Shrna for down-regulating or knocking down the expression of fbxo44 gene and application thereof

By downregulating FBXO44 gene expression through shRNA and recombinant adenovirus vector, the unclear role of FBXO44 in diabetic cardiomyopathy was resolved, achieving the effects of reducing cardiomyocyte apoptosis and improving diabetic myocardial damage.

CN122256346APending Publication Date: 2026-06-23YICHANG CENT PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610258123.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-04
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

In the current technology, the specific role of the FBXO44 gene in diabetic cardiomyopathy is not yet clear, leading to cardiomyocyte apoptosis and mitochondrial dysfunction, which in turn affects cardiac function.

Method used

We provide shRNA that downregulates or knocks down FBXO44 gene expression and its recombinant adenovirus vector for the preparation of pharmaceutical compositions to treat diabetic cardiomyopathy.

Benefits of technology

By downregulating FBXO44 gene expression, mitochondrial apoptosis in cardiomyocytes can be reduced, thus improving diabetic myocardial damage and providing a targeted intervention strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256346A_ABST
    Figure CN122256346A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of medicine, in particular to a kind of shRNA for down-regulating or knocking down FBXO44 gene expression and application thereof.The nucleotide sequence of the shRNA is as shown in SEQ.ID.NO:1.The shRNA capable of down-regulating or knocking down FBXO44 gene expression is designed, the shRNA can reduce myocardial cell mitochondrial pathway apoptosis by down-regulating or knocking down FBXO44 gene expression, thereby effectively improving the occurrence and development of diabetic myocardial injury, and provides a new strategy for targeted intervention of diabetic myocardial injury.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to a shRNA that downregulates or knocks down the expression of the FBXO44 gene and its applications. Background Technology

[0002] Diabetic cardiomyopathy is a serious complication of diabetes, with cardiomyocyte apoptosis being a core factor leading to decreased cardiac function. Studies have shown that mitochondrial dysfunction plays a crucial role in high-glucose / high-fat induced myocardial injury, triggering mitochondrial membrane potential collapse, cytochrome C release, and caspase-3 activation, ultimately initiating apoptosis via the mitochondrial pathway.

[0003] FBXO44 (F-box only protein 44) belongs to the F-box protein family and is located on human chromosome 1p36. It is a component of CF-type E3 ubiquitin ligases, comprising 5 introns and 6 exons, and is abundantly expressed in heart, liver, and brain tissue. As a component of the E3 ubiquitin ligase complex, FBXO44 may regulate the stability of mitochondrial function-related proteins through the ubiquitin-proteasome system, but its specific role in diabetic myocardial injury remains unclear. Summary of the Invention

[0004] In view of the above, the present invention provides shRNAs that downregulate or knock down the expression of the FBXO44 gene and their applications, providing a new treatment strategy for diabetic cardiomyopathy.

[0005] To achieve the above objectives, the first aspect of the present invention provides an shRNA that downregulates or knocks down the expression of the FBXO44 gene, the nucleotide sequence of which is shown in SEQ. ID. NO: 1.

[0006] A second aspect of the present invention provides a recombinant adenovirus vector comprising shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above.

[0007] A third aspect of the present invention provides the use of the shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above, or the recombinant adenovirus vector as described above, in the preparation of a medicament for treating diabetic cardiomyopathy.

[0008] A fourth aspect of the present invention provides a pharmaceutical composition comprising the shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above, or the recombinant adenovirus vector as described above.

[0009] Preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients.

[0010] The present invention has the following beneficial effects: This invention designs an shRNA that can downregulate or knock down the expression of the FBXO44 gene. This shRNA can reduce mitochondrial apoptosis in cardiomyocytes by downregulating or knocking down the expression of the FBXO44 gene, thereby effectively improving the occurrence and development of diabetic myocardial injury and providing a new strategy for targeted intervention of diabetic myocardial injury. Attached Figure Description

[0011] Figure 1 These are Hoechst staining results of H9C2 cardiomyocytes in each group in Example 1; Figure 2 These are representative images of H9C2 cardiomyocytes stained with DHE in each group in Example 1; Figure 3 These are representative images of JC-1 staining of H9C2 cardiomyocytes from each group in Example 1; Figure 4 These are representative images of CytC mitochondrial colocalization staining in H9C2 cardiomyocytes from each group in Example 1; Figure 5 These are representative transmission electron micrographs of H9C2 cardiomyocytes from each group in Example 1; Figure 6 This refers to the Western blot detection results in Example 2; Figure 7 This is the gel image result of rat tail genotype identification in Example 2; Figure 8 These are the echocardiogram results of each group of mice in Example 2; Figure 9 These are representative pathological images of mouse heart tissue from each group in Example 2; Figure 10 These are representative images of Tunel staining of mouse heart tissue from each group in Example 2; Figure 11 These are representative images of DHE staining of mouse heart tissue from each group in Example 2; Figure 12 These are representative transmission electron micrographs of mouse heart tissue from each group in Example 2. Detailed Implementation

[0012] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0013] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0014] During their research, the inventors of this invention discovered a significant relationship between the FBXO44 gene and the apoptosis of mitochondrial cells in diabetic cardiomyopathy. They further found that downregulating or knocking down the expression of the FBXO44 gene can reduce mitochondrial apoptosis in cardiomyocytes, thereby effectively improving the development and progression of diabetic myocardial damage. Based on this, this invention was completed.

[0015] The first aspect of the present invention provides a shRNA that downregulates or knocks down the expression of the FBXO44 gene, the nucleotide sequence of which is shown in SEQ. ID. NO: 1.

[0016] SEQ. ID. NO: 1: CCTCAAGGCTGAAGGGTAT In this invention, the nucleotide sequence of the FBXO44 gene is shown in SEQ. ID. NO: 2.

[0017] SEQ. ID. NO: 2: ATGGCTGTAGGCAACATCAACGAGCTGCCGGAGAACATTCTGCTGGAACTGTTCACCCACATCCCGGCTCGCCAGCTACTGCTGCGCTGCCGACCAGTCTGCAGCCTCTGGAGAGACCTCATTGACCTGGTCACACTCTGGAAGCGCAAGTGCCTTCAGGAGGGCTTCATCACCGAGGACTGGGACCAGCCC GTGGCTGACTGGAAGATCTTCTATTTCCTGCGTAGCCTCCAGAGGAACCTCCTTCACAACCCTTGTGCCGAAGAGGGCTTTGAGTTCTGGAGCCTGGATGTGAATGGAGGAGATGAATGGAAGGTGGAGGATCTCTCCAAGGACCAGCGGAAGGAATTCCCCAATGACCAGGTCAAGAAATACTTCGTGACT TCCTATTACACCTGCCTCAAGTCCCAGGTGGTGGACCTCAAGGCTGAAGGGTATTGGGAGGAACTGATGGACACCACCCGACCGGACATCGAGGTCAAGGACTGGTTTGCAGCCAGGCCGGACTGCGGGTCCAAGTACCAGCTGTGCGTCCAACTCCTGTCGTCAGCTCACGCACCACTGGGAACCTTCCAG CCGGACCCAGTGATGATCCAGCAGAAAAGCGATGCCAAGTGGAGGGAGGTCTCACACACATTCTCCAACTATCCGCCCGGCGTCCGCTACATCTGGTTTCAGCACGGAGGCGTGGACACCCACTACTGGGCCGGCTGGTACGGCCCGAGAGTCACCAACAGCAGCGTCATCATCGGGCCTCCGCTGCCCTGA A second aspect of the present invention provides a recombinant adenovirus vector comprising shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above.

[0018] The present invention does not have any special requirements for the construction method of the recombinant adenovirus vector. Conventional methods in the art can be used to achieve the expression of the target gene.

[0019] In some preferred embodiments, the adenovirus vector may be pADV-U6-shRNA-CMV-EGFP. The adenovirus vector pADV-U6-shRNA-CMV-EGFP may be provided by Heyuan Biotechnology (Shanghai) Co., Ltd.

[0020] A third aspect of the present invention provides the use of the shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above, or the recombinant adenovirus vector as described above, in the preparation of a medicament for treating diabetic cardiomyopathy.

[0021] A fourth aspect of the present invention provides a pharmaceutical composition comprising the shRNA that downregulates or knocks down the expression of the FBXO44 gene as described above, or the recombinant adenovirus vector as described above.

[0022] In some preferred embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. The excipient may be one or more of a variety of formulations or compounds conventionally used in the art, such as pH buffers, protectants, and osmotic regulators.

[0023] Example 1 This embodiment constructs a recombinant adenovirus vector carrying up- and down-regulated FBXO44 genes, infects H9C2 cardiomyocytes induced by high glucose and high insulin, and explores the key regulatory role of FBXO44 in mitochondrial pathway apoptosis. The focus is on evaluating its effects on key apoptosis indicators such as mitochondrial membrane potential, cytochrome C (CytC) release, and Caspase-3 activation, aiming to clarify the function of FBXO44 in aggravating apoptosis in diabetic cardiomyocytes.

[0024] (1) The FBXO44 adenovirus vector was constructed using the AdMax system from Microbix, Canada. The working principle of the AdMax system is to use Cre / LoxP (or FLP / frt) recombinase to recombine the shuttle plasmid carrying the foreign gene with the backbone plasmid in HEK293 cells to produce adenovirus.

[0025] The following two groups of recombinant adenovirus vectors were obtained: The overexpression adenovirus vector, named pcADV-CMV-FBXO44-linker-EGFP-3xFLAG (transcription number NM_001191576.1, the full-length overexpression transcript sequence can be found on NCBI), is designated as the FBXO44 upregulated group (Ad-FBXO44 group); the control adenovirus vector, pcADV-CMV-EGFP-3xFLAG, is designated as the upregulated empty vector group (Ad-GFP group). The knockdown adenovirus vector was named pADV-U6-shRNA(FBXO44)-CMV-EGFP, with the shRNA sequence CCTCAAGGCTGAAGGGTAT (SEQ. ID. NO: 1). The corresponding group was named the FBXO44 downregulated group (Ad-FBXO44-shRNA group). The control adenovirus vector was pADV-U6-shRNA(NC2)-CMV-EGFP, with the shRNA sequence CCCGGACTGTAAACTACAGAT (SEQ. ID. NO: 3). The corresponding group was named the downregulated viral empty vector group (Ad-GFP-shRNA group).

[0026] (2) H9C2 cells were treated with FBXO44 adenovirus transfection technology. The experiment was designed with 6 groups: normal culture group (Control group), high glucose and high insulin group (HGHI group), HGHI+ upregulated viral empty vector group (Ad-GFP group), HGHI+ FBXO44 upregulated group (Ad-FBXO44 group), HGHI+ downregulated viral empty vector group (Ad-GFP-shRNA group), and HGHI+ FBXO44 downregulated group (Ad-FBXO44-shRNA group). After transfecting H9C2 cardiomyocytes with adenovirus at MOI=100 for 48 h, the treatment groups were treated with high glucose and high insulin for 12 h to construct a high glucose and high insulin induced H9C2 cardiomyocyte injury model. Hoechst staining was used to detect the degree of cardiomyocyte apoptosis; DHE staining was used to detect the level of reactive oxygen species (ROS) in cardiomyocytes; JC-1 staining was used to detect the mitochondrial membrane potential; confocal microscopy was used to observe the co-localization of mitochondria and CytC; and transmission electron microscopy was used to observe the up- and down-regulated mitochondrial cristae in FBXO44 cells.

[0027] Hoechst staining results of H9C2 cardiomyocytes in each group are as follows: Figure 1 As shown, dark blue represents normal cells, and bright blue represents apoptotic cells (white arrows indicate apoptotic cells). Combined with... Figure 1 The Hoechst staining results showed that, under the same high glucose (25 mmol / L) conditions, stimulation with 200 nmol / L INS for 12 h upregulated FBXO44, which aggravated apoptosis, while downregulation of FBXO44 improved apoptosis.

[0028] Representative images of H9C2 cardiomyocytes stained with DHE from each group are shown below. Figure 2 As shown, DHE staining results indicate that upregulation of FBXO44 significantly increases ROS content and raises oxidative stress levels, while downregulation of FBXO44 reduces oxidative stress levels.

[0029] Figure 3Representative images of H9C2 cardiomyocytes from each group after JC-1 staining are shown. Red fluorescence indicates a higher mitochondrial membrane potential, while green fluorescence indicates a lower mitochondrial membrane potential. JC-1 staining results indicate that upregulation of FBXO44 decreases the mitochondrial membrane potential, while downregulation of FBXO44 increases the mitochondrial membrane potential.

[0030] Figure 4 Representative images of CytC co-localization staining in H9C2 cardiomyocytes from each group are shown. Red indicates cytochrome C, the mitochondrial intermembrane protein; green indicates mitochondria; and blue indicates the nucleus. CytC confocal staining results showed that upregulation of FBXO44 led to increased CytC release from mitochondria, indicating aggravated mitochondrial damage, while downregulation of FBXO44 led to decreased CytC release, indicating reduced mitochondrial damage.

[0031] Figure 5 These are representative transmission electron microscopy images of H9C2 cardiomyocytes from each group. The transmission electron microscopy results show that upregulation of FBXO44 aggravates mitochondrial damage, specifically manifested as disordered vacuoles and cristae structures within the mitochondria, while downregulation of FBXO44 results in a reduction of abnormal mitochondria.

[0032] The above experimental results indicate that under high glucose conditions, upregulation of FBXO44 exacerbates oxidative stress, induces mitochondrial dysfunction (decreased membrane potential and structural damage), and promotes cytochrome C release, ultimately leading to increased cardiomyocyte apoptosis. Conversely, downregulation of FBXO44 effectively reduces oxidative damage, protects mitochondrial integrity, and inhibits apoptosis. These results suggest that FBXO44 is a key factor mediating high glucose-induced myocardial damage, and targeted inhibition of FBXO44 expression may be a potential strategy for treating diabetic cardiomyopathy.

[0033] Example 2 By transferring a Cre expression element driven by the promoter of the mouse endogenous myosin heavy chain 6 (MYH6 or αMHC) gene into the mouse genome using transgenic (TG) gene editing technology, Cre enzyme expression can be observed in cardiomyocytes, resulting in MYH6-Cre mice. When these mice are crossed with mice containing loxp sites, sequence deletion or recombination between loxp sites mediated by Cre recombinase can occur in the cardiomyocytes of the offspring mice.

[0034] Using this technology, we successfully constructed 8-week-old FBXO44 cardiomyocyte-specific gene knockout C57BL / 6 mice (FBXO44-CKO) and littermate control FBXO44-loxp mice. Genotyping of the mouse tails was determined by PCR and agarose gel electrophoresis, and FBXO44 knockout was detected by Western blot.

[0035] Figure 6 The results are from Western blot analysis, where... Figure 6 A represents the protein expression of FBXO44 in myocardial-specific knockout mice with β-actin as an internal control. Figure 6 B represents the relative expression level of FBXO44 protein with β-actin as an internal control. P <0.05. Figure 7 This is a gel image showing the results of genotyping in the rat tail. Western blot results showed that, compared with the FBXO44-loxp group, the FBXO44-CKO group had significantly lower FBXO44 protein expression. P <0.05, combined with the results of tail genotyping, showed that the FBXO44-CKO group mice showed a clear band at 530bp (basepair), indicating that the FBXO44 cardiomyocyte-specific gene knockout C57BL / 6 mouse strain was successfully established.

[0036] Next, a diabetic mouse model was established using a high-fat diet combined with intraperitoneal injection of STZ. Mice were first fed a high-fat diet (HFD) for 3 months to induce insulin resistance, followed by intraperitoneal injection of an appropriate amount of STZ (pH 4.5; 50 mg / kg) for five consecutive days. Seven days after STZ injection, a fasting blood glucose level ≥16.7 mmol / L was considered a successful establishment of the diabetic model. The mice were then fed an HFD diet for another 2 months to establish a type 2 diabetic myocardial injury model. Echocardiography was used to detect cardiac function parameters (left ventricular ejection fraction LVEF, left ventricular fraction of shortening LVFS; cardiac weight index HW / BW; heart weight to tibia length ratio HW / TL); histopathological examination was performed to assess cardiac structural remodeling (HE, Masson, WGA, Sirius Red staining); TUNEL staining was used to detect the degree of tissue cell apoptosis; DHE staining was used to detect the level of reactive oxygen species (ROS) in cardiomyocytes; and electron microscopy was used to observe the number of lipid droplets and the structure of mitochondrial cristae to analyze lipid metabolism and mitochondrial structural status, respectively.

[0037] Figure 8 The results are from echocardiography, among which... Figure 8 A shows representative echocardiogram images of the hearts of mice in each group; Figure 8 B represents the LVEF values ​​of mice in each group. P <0.05; Figure 8 C represents the LVFS value of mice in each group. P <0.05; Figure 8 D represents the HW / BW ratio of mice in each group. P <0.05; Figure 8 E represents the HW / TL value of mice in each group. P <0.05. Echocardiographic results showed that, compared with the FBXO44-loxp group, the FBXO44-CKO group had increased LVEF and LVFS, and decreased HW / BW and HW / TL, indicating that myocardial-specific knockout of FBXO44 significantly improved cardiac function in diabetic mice.

[0038] Figure 9 These are representative images of cardiac tissue pathological staining in each group of mice. From left to right: HE staining, Masson staining, Sirius Red staining, and WGA staining. Microscopic observation of the histopathological staining results showed that, compared with the FBXO44-CKO group, the FBXO44-loxp group exhibited more disordered myocardial fiber course, inconsistent nucleus positions, and indistinct cell boundaries in H&E staining. Simultaneously, Masson and Sirius Red staining revealed large areas of myocardial collagen fibers, with myocardial fiber breakage, swelling, and increased collagen deposition, indicating a higher degree of myocardial fibrosis in the FBXO44-loxp group, suggesting that myocardial-specific knockout of FBXO44 improved myocardial fibrosis. Furthermore, WGA staining further showed hypertrophy of cardiomyocytes in the FBXO44-loxp group, indicating further deterioration of myocardial structure. These results indicate that myocardial-specific knockout of FBXO44 improves myocardial tissue damage in diabetic mice.

[0039] Figure 10 The images show representative images of Tunel staining of heart tissue from each group of mice. The Tunel staining results indicate that the degree of cardiomyocyte apoptosis was reduced in the FBXO44-CKO group compared with that in the FBXO44-loxp group. Figure 11 The images show representative DHE staining results of mouse heart tissue from each group. The DHE staining results indicate that the ROS content and oxidative stress level were significantly reduced in the FBXO44-CKO group. Figure 12 The images show representative transmission electron microscopy (TEM) images of cardiac tissue from each group of mice. Black arrows indicate damaged mitochondria, and red arrows indicate lipid droplets. TEM observation revealed a reduction in abnormal mitochondria in the FBXO44-CKO group, specifically a decrease in macromitochondria, vacuoles, and mitochondria with disordered cristae structures, as well as a reduction in lipid droplets. This indicates that myocardial-specific knockout of FBXO44 improves mitochondrial damage in cardiomyocytes of diabetic mice.

[0040] The above experiments and tests demonstrate that this embodiment successfully established a type 2 diabetic myocardial injury model by simultaneously treating FBXO44 cardiomyocyte-specific gene knockout C57BL / 6 mice and littermate control mice according to the same culture method. Tests revealed that, compared to littermate control mice, the myocardial tissue damage in FBXO44 cardiomyocyte-specific gene knockout C57BL / 6 mice, cultured using the same method, was significantly lower, proving a significant relationship between FBXO44 gene expression and diabetic cardiomyopathy.

[0041] Based on the content of Examples 1 and 2, it can be seen that there is a significant relationship between the expression of the FBXO44 gene and diabetic cardiomyopathy. Downregulating FBXO44 expression can effectively improve the occurrence and development of diabetic myocardial injury by reducing mitochondrial apoptosis of cardiomyocytes.

[0042] It should be understood that any parts not described in detail in this specification belong to the prior art.

[0043] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A shRNA that downregulates or knocks down the expression of the FBXO44 gene, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ. ID. NO:

1.

2. A recombinant adenovirus vector, characterized in that, The recombinant adenovirus vector comprises the shRNA that downregulates or knocks down the expression of the FBXO44 gene as described in claim 1.

3. The use of the shRNA that downregulates or knocks down FBXO44 gene expression as described in claim 1 or the recombinant adenovirus vector as described in claim 2 in the preparation of a medicament for treating diabetic cardiomyopathy.

4. A pharmaceutical composition, characterized in that, The shRNA comprising the downregulation or knockdown of the FBXO44 gene expression as described in claim 1 or the recombinant adenovirus vector as described in claim 2.

5. The pharmaceutical composition according to claim 4, characterized in that, The pharmaceutical composition also contains pharmaceutically acceptable excipients.