Application of brown planthopper gene fragment Nlug001825.1 and dsRNA in prevention and treatment of brown planthopper

By using RNA interference technology, the brown planthopper gene fragment Nlug001825.1 and its dsRNA were prepared and injected, solving the problems of pesticide resistance and environmental pollution caused by chemical pesticides in the control of brown planthoppers, and achieving efficient and safe pest control.

CN122256358APending Publication Date: 2026-06-23ZHEJIANG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2026-05-08
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing chemical pesticides for controlling brown planthoppers have problems such as pesticide resistance, environmental pollution, and harm from non-target organisms, necessitating the development of efficient, safe, and environmentally friendly biological control technologies.

Method used

Using RNA interference technology, the brown planthopper gene fragment Nlug001825.1 and its dsRNA were used to target and degrade the insect's gene mRNA, thereby interfering with its physiological function. The dsRNA was then prepared and injected to kill the brown planthopper.

Benefits of technology

It effectively kills brown planthoppers, reduces negative impacts on the environment and non-target organisms, and has green and safe application value, providing a new approach to pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256358A_ABST
    Figure CN122256358A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological control, and particularly relates to a gene fragment Nlug001825.1 of a brown planthopper and application of dsRNA of the gene fragment in preventing and treating the brown planthopper. The application provides the gene fragment Nlug001825.1 capable of causing death of the brown planthopper after interference and dsRNA of the gene fragment. The results of examples show that the dsRNA can effectively kill the brown planthopper after injection. The method for preventing and treating the brown planthopper provided by the application is friendly to the environment ecology and food safety, has the application value of green safety, and establishes a new way for controlling pests by using the RNA interference technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological control technology, specifically relating to the application of the brown planthopper gene fragment Nlug001825.1 and its dsRNA in the control of brown planthoppers. Background Technology

[0002] The brown planthopper [Nilaparvata lugens] belongs to the order Hemiptera, suborder Cicadomorpha, superfamily Fulgoroidea, and family Delphacidae. It has a single diet, feeding and reproducing only on rice plants. It is a common rice planthopper and is currently the leading pest of rice in many Asian countries, including China, Japan, Thailand, Vietnam, and Indonesia.

[0003] As one of the staple foods for Chinese people, the extent of damage to rice is closely related to my country's food security. Brown planthopper outbreaks can cause severe losses to rice production. For a long time, chemical pesticides have been the primary means of controlling brown planthoppers. However, with the overuse of chemical pesticides, problems such as pesticide resistance, environmental pollution, and harm to non-target organisms have become increasingly prominent, seriously affecting the sustainability of the agricultural ecological environment. Therefore, finding more efficient, safe, and environmentally friendly pest control technologies has become a key focus of current agricultural research. To address this issue, developing targeted and sustainable biological control strategies has become an urgent task in combating brown planthoppers.

[0004] RNA interference (RNAi) technology, as an emerging molecular biology tool, has shown significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi targets and degrades the mRNA of pest genes through specific short double-stranded RNA (dsRNA), thereby inhibiting the expression of specific genes and interfering with the physiological functions of pests to achieve pest control. Compared with traditional chemical control methods, RNAi has high targeting specificity and can reduce negative impacts on the environment and non-target organisms.

[0005] Gene co-expression networks have become an indispensable tool in entomology, helping to systematically understand the biological characteristics and functions of insects, as well as their interaction mechanisms with the environment and other organisms in ecosystems. They also provide new perspectives and methods for exploring the important roles of insects in agriculture, medicine, and ecology.

[0006] In summary, exploring the target genes and dsRNAs for the control of brown planthoppers and developing green technologies for the control of brown planthoppers are technical problems that need to be solved by those skilled in the art. Summary of the Invention

[0007] The purpose of this invention is to provide the application of the brown planthopper gene fragment Nlug001825.1 and its dsRNA in the control of brown planthoppers. This invention provides the gene fragment Nlug001825.1 that can cause the death of brown planthoppers after interference and the dsRNA of the gene fragment.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] This invention provides the application of a gene that serves as an RNA interference target in the control of brown planthoppers. The gene includes the gene fragment Nlug001825.1, the sequence of which is shown in SEQ ID NO. 1.

[0010] Preferably, the preparation method of the gene fragment Nlug001825.1 includes: reverse transcribing the total RNA of brown planthopper into cDNA, using the cDNA as a template, and performing PCR amplification using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain the gene fragment Nlug001825.1.

[0011] The present invention also provides a dsRNA for controlling brown planthoppers, wherein the dsRNA can inhibit the expression of the brown planthopper gene fragment Nlug001825.1, the sequence of which is shown in SEQ ID NO. 1.

[0012] Preferably, the sequence of the dsRNA is shown in SEQ ID NO.4.

[0013] The present invention also provides a method for preparing the above-mentioned dsRNA, the method comprising: reverse transcribing total RNA of brown planthopper into cDNA, using the cDNA as a template, performing PCR amplification using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, and in vitro transcribing the PCR amplification product into the dsRNA.

[0014] Preferably, using the gene fragment Nlug001825.1 as a template, PCR amplification is performed using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, and the PCR amplification product is transcribed in vitro to synthesize the dsRNA.

[0015] The present invention also provides a product for controlling brown planthoppers, the product comprising the above-mentioned dsRNA.

[0016] This invention also provides the application of the above-mentioned dsRNA in the control of brown planthoppers.

[0017] The present invention also provides a method for killing brown planthoppers, the method comprising injecting the above-mentioned dsRNA into the brown planthoppers. Preferably, the injection is a microinjection.

[0018] Preferably, in the method for killing brown planthoppers, the concentration of dsRNA is 150–350 μg / ml.

[0019] Beneficial effects:

[0020] This invention screened out the gene fragment Nlug001825.1 (as shown in SEQ ID NO. 1), which can cause the death of brown planthoppers after interference. Injecting brown planthoppers with the dsRNA of this gene fragment (as shown in SEQ ID NO. 4) can effectively kill them. This invention is environmentally friendly and food-safe, possessing green and safe application value, and establishing a new approach for controlling pests using RNA interference technology. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Electrophoresis diagram of DNA fragments with T7 promoter added to Nlug001825.1.

[0023] Figure 2 Electrophoresis image of the dsRNA fragment of Nlug001825.1.

[0024] Figure 3 The cumulative mortality rate of brown planthoppers after microinjection of dsRNA varies over different days. Asterisks indicate statistically significant differences: ** (P<0.01); * (P<0.05). Detailed Implementation

[0025] This invention provides the application of the brown planthopper gene fragment Nlug001825.1 and its dsRNA in the control of brown planthoppers. Using Nlug001825.1 as an RNA interference target, injection of its dsRNA can effectively kill brown planthoppers.

[0026] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0027] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0028] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0029] The sequence information involved in the embodiments of the present invention includes:

[0030] SEQ ID NO.1:

[0031]

[0032] SEQ ID NO.2:

[0033] CATCAACTTGTCAGCCACCC

[0034] SEQ ID NO.3:

[0035] CTGGGTCTGTTTGTCCAAGC

[0036] SEQ ID NO.4:

[0037]

[0038] SEQ ID NO.5:

[0039] TAATACGACTCACTATAGGGCATCAACTTGTCAGCCACCC

[0040] SEQ ID NO.6:

[0041] TAATACGACTCACTATAGGGCTGGGTCTGTTTGTCCAAGC

[0042] Example 1, Cloning method of Nlug001825.1 gene fragment:

[0043] (1) Total RNA was extracted from brown planthoppers using the Trizol method;

[0044] (2) RNA reverse transcription was performed using the HiScript II Q Select RT SuperMix for qPCR kit manufactured by Vazyme;

[0045] (3) The cDNA obtained by reverse transcription was diluted 10 times with RNase-free H2O and then used for subsequent PCR reactions. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0046] (4) DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit manufactured by Vazyme;

[0047] (5) DNA clone fragments were obtained by ligation using the pMD™19-T Vector Cloning Kit produced by Takara and by ligation and transformation of competent E.coli DH5α Competent Cells.

[0048] Electrophoresis image of the DNA fragment with Nlug001825.1 and T7 promoter is shown below. Figure 1 As shown.

[0049] Example 2, Method for synthesizing dsRNA of Nlug001825.1 gene fragment:

[0050] On the website https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl, primers were designed by inputting the target gene sequence, with the product length controlled to around 500 bp. A T7 promoter sequence was added to the 5' end: 5'-TAATACGACTCACTATAGGG-3'. The primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6. This invention uses the Novizan T7 RNAi Transcription Kit. The electrophoresis image of the dsRNA fragment of Nlug001825.1 is shown below. Figure 2 As shown.

[0051] Example 3, Microinjection of dsRNA into brown planthopper:

[0052] (1) Preparation of the microinjection platform: Prepare a 2% agarose gel and melt it completely at high temperature. Then, pour the melted agarose gel into a sterile petri dish, ensuring that its thickness is uniform and sufficient to cover the toothpicks and capillaries placed therein, so as to form grooves adapted to the specific instar of brown planthopper. After the agarose has completely cooled and solidified, gently remove the toothpicks and capillaries, leaving grooves on the platform that match the shape of the insect, providing stable support for subsequent microinjection;

[0053] (2) Drawing capillary needles for injection: The P-97 Micropipette Puller was used for drawing. The material used was a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. The drawing program parameters were set according to the experimental requirements: heating temperature (Heat) was set to 650, tensile force (Pull) was set to 300, tensile speed (Vel) was set to 150, and heating time (Time) was set to 150 ms.

[0054] (3) Microinjection: Inject liquid dsRNA into a capillary needle and fix it on a microinjector. Cut the needle to an appropriate thickness and length according to the brown planthopper's instar. Use a joystick to operate the robotic arm of the injector and insert the capillary needle into the ventral side of the brown planthopper's thorax between the hind legs. Then inject dsRNA. During injection, you will see the brown planthopper's abdomen swell slightly. In addition to injecting the target gene dsRNA, dsGFP is also injected as a control group. Each group is repeated with 50 plants. The concentration of dsRNA injected is approximately 150-350 μg / ml.

[0055] (4) Phenotypic observation: Immediately after injection, the brown planthopper nymphs were transferred to glass test tubes containing fresh rice plants for rearing. The mortality rate within 8 days was recorded, and the results are shown in Table 1. Table 1 shows that the injection of Nlug001825.1 dsRNA had a significant lethal effect on brown planthoppers. The line graph showing the cumulative mortality rate of brown planthoppers after different days of microinjection of dsRNA is shown below. Figure 3 As shown.

[0056] Table 1

[0057]

[0058] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a gene acting as an RNA interference target in the control of brown planthoppers, characterized in that, The gene includes the gene fragment Nlug001825.1, the sequence of which is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The preparation method of the gene fragment Nlug001825.1 includes: reverse transcribing the total RNA of brown planthopper into cDNA, using the cDNA as a template, and performing PCR amplification using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain the gene fragment Nlug001825.

1.

3. A dsRNA for controlling brown planthoppers, characterized in that, The dsRNA can inhibit the expression of the brown planthopper gene fragment Nlug001825.1, the sequence of which is shown in SEQ ID NO.

1.

4. A dsRNA for controlling brown planthoppers, characterized in that, The sequence of the dsRNA is shown in SEQ ID NO.

4.

5. The method for preparing dsRNA according to claim 4, characterized in that, The method includes: reverse transcribing total RNA from brown planthoppers into cDNA; using the cDNA as a template, performing PCR amplification with the primer pairs shown in SEQ ID No. 5 and SEQ ID No. 6; and in vitro transcribing the PCR amplification product into the dsRNA.

6. The preparation method according to claim 5, characterized in that, The method includes: using the gene fragment Nlug001825.1 as a template, performing PCR amplification using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, and transcribing the PCR amplification product in vitro to synthesize the dsRNA.

7. A product for controlling brown planthoppers, characterized in that, The product includes the dsRNA as described in claim 3 or 4.

8. The application of the dsRNA according to claim 3 or 4 in the control of brown planthoppers.

9. A method for killing brown planthoppers, characterized in that, The method includes injecting the dsRNA of claim 3 or 4 into brown planthoppers.

10. The method for killing brown planthoppers according to claim 9, characterized in that, The concentration of the dsRNA was 150–350 μg / ml.