sites, the molecular marker DNCAP604 was developed for marker-assisted selection. The average detection efficiency in identifying storage-tolerant inbred lines is 88.9%. This invention provides a new technical means for screening storage-tolerant maize germplasm.

Description

Technical Field

[0001] This invention relates to a molecular marker related to maize storage tolerance and its application, particularly to a molecular marker developed based on the nuclear factor Y gene ZmNF-YB16 related to maize storage tolerance and its application in screening maize germplasm resources for storage tolerance. This invention belongs to the field of crop breeding technology. Background Technology

[0002] The decline in seed vigor due to storage is a significant issue affecting food security. Seed storability is a comprehensive characteristic formed by the interaction and influence of intrinsic genetic material and external environment; it represents the ability to maintain high viability and stability after storage. Even under favorable storage conditions, seed vigor will slowly decrease, affecting germination rate. Identifying key functional genes related to maize seed storability is crucial for further molecular design breeding.

[0003] Seed storage tolerance is a quantitative trait controlled by multiple genes. Few genes related to seed storage tolerance have been identified in maize, mainly involving the raffinose pathway, toxic substance clearance / repair, and hormone pathways. The plant NF-Y gene family is large and multifunctional, with even more complex and sophisticated regulatory mechanisms. Currently reported NF-Y transcription factors regulate embryo and seed development, root and hypocotyl development, flowering, and responses to abiotic stress.

[0004] Lee et al. (2003) reported the first transcriptional activator, AtNF-YB9, or LEC1, associated with plant embryo maturation and cell differentiation. This gene negatively regulates AtABI3 and AtFUS3, controlling embryo development through hormonal signaling, while positively regulating genes related to fatty acid biosynthesis, thus affecting seed nutrient storage by influencing lipid synthesis. The homologous gene OsNF-YB2 in rice plays a crucial role in embryo development, influencing morphogenesis of rice meristems and interacting directly with MADS-like transcription factors to affect methylation in specific regions of the OsMADS1 promoter, thereby regulating panicle and grain development in rice. Xiong et al. (2019) discovered that rice NF-YC12 and NF-YB1 interact synergistically to regulate the rice sucrose transporter OsSUT1, regulating endosperm development and the accumulation of stored substances in rice seeds through multiple pathways.

[0005] The research group of the inventors of this invention previously cloned the candidate gene ZmNF-YB16, which is positively regulating the storage tolerance of maize seeds. Functional verification of seed storage tolerance after artificial aging showed that the storage tolerance of seeds in overexpressing lines was improved by 1-4 grades compared to the recipient control. To further confirm the function of the ZmNF-YB16 gene, it is necessary to analyze the sequence variation of its coding region in different maize inbred lines, conduct association analysis with the storage tolerance of the inbred lines, identify associated sites, and then develop molecular markers for marker-assisted selection, providing material and technical support for molecular breeding. Summary of the Invention

[0006] The purpose of this invention is to provide a CAPS molecular marker based on the gene ZmNF-YB16 that is related to the storage tolerance of maize seeds and its application.

[0007] To achieve the above objectives, the present invention employs the following technical means:

[0008] This invention discloses a CAPS molecular marker, named DNCAP604, developed based on the ZmNF-YB16 gene and associated with the storage tolerance of maize seeds. This molecular marker is obtained by PCR amplification using a maize genome as a template via a CAPS primer pair. The marker contains an SNP site located at the 196th base of the PCR amplified fragment. In storage-tolerant maize materials, the SNP site is A, therefore the PCR amplified fragment can be cleaved into two fragments by the AluI restriction endonuclease; in non-storage-tolerant maize materials, the SNP site is G, therefore the PCR amplified fragment cannot be cleaved by the AluI restriction endonuclease. The sequence of the CAPS primer pair is shown below:

[0009] Upstream primer: 5'TCGTCAACGCACAATGGC 3';

[0010] Downstream primer: 5'TTACCGACACCAAGCAAGAA 3'.

[0011] Preferably, using CAPS primer pairs, a 318bp fragment is obtained by PCR amplification using the maize genome as a template, and its nucleotide sequence is shown in SEQ ID NO.2 or SEQ ID NO.3. The PCR amplification fragment of the non-storage-resistant maize material is shown in SEQ ID NO.2 and cannot be cleaved by the AluⅠ restriction endonuclease. The PCR amplification fragment of the storage-resistant maize material is shown in SEQ ID NO.3 and can be cleaved by the AluⅠ restriction endonuclease into two fragments of 197bp and 121bp, as shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0012] The primer pairs used to obtain the CAPS molecular markers are also within the scope of protection of this invention, and the sequences of the primer pairs are shown below:

[0013] Upstream primer: 5'TCGTCAACGCACAATGGC 3';

[0014] Downstream primer: 5'TTACCGACACCAAGCAAGAA 3'.

[0015] Furthermore, this invention also proposes the application of the aforementioned CAPS molecular marker and primer pair in marker-assisted breeding for maize storage tolerance.

[0016] Furthermore, this invention also proposes a method for screening storage-resistant corn materials, comprising the following steps:

[0017] (1) Using maize inbred lines with different storage tolerance as test materials, after soaking and germination, the genomic DNA was extracted by CTAB method when the seeds grew to the three-leaf-one-heart stage;

[0018] (2) Using the total genomic DNA extracted in step (1) as a template, PCR amplification was performed using the following CAPS primer pair to obtain the CAPS molecular marker DNCAP604 associated with the storage tolerance of maize seeds. The CAPS primer pair sequence is shown below:

[0019] Upstream primer: 5'TCGTCAACGCACAATGGC 3';

[0020] Downstream primer: 5'TTACCGACACCAAGCAAGAA 3';

[0021] (3) The PCR amplification products obtained in step (2) are digested with restriction endonuclease AluⅠ. The maize materials that can be digested by AluⅠ into two fragments of 197bp and 121bp are storable maize materials; those that cannot be digested by AluⅠ and are detected as a 318bp band are non-storable maize materials.

[0022] Among them, the preferred maize inbred lines with different storage tolerance are obtained by using monotypic inbred lines with excellent storage tolerance as donors, and transferring the ZmNF-YB16 gene into important inbred lines whose stress resistance needs to be improved in breeding through hybridization and backcrossing. Storage-tolerant maize materials with a background recovery rate of more than 99% can be obtained in the BC3F1 generation by using DNCAP604 molecular marker-assisted selection.

[0023] Preferably, the monomeric self-pollinated lines with excellent storage resistance are selected from Dong 156, Moqun 17 and Za C546.

[0024] Preferably, the nucleotide sequence of the PCR amplification fragment of the non-storage-resistant material is shown in SEQ ID NO.2, and the nucleotide sequence of the PCR amplification fragment of the storage-resistant maize material is shown in SEQ ID NO.3. Both fragments can be digested by the AluⅠ restriction endonuclease into two fragments of 197bp and 121bp, as shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0025] Compared with the prior art, the beneficial effects of the present invention are:

[0026] This invention analyzes the sequence variations in the coding region of the gene ZmNF-YB16, which is induced by aging stress, in different maize inbred lines. It then performs correlation analysis with the seed storage tolerance of the inbred lines, identifies the associated sites, and develops the molecular marker DNCAP604 for marker-assisted selection. The detection efficiency is 88.9% on average in identifying storage-tolerant inbred lines. This invention provides a new technical means for screening storage-tolerant maize germplasm. Attached Figure Description

[0027] Figure 1 The location of the maize ZmNF-YB16 gene, SNP site, molecular marker DNCAP604, and related primers in region 7.05 of chromosome 7.

[0028] In this diagram, the green text represents the coding region sequence (639 bp); the red text combined with the green text represents the full length of the ZmNF-YB16 gene (1080 bp); the molecular marker primer DNCAP604F / R is highlighted in yellow (amplified fragment length 318 bp); primer 16-1F / R is highlighted in green (amplified fragment length 769 bp); primer 16-2F / R is highlighted in blue (amplified fragment length 729 bp); and the restriction enzyme sites are highlighted in gray, with the mutant bases in parentheses.

[0029] Figure 2 For enzyme digestion verification of DNCAP604;

[0030] Note: Lanes 1-9 on the left are after enzyme digestion; lanes 1-9 on the right are before enzyme digestion; M: Trans 2K;

[0031] Figure 3 To improve maize germplasm using CAPS molecular markers. Detailed Implementation

[0032] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description of the specific embodiments. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0033] Example 1. Sequence variation analysis of the coding region (CDS) of the maize gene ZmNF-YB16.

[0034] 1. Resequencing of the CDS region of the ZmNF-YB16 gene in different maize inbred lines

[0035] The ZmNF-YB16 gene, named Zm00001d022099 in the MaizeGDB database and with NCBI accession number LOC100281337, is located in region 7.05 of chromosome 7. It is 1080 bp in length (SEQ ID NO.1), containing one exon of 639 bp (157 bp - 795 bp) encoding 212 amino acids. Using the NCBI Reference B73 RefGen_V4 genome as a reference, specific primers were designed for the candidate gene using Primer 5.0 software. To ensure the integrity of the gene sequencing, the ZmNF-YB16 gene coding region was divided into two segments for amplification: the first segment was 767 bp long, and the second segment was 729 bp long. The primers were named 16-1F / R and 16-2F / R, respectively. The sequence information is shown in Table 2. The coding region sequence of the ZmNF-YB16 gene was amplified from 153 maize inbred lines (Table 1) using the primers described above. The positions of primers 16-1F / R and 16-2F / R in region 7.05 of chromosome 153 are shown below. Figure 1 As shown.

[0036] Table 1.153 maize inbred lines and their pedigree sources

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043] Table 2 Primer sequences for CDS region amplification

[0044]

[0045] Sequencing results were processed and assembled using Excel and SnapGene, then compared using DNAMAN and MEGA X. The ZmNF-YB16 gene sequence was analyzed using DnaSPv6.0 software, and based on the different SNP sites, it was divided into different haplotypes. At the same time, the superior haplotype was preliminarily determined by combining the association analysis results.

[0046] 2. Haplotype analysis of the ZmNF-YB16 gene

[0047] Fourteen SNP sites were detected in the coding region of the ZmNF-YB16 gene in the tested maize inbred lines. Polymorphic sites were genotyped according to nucleotide mutation type and number. SNPs were classified into six types: G / C mutation, A / G mutation, C / G mutation, G / A mutation, T / C mutation, and C / T mutation (Table 3). Analysis using DNASPV6.0 software detected 20 haplotypes, with a haplotype density of 0.87. The main haplotypes were HAP1, HAP2, HAP4, HAP5, and HAP6, accounting for 77.78% of the tested materials. The remaining haplotypes were fewer in number and belonged to rare variants. The HAP1 monomer type has 39 inbred lines, mainly composed of materials with poor storage resistance such as H10, J001, JI465, and JINHUANG55; the HAP6 monomer type has 20 inbred lines, mainly composed of materials with strong storage resistance such as 444, 502, ZHENG22, and ZHENG35; and the HAP5 monomer type has 24 inbred lines, mainly composed of materials with moderate storage resistance such as HE344, JI412, and ZAO49 (Table 4).

[0048] Table 3. SNP locations of the ZmNF-YB16 gene

[0049]

[0050] Table 4. Inbred lines corresponding to ZmNF-YB16 genotypes

[0051]

[0052]

[0053]

[0054] 3. SNP variation analysis in the coding region of the ZmNF-YB16 gene

[0055] The translation of the coding region of the ZmNF-YB16 gene was performed using DNAMAN software. It was found that 11 of the 14 SNP sites were synonymous mutations that did not affect the amino acid sequence; 3 SNP sites were non-synonymous mutations that may change the structure and physiological function of the protein and thus affect the resistance expression (Table 5).

[0056] Table 5. Amino acid changes corresponding to SNP mutations in the coding region of the ZmNF-YB16 gene.

[0057]

[0058] Example 2: Development of CAPS molecular markers related to maize seed storage tolerance

[0059] 1. Association analysis of SNP variation in the coding region of the ZmNF-YB16 gene with seed storage tolerance

[0060] Based on phenotypic identification data from artificial aging treatment, the association analysis of 14 SNP sites in the CDS region sequence of the ZmNF-YB16 gene of the tested maize inbred lines with storage tolerance phenotypic indices was performed using the general linear model (GLM) in TASSEL 5.0 software. The results showed that at the 0.05 level, SNPs 604 and 255 were significantly associated with traits such as relative germination rate (RGP) and relative germination index (RGI) of maize seeds (see Table 6), with SNP 604 being a non-synonymous mutation site. Based on the association and haplotype analysis results, three haplotypes of HAP13 were found to be entirely storage-tolerant, and therefore considered excellent storage-tolerant haplotypes. These three inbred lines were Dong 156, Moqun 17, and Za C546.

[0061] Table 6. Association analysis between the CDS region of the ZmNF-YB16 gene and seed storage tolerance.

[0062]

[0063] 2. Development of CAPS molecular markers related to maize seed storage tolerance

[0064] Based on the CDS region association analysis of the ZmNF-YB16 gene, the SNP604 (G / A) site, which has a high phenotypic contribution rate and is a non-synonymous mutation, was selected for CAPs molecular marker development. The optimal restriction site and restriction endonuclease selection were analyzed using the dCAPsFinder2.0 online website. The SNP604 site was converted into a CAPs marker and named DNCAP604. A 318 bp fragment (SEQ ID NO.2) was amplified using the specific primers CAPS604-F / R, where the 196th base is the mutation site. The high-storage-resistance material is A, which can be cleaved by the AluI restriction endonuclease (AG↓CT) into two fragments: 197 bp (SEQ ID NO.3) and 121 bp (SEQ ID NO.4). The low-storage-resistance material is G, which cannot be cleaved by the AluI restriction endonuclease. Figure 1 , Figure 2 ).

[0065] The sequence of the primer CAPS604-F / R is shown below:

[0066] Upstream primer: 5'TCGTCAACGCACAATGGC3';

[0067] Downstream primer: 5'TTACCGACACCAAGCAAGAA3'.

[0068] Example 3: Application of CAPS functional markers related to storage tolerance of maize seeds

[0069] 1. Phenotypic identification of the storage tolerance of seeds from different maize inbred lines

[0070] Based on the laboratory's previous identification results of the storage tolerance of 153 maize inbred lines using artificial aging treatment, and using the total genomic DNA of 153 maize inbred lines with different storage tolerances as templates, the genotypes were analyzed using CAPS markers. The selection efficiency of the developed CAPS markers was analyzed by combining the genotypes of the 153 materials with the identified storage tolerance phenotypes. The 153 maize inbred lines and their pedigrees are shown in Table 7.

[0071] Table 7. Storage tolerance of 153 maize inbred lines

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078] Note: Storage tolerance gradually increases from I to V.

[0079] 2. Selection efficiency analysis of CAPS molecular markers related to maize seed storage tolerance

[0080] The CAPS molecular marker DNCAP604, developed based on SNP sites in the coding region of the ZmNF-YB16 gene that are significantly associated with storage tolerance, was validated in 153 maize inbred lines. The molecular concordance rate was then assessed in conjunction with the results of storage tolerance phenotype identification. The specific methods are as follows:

[0081] (1) Using 153 maize inbred lines as test materials, after soaking and germination, the genomic DNA was extracted by CTAB method when the seeds grew to the three-leaf-one-heart stage;

[0082] (2) Using the total genomic DNA extracted in step (1) as a template, PCR amplification was performed using specific primers CAPS604-F / R. The primer pair sequences are shown below:

[0083] CAPS604-F: 5'TCGTCAACGCACAATGGC3';

[0084] CAPS604-R: 5'TTACCGACACCAAGCAAGAA3';

[0085] (3) The PCR amplification product obtained in step (2) is digested with restriction endonuclease AluⅠ. The corn material that can be digested by AluⅠ into two fragments of 197bp (shown in SEQ ID NO.4) and 121bp (shown in SEQ ID NO.5) is a storage-resistant corn material; the corn material that cannot be digested by AluⅠ and shows a single band of 318bp (shown in SEQ ID NO.2) is a non-storage-resistant corn material.

[0086] Among 153 maize inbred lines with different storage tolerance, the concordance rate of the DNCAP604 molecular marker was tested. A total of 9 materials could be cut, of which 8 were maize materials with medium or higher storage tolerance. The concordance rate between genotype and phenotype was 88.89% (Table 8).

[0087] Table 8. Selection efficiency analysis of molecular marker DNCAP604

[0088]

[0089] 3. Application of CAPS molecular markers to improve the seed storage tolerance of maize germplasm

[0090] This invention is based on the aging stress-responsive gene ZmNF-YB16, which positively regulates the storage tolerance of maize seeds, identified by our research group. We discovered a superior haplotype of this gene, HAP13 (including three maize inbred lines: Dong 156, Moqun 17, and Za C546), which can be used for marker-assisted selection. Using the superior haplotype inbred lines as donors, ZmNF-YB16 is transferred into important inbred lines requiring improved stress resistance through hybridization and backcrossing. DNCAP604 marker-assisted selection significantly accelerates the breeding process, yielding new materials with a background recovery rate exceeding 99% in the BC3F1 generation. These materials can then be used for crossbreeding and breeding new maize varieties.

[0091] The results showed that the BC3F1 maize inbred lines Dong503, Dong701, and Dong237, improved using Dong156 as the donor parent, all significantly improved storage tolerance and increased relative germination rate by 7%-10%. Figure 3 ).

Claims

1. A CAPS molecular marker, named DNCAP604, developed based on the ZmNF-YB16 gene and associated with the storability of maize seeds, is obtained by PCR amplification using a maize genome as a template via a CAPS primer pair. The molecular marker contains an SNP site located at the 196th base of the PCR amplified fragment. In storability-tolerant maize material, the SNP site is A, therefore the PCR amplified fragment can be cleaved into two fragments by the AluI restriction endonuclease; in non-storability-tolerant maize material, the SNP site is G, therefore the PCR amplified fragment cannot be cleaved by the AluI restriction endonuclease. The sequence of the CAPS primer pair is shown below: Upstream primer: 5'TCGTCAACGCACAATGGC 3'; Downstream primer: 5'TTACCGACACCAAGCAAGAA 3'.

2. The CAPS molecular marker as described in claim 1, characterized in that, Using CAPS primer pairs, a 318bp fragment was obtained by PCR amplification using maize genome as a template. The nucleotide sequence of the fragment is shown in SEQ ID NO.2 or SEQ ID NO.

3. The PCR amplification fragment of non-storage-resistant maize material is shown in SEQ ID NO.2 and cannot be cleaved by AluI restriction endonuclease. The PCR amplification fragment of storage-resistant maize material is shown in SEQ ID NO.3 and can be cleaved by AluI restriction endonuclease into two fragments of 197bp and 121bp, as shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

3. Obtaining the primer pair of the CAPS molecular marker as described in claim 1 or 2, characterized in that, The sequences of the primer pairs are shown below: Upstream primer: 5'TCGTCAACGCACAATGGC 3'; Downstream primer: 5'TTACCGACACCAAGCAAGAA 3'.

4. The application of the CAPS molecular marker as described in claim 1 or 2 in marker-assisted breeding of maize storage tolerance.

5. The application of the primer pair according to claim 3 in marker-assisted breeding of maize storage tolerance.

6. A method for screening storage-resistant corn materials, characterized in that, Includes the following steps: (1) Using maize inbred lines with different storage tolerance as test materials, after soaking and germination, the genomic DNA was extracted by CTAB method when the seeds grew to the three-leaf-one-heart stage; (2) Using the total genomic DNA extracted in step (1) as a template, PCR amplification was performed using the following CAPS primer pair to obtain the CAPS molecular marker DNCAP604 associated with the storage tolerance of maize seeds. The CAPS primer pair sequence is shown below: Upstream primer: 5'TCGTCAACGCACAATGGC 3'; Downstream primer: 5'TTACCGACACCAAGCAAGAA 3'; (3) The PCR amplification products obtained in step (2) are digested with restriction endonuclease AluⅠ. The maize materials that can be digested by AluⅠ into two fragments of 197bp and 121bp are storable maize materials; those that cannot be digested by AluⅠ and are detected as a 318bp band are non-storable maize materials.

7. The method as described in claim 6, characterized in that, Different storage-resistant maize inbred lines were obtained by transferring the ZmNF-YB16 gene into important inbred lines that require improvement in stress resistance during breeding, using monotypic inbred lines with excellent storage resistance as donors and through hybridization and backcrossing. Storage-resistant maize materials with a background recovery rate of over 99% can be obtained in the BC3F1 generation by using DNCAP604 molecular marker-assisted selection.

8. The method as described in claim 6, characterized in that, The excellent storage-resistant monoculture self-pollinated lines are selected from Dong 156, Moqun 17 and Za C546.

9. The method as described in claim 6, characterized in that, The nucleotide sequence of the PCR amplification fragment of the non-storage-resistant material is shown in SEQ ID NO.2, and the nucleotide sequence of the PCR amplification fragment of the storage-resistant maize material is shown in SEQ ID NO.

3. Both fragments can be digested by the AluⅠ restriction endonuclease into two fragments of 197bp and 121bp, as shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

Images