Method for creating in-del marker closely linked to rice restorer gene osrf19 and application thereof

By creating an artificial haplotype closely linked to the rice fertility restoration gene OsRf19 using the CRISPR/Cas12a gene editing system and developing the InDel molecular marker, the problem of identifying the OsRf19 gene in existing technologies was solved, enabling a rapid breeding process and improving breeding efficiency.

CN122279075APending Publication Date: 2026-06-26FUJIAN AGRI & FORESTRY UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610453789.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-06-26

Smart Images

  • Figure CN122279075A_ABST
    Figure CN122279075A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant molecular breeding, and specifically discloses a gene related to rice fertility restoration. OsRf19 This invention addresses the cumbersome process of identifying restorer lines for the existing Fujian abortive cytoplasmic male sterility (CMS-FA / OsRf19) system by developing a method for creating tightly linked artificial haplotypes, the development of InDel molecular markers, and their application in rice fertility. Through bioinformatics analysis, this invention identifies a fertility restoration gene associated with the rice sporophytic sterility system CMS-FA. OsRf19 A specific region closely linked to the PPR gene cluster and with extremely low similarity to the loci was edited using CRISPR / Cas12a gene editing technology, resulting in multiple large deletions. Based on these genotype sequence variations, a set of InDel molecular markers was developed to realize the editing of this artificially created restoration gene. OsRf19 Rapid identification of closely linked artificial haplotypes accelerates the breeding process of molecular marker-assisted selection in the rice CMS-FA system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for creating InDel markers closely linked to the rice restorer gene OsRf19 and their application, belonging to the field of molecular genetic breeding technology. Background Technology

[0002] As one of the world's most important food crops, increasing rice yield has been a key issue that scientists have been working to address. The emergence of hybrid rice has greatly improved rice productivity worldwide and made significant contributions to solving global food security. Among them, the three-line hybrid rice method, consisting of sterile lines, maintainer lines, and restorer lines, enables large-scale seed production and the utilization of heterosis. Its core genetic material consists of rice cytoplasmic male sterility (CMS) and restorer of fertility (Rf) germplasm.

[0003] Cytoplasmic male sterility (CMS) is a genetic phenomenon controlled by the interaction between the mitochondrial and nuclear genomes, characterized by the plant's inability to produce normal functional pollen, while the female reproductive organs function normally. CMS is typically caused by the mitochondrial genome producing a sterility gene transcript, which can be degraded by a mitochondrial-localized PPR protein encoded by a fertility restoration gene (Rf) in the nuclear genome, thus restoring fertility. Therefore, the CMS / Rf system is widely used in the large-scale production of hybrid seeds. Since the 1970s, three-line hybrid rice, based on male-sterile lines, maintainer lines, and restorer lines, has overcome the technical bottleneck of utilizing heterosis in self-pollinating crops, making a significant contribution to global food production.

[0004] Currently, there are three main types of genetic systems that utilize CMS / Rf fertility control: wild-abort type CMS-WA / Rf3-Rf4, red lotus type CMS-HL / Rf5-Rf6, and platform type CMS-BT / Rf1a-Rf1b. Although these three types of CMS / Rf systems are widely used in rice, existing rice cytoplasmic male sterility types often suffer from problems such as unstable fertility, incomplete fertility restoration, and the impact of restoration genes in two-site patterns on breeding efficiency.

[0005] A recently reported stable sporophytic male-sterile rice strain exhibiting Fujian abortive cytoplasmic male sterility (CMS-FA) and a nuclear restoration gene that fully restores hybrid fertility. OsRf19The identification of CMS-FA / OsRf19 provides a highly promising system for hybrid breeding. CMS-FA / OsRf19 is a hybrid rice breeding system discovered and established by Professor Wang Naiyuan of Fujian Agriculture and Forestry University. Its male sterility originates from wild rice in Fujian, is sporophytic sterility, with complete abortion, single-gene restoration, and strong restoration ability. Compared to the gametophytic male sterility of the Honglian type CMS-HL / Rf5-Rf6 and the Baotai type CMS-BT / Rf1a-Rf1b (fertility determined by pollen genotype), CMS-FA's male sterility is sporophytic (fertility determined by parental genotype), making it a more preferred breeding system. Furthermore, CMS-FA exhibits significant genetic differences from CMS-WA in terms of CMS and fertility restoration genes.

[0006] In 2022, research institutions including Huazhong Agricultural University cloned the sterility gene FA182 and the male fertility restorer gene for CMS-FA type cytoplasmic male sterility in rice. OsRf19 (Jiang et al., Fujian cytoplasmic male sterility and thefertility restorer gene OsRf19 Provide a promising breeding system for hybrid rice [J]. Proceedings of the National Academy of Sciences, 2022, 119(34):e2208759119.), and preliminarily analyzed OsRf19 The mechanism of fertility restoration was investigated, and the significant breeding application value of the rice CMS-FA / OsRf19 system was demonstrated through breeding applications.

[0007] Due to the recovery gene of the CMS-FA / OsRf19 system OsRf19 The gene cluster, located on chromosome 10 of rice, encodes a pentatricopeptide repeat (PPR). This cluster contains multiple predicted PPR genes, and the restorer genes for the wild-type CMS-WA / Rf4 and the packaged CMS-BT / Rf1a-Rf1b systems also fall at this locus. In the 37185 bp (base pairs) nucleotide sequence of the restorer line Jinhui3 (NCBI accession number: ON855493), this PPR gene cluster contains... OsRf19 The five PPR genes, including the male-sterile line, share a high degree of nucleotide sequence similarity with each other. Furthermore, the sequence similarity of this PPR gene cluster is extremely high across all rice varieties, making it difficult to distinguish between sterile lines and restorer lines, or whether different rice varieties carry it. OsRf19.

[0008] For the reasons mentioned above, it is difficult to find matching sequences through sequence alignment. OsRf19 InDel molecular markers that are tightly linked to genes are not conducive to gene restoration. OsRf19 Transformation of breeding materials and three-line matching. In the traditional CMS-FA / OsRf19 three-line matching system, the presence of the restorer gene in the tested material can only be determined by whether the pollen fertility of the hybrid offspring with the CMS-FA sterile line is restored. OsRf19 This method is time-consuming, labor-intensive, and extremely inefficient.

[0009] In recent years, molecular marker-assisted selection breeding has been widely promoted and applied. Using molecular markers to identify functional genes in rice to determine rice phenotypes is more efficient and direct. Currently, there are no reports on its use for... OsRf19 The InDel molecular marker, used in assisted selection breeding, severely limits the breeding application of the CMS-FA / OsRf19 system. Summary of the Invention

[0010] The purpose of this invention is to overcome the limitation that, in the breeding process of CMS-FA / OsRf19, the test material can only be detected for the fertility of pollen from the offspring of hybridization with a sterile line to determine whether it carries the restorer gene. OsRf19 Addressing the shortcomings of identification technology and resolving its severe limitations. OsRf19 Issues related to parental material selection and the application of the three-line system. This invention analyzes the restorer genes in Fujian-type male-sterile rice plants. OsRf19 The gene locus was found to be related to... OsRf19 A specific region with tightly linked genes and extremely low similarity to the locus of this PPR gene cluster; by editing the gene in this specific region, insertion or deletion variations are generated to obtain or restore the gene. OsRf19 Tightly linked artificial haplotypes; based on variations in these genotype sequences, a set of InDel molecular markers was developed to realize the restoration of this artificially created gene. OsRf19 Rapid identification of closely linked artificial haplotypes accelerates the breeding process of the rice CMS-FA / OsRf19 system.

[0011] The technical solution adopted in this invention: [The invention relates to] rice fertility restoration genes. OsRf19 A closely linked specific region located on rice chromosome 10. OsRf19 The nucleotide sequence is shown in SEQ ID No. 1, located 9.8 kb upstream of the coding region.

[0012] With rice fertility restoration gene OsRf19 A method for creating closely linked artificial haplotypes includes the following steps: (1) Select the region described in claim 1 as the editing target region; (2) Design three editing target points targeting the region, with the target point sequences as follows: OsRf19-Target1: GGCTCTCTCTTAGATGGAGGAGT; OsRf19-Target2:CATGCTAACTTGATCGAGATATC; OsRf19-Target3:GCGCTGAAGTATACGATTTTGCG; (3) Using the CRISPR / Cas12a gene editing system, targeted editing was performed on the three editing target sites to induce nucleotide insertion or deletion variations in the regions, thereby obtaining the desired results. OsRf19 Closely linked artificial haplotypes.

[0013] The application of the CRISPR / Cas12a gene editing system in step (3) includes: constructing three sgRNA expression cassettes corresponding to the three editing target sites respectively; digesting and ligating the sgRNA expression cassettes with the pZmUbip-Cas12 vector to obtain recombinant vectors; transforming the recombinant vectors into Agrobacterium, and then infecting Agrobacterium-carrying cells with the vectors. OsRf19 The restorer line rice was used to obtain gene-edited lines, and after self-pollination, homozygous artificial haplotype lines were obtained.

[0014] The construction of the sgRNA expression cassette involves two rounds of PCR reactions. In the first round, pUC57-U6a-crRNA12a, pUC57-U6b-crRNA12a, and pUC57-U6c-crRNA12a were used as templates for their respective target sites, and specific primers were used to amplify fragments a and b. In the second round, a mixture of fragments a and b was used as a template, and primers containing BsaI restriction sites were used to amplify the complete sgRNA expression cassette. The primer sequences are as follows: Unit-out-F:GGCTCCACCATGGGAACCAATT; Unit-out-R:CCCGTTGAATATGGCTCATAAC; OsRf19T1-crF: GGCTCCTCTTAGATGGAGGAGGTGGCCGGCATGGTCCCAGCCT; OsRf19T1-crR:ACTCCTCCATCTAAGAGAGAGCCATCTACACTTAGTAGAAATT; OsRf19T2-crF:CGGTAGTTTAATAGAGGGATCCAGGCCGGCATGGTCCCAGCCT; OsRf19T2-crR: TGGATCCCTCTATTAAACTACCGATCTACACTTAGTAGAAATT; OsRf19T3-crF:TCTTCCACGCGCGCAGAACAGATGGCCGGCATGGTCCCAGCCT; OsRf19T3-crR: ATCTGTTCTGCGCGCGTGGAAGAATCTACACTTAGTAGAAATT; Unit1-BsaI-F:TAGAATGggtctcGatgaGATCCAAGAACGAACTAAGCC; Unit1-BsaI-R:CGAGCATggtctcCacttCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit2-BsaI-F:TAGAATGggtctcGaagtGATCCAAGAACGAACTAAGCC; Unit2-BsaI-R:CGAGCATggtctcCgaatCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit3-BsaI-F:TAGAATGggtctcGattcGATCCAAGAACGAACTAAGCC; Unit3-BsaI-R:CGAGCATggtctcCtggaCGAGTAAAAAAAGTCCCATTCGCCATGC.

[0015] The enzyme digestion-ligation reaction system includes: 10×rCutSmart Buffer 10μL, pZmUbip-Cas12 plasmid 100ng, 3 sgRNA expression cassettes 10ng each, BsaI 1μL, T4 DNA ligase 1μL, and ddH2O to a final volume of 20μL; the reaction conditions are: 37℃ for 30min, followed by 20 cycles (37℃ for 3min, 10℃ for 5min, 20℃ for 5min), and finally 37℃ for 5min.

[0016] The InDel molecular markers used to identify the aforementioned artificial haplotypes are characterized in that the InDel molecular markers correspond to the upstream and downstream regions of the three editing target sites in claim 2, and the primer sequences are as follows: The primers targeting OsRf19-T1 are: OsRf19T1-F: GAGCATCACTAATATGTTAGC; OsRf19T1-R:CGGTAGTTTAATAGAGGGATC; The primers targeting OsRf19-T2 are: OsRf19T2-F: GGTGGATCCCTCTATTAAACTAC; OsRf19T2-R:CGGAAGGAGTCGTATAAGGTATC; The primers targeting OsRf19-T3 are: OsRf19T3-F:ACCTAGACGCGCTTGCAAACTG; OsRf19T3-R: CCGTGCTATTTGGCGCTGAAGT.

[0017] The method for identifying artificial haplotypes in rice using the aforementioned InDel molecular markers includes the following steps: (1) Using the rice genomic DNA to be identified as a template, PCR amplification was performed using any one or more of the above primer pairs. The PCR amplification system was: 10 μL of 2×Rapid Taq Master Mix, 1 μL of primer F, 1 μL of primer R, 1 μL of rice DNA template, and ddH2O to make up to 20 μL. The PCR amplification program was: 94℃ for 4 min, 32 cycles (95℃ for 30 s, 58℃ for 15 s, 72℃ for 20 s), and a final extension at 72℃ for 5 min. (2) Perform polyacrylamide gel electrophoresis on the PCR product to determine the length of the PCR product; if the length of the PCR product is consistent with the length of the edited specific region of the artificial haplotype in claim 2, then the rice is a carrier. OsRf19 Rice with tightly linked artificial haplotypes; if the length matches that of an unedited specific region, the rice does not carry the artificial haplotype.

[0018] The aforementioned special regions in creation and OsRf19 Applications in tightly linked artificial haplotypes.

[0019] The above InDel molecular markers in rice OsRf19 Application in restorer line-assisted breeding.

[0020] The application of the artificial haplotypes created by the above method in the three-line breeding of rice CMS-FA / OsRf19 system.

[0021] The beneficial effects of this invention are as follows: 1. This invention provides a rice fertility restoration gene. OsRf19 A specific region that is tightly linked on both sides and has very low similarity to the locus of this PPR gene cluster; 2. This invention provides a method for creating and restoring genes using the CRISPR / Cas12a gene editing system. OsRf19 The method for tightly linked artificial haplotypes involves designing three editing sites, each targeting the aforementioned specific region, and then using the CRISPR / Cas12a gene editing system to perform targeted editing, generating a series of insertion or deletion variations to obtain and restore the gene. OsRf19 Closely linked artificial haplotypes provide a foundation for the subsequent development of InDel molecular markers; 3. This invention provides a set of genes that can be used to identify restoration genes. OsRf19 Closely linked artificial haplotypes of InDel molecular markers were used to identify whether rice was a hybrid of artificial haplotypes and artificial haplotypes. OsRf19 The method of linked artificial haplotypes was used to achieve the restoration of this artificially created gene. OsRf19 Rapid identification of closely linked artificial haplotypes accelerates the breeding process of the rice CMS-FA / OsRf19 system. Attached Figure Description

[0022] Figure 1 and OsRf19 A schematic diagram of tightly linked specific regions, targets, and InDel primers; Figure 2 Identification using InDel molecular markers OsRf19 Gel electrophoresis image of artificial haplotypes; Figure 3 Anther morphology and pollen phenotype of the CMS-FA / OsRf19 sterile line and its edited restorer line.

[0023] Figure 3 illustrate A. Florets of the sterile line (left) and restorer line L58 ​​(right) with glumes removed; B. Anthers of the sterile line stained with I2-KI; C. Pollen of the restorer line L58 ​​stained with I2-KI; D. Florets of the edited restorer line L58e-3 with glumes removed; E. Pollen of the edited restorer line L58e-3 stained with I2-KI; F. Pollen of the F1-1 cross between the sterile line and the edited restorer line L58e stained with I2-KI; E. Pollen of the F1-2 cross between the sterile line and the edited restorer line L58e stained with I2-KI; D. Pollen of the F1-3 cross between the sterile line and the edited restorer line L58e stained with I2-KI. Scale bar: 1 mm (A, D); 100 μm (B, C, EH). Detailed Implementation

[0024] The following is combined with Figure 1-3 The present invention will be further described, but the scope of protection of the present invention is not limited to the contents described herein.

[0025] With rice fertility restoration gene OsRf19 A closely linked specific region located on rice chromosome 10. OsRf19 The nucleotide sequence is shown in SEQ ID No. 1, located 9.8 kb upstream of the coding region.

[0026] With rice fertility restoration gene OsRf19 A method for creating closely linked artificial haplotypes includes the following steps: (1) Select the region described in claim 1 as the editing target region; (2) Design three editing target points targeting the region, with the target point sequences as follows: OsRf19-Target1: GGCTCTCTCTTAGATGGAGGAGT; OsRf19-Target2:CATGCTAACTTGATCGAGATATC; OsRf19-Target3:GCGCTGAAGTATACGATTTTGCG; (3) Using the CRISPR / Cas12a gene editing system, targeted editing was performed on the three editing target sites to induce nucleotide insertion or deletion variations in the regions, thereby obtaining the desired results. OsRf19 Closely linked artificial haplotypes.

[0027] The application of the CRISPR / Cas12a gene editing system in step (3) includes: constructing three sgRNA expression cassettes corresponding to the three editing target sites respectively; digesting and ligating the sgRNA expression cassettes with the pZmUbip-Cas12 vector to obtain recombinant vectors; transforming the recombinant vectors into Agrobacterium, and then infecting Agrobacterium-carrying cells with the vectors. OsRf19 The restorer line rice was used to obtain gene-edited lines, and after self-pollination, homozygous artificial haplotype lines were obtained.

[0028] The construction of the sgRNA expression cassette involves two rounds of PCR reactions. In the first round, pUC57-U6a-crRNA12a, pUC57-U6b-crRNA12a, and pUC57-U6c-crRNA12a were used as templates for their respective target sites, and specific primers were used to amplify fragments a and b. In the second round, a mixture of fragments a and b was used as a template, and primers containing BsaI restriction sites were used to amplify the complete sgRNA expression cassette. The primer sequences are as follows: Unit-out-F:GGCTCCACCATGGGAACCAATT; Unit-out-R:CCCGTTGAATATGGCTCATAAC; OsRf19T1-crF:GGCTCTCTCTTAGATGGAGGAGTGGCCGGCATGGTCCCAGCCT; OsRf19T1-crR:ACTCCTCCATCTAAGAGAGAGCCATCTACACTTAGTAGAAATT; OsRf19T2-crF:CGGTAGTTTAATAGAGGGATCCAGGCCGGCATGGTCCCAGCCT; OsRf19T2-crR:TGGATCCCTCTATTAAACTACCGATCTACACTTAGTAGAAATT; OsRf19T3-crF:TCTTCCACGCGCGCAGAACAGATGGCCGGCATGGTCCCAGCCT; OsRf19T3-crR:ATCTGTTCTGCGCGCGTGGAAGAATCTACACTTAGTAGAAATT; Unit1-BsaI-F:TAGAATGggtctcGatgaGATCCAAGAACGAACTAAGCC; Unit1-BsaI-R:CGAGCATggtctcCacttCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit2-BsaI-F:TAGAATGggtctcGaagtGATCCAAGAACGAACTAAGCC; Unit2-BsaI-R:CGAGCATggtctcCgaatCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit3-BsaI-F:TAGAATGggtctcGattcGATCCAAGAACGAACTAAGCC; Unit3-BsaI-R:CGAGCATggtctcCtggaCGAGTAAAAAAAGTCCCATTCGCCATGC。

[0029] The enzyme digestion-ligation reaction system includes: 10×rCutSmart Buffer 10μL, pZmUbip-Cas12 plasmid 100ng, 3 sgRNA expression cassettes 10ng each, BsaI 1μL, T4 DNA ligase 1μL, and ddH2O to a final volume of 20μL; the reaction conditions are: 37℃ for 30min, followed by 20 cycles (37℃ for 3min, 10℃ for 5min, 20℃ for 5min), and finally 37℃ for 5min.

[0030] The InDel molecular markers used to identify the aforementioned artificial haplotypes are characterized in that the InDel molecular markers correspond to the upstream and downstream regions of the three editing target sites in claim 2, and the primer sequences are as follows: The primers targeting OsRf19-T1 are: OsRf19T1-F: GAGCATCACTAATATGTTAGC; OsRf19T1-R:CGGTAGTTTAATAGAGGGATC; The primers targeting OsRf19-T2 are: OsRf19T2-F: GGTGGATCCCTCTATTAAACTAC; OsRf19T2-R:CGGAAGGAGTCGTATAAGGTATC; The primers targeting OsRf19-T3 are: OsRf19T3-F:ACCTAGACGCGCTTGCAAACTG; OsRf19T3-R: CCGTGCTATTTGGCGCTGAAGT.

[0031] The method for identifying artificial haplotypes in rice using the aforementioned InDel molecular markers includes the following steps: (1) Using the rice genomic DNA to be identified as a template, PCR amplification was performed using any one or more pairs of primers as described in claim 6. The PCR amplification system was: 10 μL of 2×Rapid Taq Master Mix, 1 μL of primer F, 1 μL of primer R, 1 μL of rice DNA template, and ddH2O was added to make up to 20 μL. The PCR amplification program was: 94℃ for 4 min, 32 cycles (95℃ for 30 s, 58℃ for 15 s, 72℃ for 20 s), and a final extension at 72℃ for 5 min. (2) Perform polyacrylamide gel electrophoresis on the PCR product to determine the length of the PCR product; if the length of the PCR product is consistent with the length of the edited specific region of the artificial haplotype in claim 2, then the rice is a carrier. OsRf19Rice with tightly linked artificial haplotypes; if the length matches that of an unedited specific region, the rice does not carry the artificial haplotype.

[0032] The aforementioned special regions in creation and OsRf19 Applications in tightly linked artificial haplotypes.

[0033] The above InDel molecular markers in rice OsRf19 Application in restorer line-assisted breeding.

[0034] The application of the artificial haplotypes created by the above method in the three-line breeding of rice CMS-FA / OsRf19 system.

[0035] The technical solution adopted in this invention is as follows: 1. Rice fertility restoration gene OsRf19 Closely linked special areas This invention provides a rice fertility restoration gene. OsRf19 A specific region closely linked on both sides and with very low similarity to the PPR gene cluster locus, located on rice chromosome 10. OsRf19 At a position 9.8 kb on the flank, its nucleotide sequence is shown in SEQ ID No. 1.

[0036] 2. Creation of artificial haplotypes This invention provides a method for creating and restoring genes using the CRISPR / Cas12a gene editing system. OsRf19 The method for tightly linked artificial haplotypes involves designing three editing sites (as shown in Table 3), targeting the aforementioned specific region (SEQ ID No. 1), and performing targeted editing using the CRISPR / Cas12a gene editing system to generate a series of insertion or deletion variants (as shown in Table 6), thereby obtaining and restoring the gene. OsRf19 The tightly linked artificial haplotypes provide a foundation for the subsequent development of InDel molecular markers.

[0037] 3. InDel molecular markers and identification methods This invention provides a set of genes that can be used to identify restoration genes. OsRf19 The PCR primer sequences for tightly linked artificial haplotypes of InDel molecular markers are shown in Table 7. This set of InDel molecular markers was used to identify whether rice was... OsRf19 The method for ligated artificial haplotypes includes the following steps: (1) Using the rice genomic DNA to be identified as a template, PCR amplification was performed using the primer pair of the InDel molecular marker mentioned above to obtain PCR products; preferably, the PCR amplification system shown in Table 1 and the PCR amplification program shown in Table 2 were performed.

[0038] (2) By determining the length of the PCR product through polyacrylamide gel electrophoresis, it can be determined whether the rice is a type of rice. OsRf19 Linked artificial haplotypes; among them, those containing various nucleotide deletion types in Table 6 are restorer genes. OsRf19 Linked artificial haplotypes; others with sequence lengths identical to the sterile line do not carry the restorer gene. OsRf19 Or a recovery gene that is not artificially created. OsRf19 Chained haplotypes.

[0039] Example 1 and OsRf19 Obtaining and targeting tightly linked specific region DNA sequences According to the nucleotide sequence of the restorer line Jinhui3 with accession number ON855493 in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the sequence is 37185 bp in length and was analyzed to be a PPR gene cluster, containing... OsRf19 Five PPR genes, including [list of genes], show high nucleotide sequence similarity among themselves; moreover, this PPR gene cluster exhibits extremely high similarity on chromosome 10 in all rice varieties, making it difficult to distinguish whether different rice varieties carry it. OsRf19 .

[0040] Sequence alignment was performed on the promoter, coding region, and termination region of each PPR gene at this locus to obtain a distance. OsRf19 There is a specific 710bp region 9.8kb upstream of the coding region, and its nucleotide sequence is as follows: Figure 1 As shown in SEQ ID No. 1.

[0041] The specific region sequence was analyzed using an online website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to identify sequences that could be targeted by the CRISPR / Cas12a gene editing system. Three target sequences were ultimately selected, and the details are shown in Table 3.

[0042] SEQ ID No.1.

[0043] .

[0044] Table 1 PCR amplification system

[0045] Table 2 PCR amplification program

[0046] Table 3 Target information for CRISPR / Cas12a system targeting editing SEQ ID No. 1

[0047] Example 2 Cultivation and OsRf19 Methods for gene-editing rice in tightly linked, specific regions This embodiment utilizes the CRISPR / Cas12a gene editing system to target and edit the aforementioned specific region, thereby cultivating gene-edited rice carrying artificial haplotypes. The specific steps are as follows: (1) Preparation of strain activation and plasmid extraction The bacterial strains carrying the pZmUbip-Cas12 vector were streaked overnight on agar plates containing kanamycin (50 μg / ml); the bacterial strains carrying the pUC57-U6a-crRNA12a, pUC57-U6b-crRNA12a, and pUC57-U6c-crRNA12a vectors were streaked overnight on agar plates containing ampicillin (100 μg / ml), and single colonies were picked for liquid culture to extract the corresponding plasmids.

[0048] (2) Construction of sgRNA1 expression cassette First round of PCR reaction: Using 2-5 ng of pUC57-U6a-crRNA12a plasmid as template, two PCR reactions were performed: one PCR reaction used primers Unit-out-F and OsRf19T1-crR, with a primer concentration of 0.2 μM in the reaction system, and the product was a1; the other PCR reaction used primers OsRf19T1-crF and Unit-out-R, with a primer concentration of 0.1 mM in the reaction system, and the product was b1; the two PCR reaction programs were as follows: 28 cycles, each cycle including 98℃ for 10 s, 55℃ for 15 s, and 72℃ for 20 s; the primer sequences are shown in Table 4.

[0049] Second round PCR reaction: Take 1 μL of the products a1 and b1 obtained from the first round PCR reaction, dilute them 10 times with ddH2O, and then take 1 μL of each to mix as templates. Use Unit1-BsaI-F and Unit1-BsaI-R as primers for PCR amplification. The PCR reaction program is as follows: 30 cycles, each cycle including 98℃ for 10s, 55℃ for 10s, and 72℃ for 10s. The primer sequences are shown in Table 4.

[0050] (3) Construction of sgRNA2 expression cassette First round of PCR reaction: Using 2-5 ng of pUC57-U6b-crRNA12a plasmid as a template, two PCR reactions were performed: one PCR reaction used primers Unit-out-F and OsRf19T2-crR, with a primer concentration of 0.2 μM in the reaction system, and the product was a2; the other PCR reaction used primers OsRf19T2-crF and Unit-out-R, with a primer concentration of 0.1 mM in the reaction system, and the product was b2; the procedures for the two PCR reactions were consistent with the first round of PCR reaction procedure for the sgRNA1 expression cassette; the primer sequences are shown in Table 4.

[0051] Second round of PCR reaction: Take 1 μL of products a2 and b2 obtained from the first round of PCR reaction, dilute them 10 times with ddH2O, and then take 1 μL of each and mix them as templates. Use Unit2-BsaI-F and Unit2-BsaI-R as primers for PCR amplification. The PCR reaction program is the same as the second round of PCR reaction program of sgRNA1 expression cassette. The primer sequences are shown in Table 4.

[0052] (4) Construction of sgRNA3 expression cassette First round of PCR reaction: Using 2-5 ng of pUC57-U6c-crRNA12a plasmid as a template, two PCR reactions were performed: one PCR reaction used primers Unit-out-F and OsRf19T3-crR, with a primer concentration of 0.2 μM in the reaction system, and the product was a3; the other PCR reaction used primers OsRf19T3-crF and Unit-out-R, with a primer concentration of 0.1 mM in the reaction system, and the product was b3; the procedures for the two PCR reactions were consistent with the first round of PCR reaction procedure for the sgRNA1 expression cassette; the primer sequences are shown in Table 4.

[0053] Second round of PCR reaction: Take 1 μL of products a3 and b3 obtained from the first round of PCR reaction, dilute them 10 times with ddH2O, and then take 1 μL of each and mix them as templates. Use Unit3-BsaI-F and Unit3-BsaI-R as primers for PCR amplification. The PCR reaction program is the same as the second round of PCR reaction program of sgRNA1 expression cassette. The primer sequences are shown in Table 4.

[0054] Table 4 Construction OsRf19 Primers for the three sgRNA expression cassettes

[0055] (5) Carrier connection The pZmUbip-Cas12 vector was subjected to enzyme digestion-ligation reaction with sgRNA1 expression cassette, sgRNA2 expression cassette and sgRNA3 expression cassette to obtain ligation products. The ligation reaction system is shown in Table 5. The enzyme digestion-ligation reaction conditions were: 37℃ for 30 min; followed by 20 cycles, each cycle including 37℃ for 3 min, 10℃ for 5 min, 20℃ for 5 min; and finally 37℃ for 5 min.

[0056] Table 5 Enzyme digestion-ligation reaction system

[0057] (6) Transformation of ligation products into competent E. coli cells Add 5 μL of the ligation product to E. coli DH5α competent cells, incubate on ice for 30 min, heat shock at 42℃ for 60 s, and then incubate on ice for 2 min; then add 1 ml of SOB medium, incubate at 37℃ for 60 min, and then plate (the plate medium is LB + 50 μg / ml Kan); select positive single clones, extract plasmids, and confirm correct ligation by Sanger sequencing.

[0058] (7) Agrobacterium transformation After expanding the culture of the positive single clones obtained in step (6), extract the plasmid and transform it into Agrobacterium competent cells (EHA105). The specific steps are as follows: ice bath for 5 min, liquid nitrogen quick freeze for 5 min, heat shock at 37℃ for 5 min; add 1 ml SOB medium, incubate at 28℃ for 1-2 h and then plate (the plate medium is LB + 25 μg / ml Kan + 25 μg / ml Rif); select positive single clones for preservation.

[0059] (8) Obtaining rice from Agrobacterium infection and gene-edited lines The positive Agrobacterium (EHA105) obtained in step (7) was used to infect the infected animal. OsRf19 The specific steps for developing the restorer line rice L58 ​​are as follows: 1) Induction: Select rice grains without mold spots and with normal sprouts, disinfect with 75% alcohol for 1 min, and rinse 3 times with sterile water (1 min / time); then disinfect with 15% sodium hypochlorite for 20 min, and rinse 3 times with sterile water (1 min / time); inoculate the disinfected rice grains into the induction medium and culture at 26℃ under light for 20 days.

[0060] 2) Agrobacterium infection: Pick Agrobacterium and place it in the infection solution to prepare Agrobacterium resuspension with OD600=0.2; pick callus in Erlenmeyer flask, add Agrobacterium resuspension, and discard the bacterial solution after 10-15 min of infection; inoculate the callus on co-culture medium and co-culture at 20℃ for 48-72 h.

[0061] 3) Callus screening: Inoculate the callus from step 2) onto the screening medium and incubate in the dark at 26°C for 20-30 days; inoculate the positive monoclonal callus onto the secondary screening medium and incubate in the dark at 26°C for 7-10 days.

[0062] 4) Differentiation and rooting: Inoculate positive callus onto differentiation medium and culture at 25-27℃ under light for 15-20 days. After 2-5cm shoots have differentiated, inoculate onto rooting medium and culture at 30℃ under light for 7-10 days.

[0063] 5) Obtaining gene-edited lines: Genomic DNA of transgenic rice was extracted using the CTAB method, and the target sites were amplified by PCR. The obtained gene-edited line T0 was self-crossed to obtain homozygous gene-edited lines of the T1 generation that did not carry the transgene, numbered L58e-1, L58e-2, and L58e-3, and their genotypes are shown in Table 6.

[0064] Table 6. Genotyping of L58 gene-edited restorer lines

[0065] Example 3 Identification using a set of InDel molecular markers OsRf19 Artificial haplotypes This embodiment utilizes the created and restored genes. OsRf19 Primers designed using tightly linked InDel molecular markers were used to rapidly identify whether rice was a [specific species / type of plant]. OsRf19 The specific steps for chain-linked artificial haplotypes are as follows: In relation to the recovery gene OsRf19 Three pairs of InDel molecular marker primers were designed upstream and downstream of three target sequences in tightly linked specific regions (the positions of the molecular marker primers are as follows). Figure 1 As shown in Table 7, primer sequences were used. Using rice genomic DNA as a template, PCR amplification was performed according to the PCR amplification system shown in Table 1 and the PCR amplification procedure shown in Table 2. The length of the PCR product was determined by polyacrylamide gel electrophoresis to identify whether the rice was a suitable candidate for PCR. OsRf19 Linked artificial haplotypes.

[0066] Table 7 is used for identification. OsRf19 Linked artificial haplotype InDel molecular marker primers

[0067] The results are as follows Figure 2As shown, taking the edited line L58e-3 as an example, the three primer pairs in Table 7 were used to detect six individual plants from the sterile line, the edited line L58e-3, and the F1 generation of the cross between the sterile line and the edited line L58e-3. Corresponding bands were amplified in all cases. The band corresponding to the size of the sterile line indicates the absence of the restorer gene. OsRf19 Or a recovery gene that is not artificially created. OsRf19 Linked haplotypes; the bands corresponding to the edited line L58e-3 are the deletion types shown in Table 6 for L58e-3; all six F1 plants from the cross between the sterile line and the edited line L58e-3 are heterozygous bands, indicating that all plants carry the same type of haplotype. OsRf19 Linked artificial haplotypes.

[0068] Example 4: Artificially Created Restoration Gene OsRf19 Linked haplotypes: anther morphology and pollen phenotype This embodiment studies artificially created restoration genes. OsRf19 The anther morphology and pollen phenotype of linked haplotypes were analyzed to verify the effect of gene editing on rice fertility. The specific steps are as follows: During the peak flowering period of rice, the anthers of the CMS-FA sterile line, restorer line L58, and edited restorer line L58e-3 were peeled open for pollen staining observation; at the same time, the pollen of F1 generation single plants of the hybridization of the sterile line and L58e-3 was observed.

[0069] The results are as follows Figure 3 As shown, the anthers of the edited restorer line L58e-3 were no different from those of the original restorer line L58; moreover, the three F1 generation single plants (compared to) the edited restorer line L58e-3, the sterile line, and L58e-3 were all different. Figure 2 The pollen from the corresponding line (L58) showed no difference after I2-KI staining compared to the pollen from the original restorer line L58.

[0070] The above results indicate that, in the restorer system, artificial intervention... OsRf19 Gene editing in tightly linked regions does not affect anther and pollen fertility. The InDel molecular marker developed in this invention can be applied to the CMS-FA / OsRf19 rice three-line breeding for rapid identification and fertility restoration genes. OsRf19 Closely linked artificial haplotypes.

[0071] Although the technical solutions of the present invention have been described and enumerated in detail, it should be understood that modifications to the above embodiments or the adoption of equivalent alternatives are obvious to those skilled in the art. Such modifications or improvements made without departing from the spirit of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. A gene related to rice fertility restoration OsRf19 Closely linked areas are characterized by, The region is located on chromosome 10 of rice OsRf19 The nucleotide sequence at 9.8 kb upstream of the coding region is shown in SEQ ID No.

1.

2. A gene associated with rice fertility restoration OsRf19 A method for creating closely linked artificial haplotypes, characterized in that, Includes the following steps: (1) Select the region described in claim 1 as the editing target region; (2) Design three editing target points targeting the region, with the target point sequences as follows: OsRf19-Target1: GGCTCTCTCTTAGATGGAGGAGT; OsRf19-Target2:CATGCTAACTTGATCGAGATATC; OsRf19-Target3:GCGCTGAAGTATACGATTTTGCG; (3) Using the CRISPR / Cas12a gene editing system, targeted editing was performed on the three editing target sites to induce nucleotide insertion or deletion variations in the regions, thereby obtaining the desired results. OsRf19 Closely linked artificial haplotypes.

3. The creation method according to claim 2, characterized in that, The application of the CRISPR / Cas12a gene editing system in step (3) includes: constructing three sgRNA expression cassettes corresponding to the three editing target sites respectively; digesting and ligating the sgRNA expression cassettes with the pZmUbip-Cas12 vector to obtain recombinant vectors; transforming the recombinant vectors into Agrobacterium, and then infecting Agrobacterium-carrying cells with the vectors. OsRf19 The restorer line rice was used to obtain gene-edited lines, and after self-pollination, homozygous artificial haplotype lines were obtained.

4. The creation method according to claim 3, characterized in that, The construction of the sgRNA expression cassette involves two rounds of PCR reactions. In the first round, pUC57-U6a-crRNA12a, pUC57-U6b-crRNA12a, and pUC57-U6c-crRNA12a were used as templates for their respective target sites, and specific primers were used to amplify fragments a and b. In the second round, a mixture of fragments a and b was used as a template, and primers containing BsaI restriction sites were used to amplify the complete sgRNA expression cassette. The primer sequences are as follows: Unit-out-F:GGCTCCACCATGGGAACCAATT; Unit-out-R:CCCGTTGAATATGGCTCATAAC; OsRf19T1-crF: GGCTCCTCTTAGATGGAGGAGGTGGCCGGCATGGTCCCAGCCT; OsRf19T1-crR:ACTCCTCCATCTAAGAGAGAGCCATCTACACTTAGTAGAAATT; OsRf19T2-crF: CGGTAGTTTAATAGAGGGATCCAGGCCGGCATGGTCCCAGCCT; OsRf19T2-crR: TGGATCCCTCTATTAAACTACCGATCTACACTTAGTAGAAATT; OsRf19T3-crF:TCTTCCACGCGCGCAGAACAGATGGCCGGCATGGTCCCAGCCT; OsRf19T3-crR: ATCTGTTCTGCGCGCGTGGAAGAATCTACACTTAGTAGAAATT; Unit1-BsaI-F:TAGAATGggtctcGatgaGATCCAAGAACGAACTAAGCC; Unit1-BsaI-R:CGAGCATggtctcCacttCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit2-BsaI-F:TAGAATGggtctcGaagtGATCCAAGAACGAACTAAGCC; Unit2-BsaI-R:CGAGCATggtctcCgaatCGAGTAAAAAAAGTCCCATTCGCCATGC; Unit3-BsaI-F:TAGAATGggtctcGattcGATCCAAGAACGAACTAAGCC; Unit3-BsaI-R:CGAGCATggtctcCtggaCGAGTAAAAAAAGTCCCATTCGCCATGC.

5. The method of creation according to claim 3, characterized in that, The enzyme digestion-ligation reaction system includes: 10×rCutSmart Buffer 10μL, pZmUbip-Cas12 plasmid 100ng, 3 sgRNA expression cassettes 10ng each, BsaI 1μL, T4 DNA ligase 1μL, and ddH2O to a final volume of 20μL; the reaction conditions are: 37℃ for 30min, followed by 20 cycles (37℃ for 3min, 10℃ for 5min, 20℃ for 5min), and finally 37℃ for 5min.

6. An InDel molecular marker for identifying the artificial haplotype of claim 2, characterized in that, The InDel molecular markers correspond to the upstream and downstream regions of the three editing target sites in claim 2, and the primer sequences are as follows: The primers targeting OsRf19-T1 are: OsRf19T1-F: GAGCATCACTAATATGTTAGC; OsRf19T1-R:CGGTAGTTTAATAGAGGGATC; The primers targeting OsRf19-T2 are: OsRf19T2-F: GGTGGATCCCTCTATTAAACTAC; OsRf19T2-R:CGGAAGGAGTCGTATAAGGTATC; The primers targeting OsRf19-T3 are: OsRf19T3-F:ACCTAGACGCGCTTGCAAACTG; OsRf19T3-R: CCGTGCTATTTGGCGCTGAAGT.

7. The method for identifying artificial haplotypes in rice using the InDel molecular marker of claim 6, characterized in that, Includes the following steps: (1) Using the rice genomic DNA to be identified as a template, PCR amplification was performed using any one or more pairs of primers as described in claim 6. The PCR amplification system was: 10 μL of 2×Rapid Taq Master Mix, 1 μL of primer F, 1 μL of primer R, 1 μL of rice DNA template, and ddH2O was added to make up to 20 μL. The PCR amplification program was: 94℃ for 4 min, 32 cycles (95℃ for 30 s, 58℃ for 15 s, 72℃ for 20 s), and a final extension at 72℃ for 5 min. (2) Perform polyacrylamide gel electrophoresis on the PCR product to determine the length of the PCR product; if the length of the PCR product is consistent with the length of the edited specific region of the artificial haplotype in claim 2, then the rice is a carrier. OsRf19 Rice with tightly linked artificial haplotypes; if the length matches that of an unedited specific region, the rice does not carry the artificial haplotype.

8. The region of claim 1 in the creation and OsRf19 Applications in tightly linked artificial haplotypes.

9. The InDel molecular marker of claim 6 in rice OsRf19 Application in restorer line-assisted breeding.

10. The application of the artificial haplotype created by the method of claim 2 in the three-line breeding of rice CMS-FA / OsRf19 system.